Starting /dee2/code/volunteer_pipeline.sh SRR7166163 current disk space = 3110540292096 free memory = 1568463168 SRR7166163 SRAfilesize 1f9ccab27f1da6ba119543775338649c SRR7166163.sra SRR7166163.sra file validated SRR7166163 is paired end SRR7166163 is conventional basespace SRR7166163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9605 33.0 32.0 34.0 31.0 34.0 2 32.2735 33.0 33.0 34.0 29.0 34.0 3 32.2965 33.0 33.0 34.0 30.0 34.0 4 32.06275 33.0 33.0 34.0 30.0 34.0 5 32.3715 33.0 33.0 34.0 31.0 34.0 6 36.192 38.0 37.0 38.0 33.0 38.0 7 36.754 38.0 37.0 38.0 34.0 38.0 8 36.81475 38.0 38.0 38.0 34.0 38.0 9 36.97275 38.0 38.0 38.0 35.0 38.0 10-14 36.8878 38.0 38.0 38.0 35.2 38.0 15-19 36.9097 38.0 38.0 38.0 35.2 38.0 20-24 36.93805 38.0 38.0 38.0 35.0 38.0 25-29 36.724599999999995 38.0 38.0 38.0 34.2 38.0 30-34 36.5388 38.0 37.8 38.0 34.0 38.0 35-39 36.3178 38.0 37.2 38.0 33.6 38.0 40-44 36.2703 38.0 37.0 38.0 33.2 38.0 45-49 36.173700000000004 38.0 37.0 38.0 33.0 38.0 50-54 35.9587 38.0 37.0 38.0 31.4 38.0 55-59 35.71055 38.0 36.2 38.0 29.8 38.0 60-64 35.76905 38.0 36.4 38.0 30.2 38.0 65-69 35.49855 38.0 36.0 38.0 29.6 38.0 70-74 35.46155 38.0 36.0 38.0 29.0 38.0 75-79 34.907 38.0 35.8 38.0 27.6 38.0 80-84 34.667 38.0 35.2 38.0 27.4 38.0 85-89 34.8056 38.0 35.0 38.0 27.2 38.0 90-94 34.67495 38.0 34.8 38.0 26.2 38.0 95-99 34.1807 38.0 34.0 38.0 24.6 38.0 100-104 33.9868 38.0 33.8 38.0 22.2 38.0 105-109 33.422200000000004 37.0 33.2 38.0 16.2 38.0 110-114 33.138400000000004 37.0 32.6 38.0 15.0 38.0 115-119 32.526349999999994 37.0 31.0 38.0 15.0 38.0 120-124 32.19969999999999 36.8 30.4 38.0 15.0 38.0 125-129 31.414800000000003 36.0 30.4 38.0 14.6 38.0 130-134 29.571649999999998 33.8 24.4 38.0 13.2 38.0 135-139 28.154200000000003 33.0 20.8 38.0 12.2 38.0 140-144 27.334000000000003 33.0 18.4 38.0 2.0 38.0 145-149 24.9078 33.0 8.4 38.0 2.0 38.0 150-151 18.777749999999997 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 4.0 15 1.0 16 3.0 17 1.0 18 2.0 19 8.0 20 11.0 21 12.0 22 22.0 23 32.0 24 41.0 25 66.0 26 58.0 27 75.0 28 117.0 29 120.0 30 147.0 31 193.0 32 284.0 33 353.0 34 441.0 35 635.0 36 856.0 37 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.84412955465587 19.003036437246966 9.286437246963562 38.8663967611336 2 18.075 28.675 36.8 16.45 3 16.85 30.275000000000002 27.275 25.6 4 19.55 39.65 21.875 18.925 5 19.825 38.074999999999996 23.075000000000003 19.025 6 15.8 37.925 24.65 21.625 7 11.899999999999999 19.475 47.099999999999994 21.525 8 17.25 20.349999999999998 29.299999999999997 33.1 9 18.65 20.849999999999998 31.225 29.275000000000002 10-14 18.745 31.16 26.16 23.935000000000002 15-19 19.39 28.754999999999995 28.244999999999997 23.61 20-24 19.54 29.220000000000002 27.815 23.425 25-29 19.82 28.925 27.74 23.515 30-34 19.2 29.54 27.875 23.385 35-39 19.24 29.57 27.889999999999997 23.3 40-44 19.400000000000002 29.34 27.73 23.53 45-49 19.13 29.255 27.88 23.735 50-54 19.634999