Starting /dee2/code/volunteer_pipeline.sh SRR7166162 current disk space = 3111145807872 free memory = 1278727280 SRR7166162 SRAfilesize 0e50f54e0907aedda36b203264bfc4ba SRR7166162.sra SRR7166162.sra file validated SRR7166162 is paired end SRR7166162 is conventional basespace SRR7166162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88825 33.0 32.0 34.0 30.0 34.0 2 32.28125 33.0 33.0 34.0 29.0 34.0 3 32.209 33.0 32.0 34.0 30.0 34.0 4 32.14175 33.0 32.0 34.0 30.0 34.0 5 32.3675 33.0 33.0 34.0 31.0 34.0 6 36.2605 38.0 37.0 38.0 33.0 38.0 7 36.74175 38.0 37.0 38.0 34.0 38.0 8 36.829 38.0 38.0 38.0 35.0 38.0 9 37.01875 38.0 38.0 38.0 36.0 38.0 10-14 36.94955 38.0 38.0 38.0 35.6 38.0 15-19 36.8855 38.0 38.0 38.0 35.2 38.0 20-24 36.88255 38.0 38.0 38.0 35.2 38.0 25-29 36.67205 38.0 38.0 38.0 34.4 38.0 30-34 36.46215 38.0 38.0 38.0 33.8 38.0 35-39 36.32635 38.0 37.0 38.0 33.8 38.0 40-44 36.25515 38.0 37.0 38.0 33.0 38.0 45-49 36.1479 38.0 37.0 38.0 33.0 38.0 50-54 35.93984999999999 38.0 37.0 38.0 31.0 38.0 55-59 35.7419 38.0 36.2 38.0 30.4 38.0 60-64 35.75305 38.0 36.6 38.0 30.6 38.0 65-69 35.5257 38.0 36.0 38.0 29.0 38.0 70-74 35.57005 38.0 36.2 38.0 29.6 38.0 75-79 34.9649 38.0 35.8 38.0 28.0 38.0 80-84 34.62525 38.0 35.2 38.0 26.6 38.0 85-89 34.76585 38.0 35.0 38.0 26.8 38.0 90-94 34.5796 38.0 34.6 38.0 25.8 38.0 95-99 34.2953 38.0 34.0 38.0 25.0 38.0 100-104 34.0387 38.0 34.0 38.0 23.4 38.0 105-109 33.40925 37.0 33.6 38.0 16.2 38.0 110-114 33.17635 37.0 32.2 38.0 15.0 38.0 115-119 32.556400000000004 37.0 31.0 38.0 15.0 38.0 120-124 32.2315 36.8 30.6 38.0 15.0 38.0 125-129 31.494400000000002 36.0 30.4 38.0 14.6 38.0 130-134 29.58175 34.0 24.4 38.0 13.4 38.0 135-139 28.305449999999997 33.0 21.0 38.0 12.2 38.0 140-144 27.426599999999997 33.0 18.6 38.0 2.0 38.0 145-149 25.0957 33.0 8.8 38.0 2.0 38.0 150-151 18.77125 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 3.0 16 4.0 17 2.0 18 9.0 19 8.0 20 10.0 21 18.0 22 25.0 23 24.0 24 39.0 25 52.0 26 69.0 27 74.0 28 105.0 29 127.0 30 157.0 31 179.0 32 285.0 33 337.0 34 430.0 35 623.0 36 873.0 37 541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.167300380228134 16.65399239543726 11.888466413181241 39.29024081115336 2 18.05 25.5 39.975 16.475 3 16.85 30.95 28.050000000000004 24.15 4 21.3 35.55 21.3 21.85 5 18.55 38.65 23.925 18.875 6 15.475 35.775 26.924999999999997 21.825 7 12.275 19.425 47.199999999999996 21.099999999999998 8 16.8 20.7 29.625 32.875 9 19.0 21.6 30.675 28.725 10-14 18.91 30.04 27.22 23.830000000000002 15-19 18.82 29.01 28.155 24.015 20-24 19.25 29.03 28.07 23.65 25-29 19.505 28.910000000000004 27.955000000000002 23.630000000000003 30-34 19.67 29.415000000000003 27.794999999999998 23.119999999999997 35-39 19.78 28.79 28.53 22.900000000000002 40-44 19.1 29.15 27.865000000000002 23.885 45-49 19.869999999999997 28.4 27.935 23.794999999999998 50-54 19.259999999999998 28.585 28.815 23.34 55-59 19.535 28.975 27.485 24.005000000000003 60-64 19.009999999999998 28.660000000000004 28.005000000000003 24.325 65-69 19.675 28.79 28.194999999999997 23.34 70-74 19.761916670834793 29.11519031661081 27.659680888310913 23.463212124243483 75-79 20.162025316455694 28.32405063291139 27.91392405063291 23.599999999999998 80-84 20.09127789046653 28.351926977687626 27.860040567951316 23.696754563894523 85-89 19.61 28.685 28.610000000000003 23.095 90-94 19.759999999999998 28.884999999999998 27.389999999999997 23.965 95-99 19.775000000000002 29.005 27.605 23.615 100-104 20.21 29.044999999999998 27.66 23.085 105-109 20.355 29.485 26.705000000000002 23.455000000000002 110-114 20.080000000000002 28.675 28.07 23.175 115-119 20.64 28.93 27.815 22.615 120-124 19.941979692892513 28.820087030460662 27.844745660981346 23.393187615665482 125-129 20.322112739458813 28.269894463062073 27.679687890761766 23.72830490671735 130-134 20.023136505381753 28.835127250779603 27.768836133185797 23.372900110652854 135-139 20.73640502276252 27.910350692881085 27.390064535494524 23.963179748861872 140-144 21.189535290880894 28.18268220699315 27.357310789855433 23.27047171227052 145-149 21.26646961575071 27.93447222083062 27.42848554681629 23.370572616602374 150-151 21.5278647463995 26.4996869129618 28.01502817783344 23.95742016280526 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 2.5 23 4.0 24 4.0 25 6.5 26 8.0 27 11.5 28 12.5 29 16.0 30 23.5 31 31.5 32 43.5 33 53.5 34 65.0 35 87.0 36 106.5 37 127.0 38 142.5 39 158.0 40 186.5 41 230.0 42 270.5 43 280.5 44 279.5 45 281.5 46 286.0 47 254.5 48 220.0 49 192.0 50 149.0 51 120.0 52 91.0 53 68.0 54 52.5 55 37.0 56 28.5 57 21.5 58 15.0 59 9.5 60 5.5 61 5.0 62 4.0 63 2.0 64 1.0 65 0.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.034999999999999996 75-79 1.25 80-84 1.4000000000000001 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.034999999999999996 130-134 0.59 135-139 0.055 140-144 0.045 145-149 0.19499999999999998 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4765 33.0 33.0 34.0 32.0 34.0 2 32.5445 33.0 33.0 34.0 31.0 34.0 3 32.73275 33.0 33.0 34.0 32.0 34.0 4 32.5265 33.0 33.0 34.0 31.0 34.0 5 32.61775 33.0 33.0 34.0 32.0 34.0 6 36.72825 38.0 38.0 38.0 35.0 38.0 7 36.7045 38.0 38.0 38.0 35.0 38.0 8 36.75875 38.0 38.0 38.0 35.0 38.0 9 36.56625 38.0 38.0 38.0 34.0 38.0 10-14 36.5148 38.0 38.0 38.0 34.2 38.0 15-19 36.44395000000001 38.0 38.0 38.0 34.0 38.0 20-24 36.24365 38.0 38.0 38.0 33.0 38.0 25-29 36.36835 38.0 38.0 38.0 33.8 38.0 30-34 36.3937 38.0 38.0 38.0 33.8 38.0 35-39 36.2224 38.0 38.0 38.0 33.2 38.0 40-44 36.10275 38.0 38.0 38.0 33.0 38.0 45-49 36.001400000000004 38.0 37.8 38.0 32.2 38.0 50-54 35.9611 38.0 37.6 38.0 31.8 38.0 55-59 35.8768 38.0 37.0 38.0 31.2 38.0 60-64 35.8992 38.0 37.2 38.0 31.0 38.0 65-69 35.6927 38.0 37.0 38.0 30.0 38.0 70-74 35.6335 38.0 37.0 38.0 30.0 38.0 75-79 35.4901 38.0 36.6 38.0 29.6 38.0 80-84 35.21125 38.0 36.0 38.0 28.4 38.0 85-89 35.1427 38.0 36.2 38.0 28.6 38.0 90-94 34.8674 38.0 35.8 38.0 26.6 38.0 95-99 34.75795 38.0 35.8 38.0 26.2 38.0 100-104 34.3437 38.0 34.6 38.0 24.6 38.0 105-109 34.26915 38.0 34.8 38.0 23.0 38.0 110-114 34.043549999999996 38.0 34.0 38.0 22.6 38.0 115-119 33.449 38.0 34.0 38.0 15.0 38.0 120-124 33.1853 38.0 33.2 38.0 16.2 38.0 125-129 32.55525000000001 37.4 31.8 38.0 15.0 38.0 130-134 31.86225 36.8 31.0 38.0 14.2 38.0 135-139 30.5942 36.0 29.4 38.0 12.8 38.0 140-144 29.58485 36.0 27.0 38.0 5.6 38.0 145-149 27.345850000000002 33.4 17.4 38.0 2.0 38.0 150-151 22.02975 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 3.0 6 0.0 7 0.0 8 2.0 9 2.0 10 2.0 11 4.0 12 5.0 13 7.0 14 6.0 15 8.0 16 11.0 17 8.0 18 9.0 19 14.0 20 12.0 21 19.0 22 25.0 23 32.0 24 35.0 25 39.0 26 42.0 27 66.0 28 73.0 29 76.0 30 114.0 31 124.0 32 161.0 33 233.0 34 309.0 35 463.0 36 800.0 37 1286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.849999999999994 13.625000000000002 14.7 36.825 2 21.825 22.325 38.95 16.900000000000002 3 19.1 26.650000000000002 31.5 22.75 4 22.375 37.0 20.625 20.0 5 22.525000000000002 38.7 21.224999999999998 17.549999999999997 6 16.6 38.175 24.85 20.375 7 15.950000000000001 14.475 47.099999999999994 22.475 8 19.400000000000002 21.2 28.549999999999997 30.85 9 21.625 23.150000000000002 29.575000000000003 25.650000000000002 10-14 22.564999999999998 28.799999999999997 26.945000000000004 21.69 15-19 22.86 28.505000000000003 27.425 21.21 20-24 22.43 28.425 28.395 20.75 25-29 22.405 28.28 28.435 20.880000000000003 30-34 22.54 28.225 28.43 20.805 35-39 22.785 28.73 27.560000000000002 20.925 40-44 22.785 28.660000000000004 27.845 20.71 45-49 22.74 28.645 28.03 20.585 50-54 22.46 28.32 28.849999999999998 20.369999999999997 55-59 23.595 28.235 28.505000000000003 19.665 60-64 23.445 28.249999999999996 28.23 20.075000000000003 65-69 23.150000000000002 28.01 28.360000000000003 20.48 70-74 23.32 28.349999999999998 28.285 20.044999999999998 75-79 23.1 28.54 28.194999999999997 20.165 80-84 22.994999999999997 28.249999999999996 28.244999999999997 20.51 85-89 23.705000000000002 28.410000000000004 27.894999999999996 19.99 90-94 23.085 27.644999999999996 29.07 20.200000000000003 95-99 23.415 28.705000000000002 28.275 19.605 100-104 23.54 28.470000000000002 27.884999999999998 20.105 105-109 23.985 28.285 28.199999999999996 19.53 110-114 23.615 28.139999999999997 28.305000000000003 19.939999999999998 115-119 24.205 28.075 28.24 19.48 120-124 23.87 28.465 27.92 19.744999999999997 125-129 24.195 28.04 28.38 19.384999999999998 130-134 24.685000000000002 27.865000000000002 28.58 18.87 135-139 24.855 28.355000000000004 28.075 18.715 140-144 25.195 28.43 27.639999999999997 18.735 145-149 25.374999999999996 27.66 27.725 19.24 150-151 26.075 27.425 27.725 18.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.0 24 4.0 25 6.0 26 5.5 27 4.5 28 6.0 29 8.5 30 12.0 31 19.5 32 29.0 33 46.5 34 58.0 35 70.0 36 94.5 37 116.5 38 142.0 39 172.5 40 212.5 41 234.5 42 265.0 43 304.0 44 283.5 45 274.0 46 279.0 47 256.5 48 219.0 49 194.0 50 163.5 51 129.0 52 109.5 53 75.0 54 52.0 55 45.5 56 34.0 57 22.0 58 14.5 59 6.5 60 3.5 61 4.0 62 4.5 63 3.5 64 3.5 65 3.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0374999999999996 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.512499999999999 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778091 spots for SRR7166162.sra Written 778091 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra Read 778072 spots for SRR7166162.sra Written 778072 spots for SRR7166162.sra SRR ids: ['SRR7166162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qa4u7c28 SRR7166162.sra spots: 15561459 blocks: [[1, 778072], [778073, 1556144], [1556145, 2334216], [2334217, 3112288], [3112289, 3890360], [3890361, 4668432], [4668433, 5446504], [5446505, 6224576], [6224577, 7002648], [7002649, 7780720], [7780721, 8558792], [8558793, 9336864], [9336865, 10114936], [10114937, 10893008], [10893009, 11671080], [11671081, 12449152], [12449153, 13227224], [13227225, 14005296], [14005297, 14783368], [14783369, 15561459]] SRR7166162 file size 5251567 SRR7166162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166162 SRR7166162_1.fastq SRR7166162_2.fastq Input file: SRR7166162_1.fastq Paired file: SRR7166162_2.fastq trimmed: SRR7166162-trimmed-pair1.fastq, SRR7166162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:36:57 2025 >> started Fri Feb 14 17:37:21 2025 >> done (24.083s) 15561459 read pairs processed; of these: 14294 ( 0.09%) short read pairs filtered out after trimming by size control 46213 ( 0.30%) empty read pairs filtered out after trimming by size control 15500952 (99.61%) read pairs available; of these: 10853474 (70.02%) trimmed read pairs available after processing 4647478 (29.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 5 0.00% 31 9 0.00% 32 8 0.00% 33 9 0.00% 34 7 0.00% 35 8 0.00% 36 10 0.00% 37 10 0.00% 38 13 0.00% 39 14 0.00% 40 15 0.00% 41 31 0.00% 42 23 0.00% 43 19 0.00% 44 32 0.00% 45 27 0.00% 46 49 0.00% 47 58 0.00% 48 66 0.00% 49 52 0.00% 50 76 0.00% 51 62 0.00% 52 97 0.00% 53 69 0.00% 54 102 0.00% 55 122 0.00% 56 121 0.00% 57 141 0.00% 58 165 0.00% 59 186 0.00% 60 212 0.00% 61 276 0.00% 62 291 0.00% 63 287 0.00% 64 339 0.00% 65 407 0.00% 66 442 0.00% 67 517 0.00% 68 543 0.00% 69 678 0.00% 70 788 0.01% 71 879 0.01% 72 1038 0.01% 73 1132 0.01% 74 1206 0.01% 75 1433 0.01% 76 1661 0.01% 77 1758 0.01% 78 1964 0.01% 79 2142 0.01% 80 2605 0.02% 81 2736 0.02% 82 3264 0.02% 83 3601 0.02% 84 4494 0.03% 85 4842 0.03% 86 5412 0.03% 87 5969 0.04% 88 6418 0.04% 89 6793 0.04% 90 7285 0.05% 91 8023 0.05% 92 8680 0.06% 93 9290 0.06% 94 10204 0.07% 95 10814 0.07% 96 11496 0.07% 97 12108 0.08% 98 13017 0.08% 99 14093 0.09% 100 15149 0.10% 101 16342 0.11% 102 17580 0.11% 103 18464 0.12% 104 19478 0.13% 105 21196 0.14% 106 22126 0.14% 107 23170 0.15% 108 24406 0.16% 109 25979 0.17% 110 27475 0.18% 111 29078 0.19% 112 31008 0.20% 113 33007 0.21% 114 35203 0.23% 115 37271 0.24% 116 38732 0.25% 117 41169 0.27% 118 43066 0.28% 119 45935 0.30% 120 48270 0.31% 121 50928 0.33% 122 53834 0.35% 123 57602 0.37% 124 61274 0.40% 125 65187 0.42% 126 68808 0.44% 127 72773 0.47% 128 77315 0.50% 129 82459 0.53% 130 88374 0.57% 131 94559 0.61% 132 102743 0.66% 133 111512 0.72% 134 120613 0.78% 135 132455 0.85% 136 139270 0.90% 137 146273 0.94% 138 158575 1.02% 139 173545 1.12% 140 194267 1.25% 141 197834 1.28% 142 217051 1.40% 143 243120 1.57% 144 280066 1.81% 145 333659 2.15% 146 413092 2.66% 147 541506 3.49% 148 755144 4.87% 149 1307293 8.43% 150 3727433 24.05% 151 4647478 29.98% 15500952 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=4.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=486.70 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=34.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=37 prefix-density=0.27 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=463.55 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=32.9 sequence=AAGAAGAAGAAA SRR7166162 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:38:54 Started mapping on | Feb 14 17:38:54 Finished on | Feb 14 17:40:44 Mapping speed, Million of reads per hour | 507.30 Number of input reads | 15500952 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14880131 Uniquely mapped reads % | 95.99% Average mapped length | 289.33 Number of splices: Total | 14801888 Number of splices: Annotated (sjdb) | 14545088 Number of splices: GT/AG | 14565400 Number of splices: GC/AG | 187030 Number of splices: AT/AC | 10701 Number of splices: Non-canonical | 38757 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.03% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381861 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 21330 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253584 253584 253584 N_multimapping 381861 381861 381861 N_noFeature 466846 14713714 564411 N_ambiguous 138735 750 69456 UnstrandedReadsAssigned:14274550 PositiveStrandReadsAssigned:165667 NegativeStrandReadsAssigned:14246264 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR7166162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166162-trimmed-pair1.fastq SRR7166162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,500,952 reads, 14,154,645 reads pseudoaligned [quant] estimated average fragment length: 231.289 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7166162.ke.tsv 34699 SRR7166162.se.tsv 87100 total ==> SRR7166162.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.71 721 30.3618 Potri.005G024800.1.v4.1 1035 804.711 256 23.9491 Potri.004G059700.1.v4.1 961 730.711 34 3.50286 Potri.007G009000.2.v4.1 1416 1185.71 0 0 Potri.003G141000.2.v4.1 2943 2712.71 429.112 11.9085 Potri.016G087400.1.v4.1 270 83.223 1112 1005.89 Potri.015G069301.1.v4.1 564 336.864 0 0 Potri.010G195200.1.v4.1 1773 1542.71 199 9.71087 Potri.012G127500.1.v4.1 977 746.711 2000 201.636 ==> SRR7166162.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 203 SRR7166162 completed mapping pipeline successfully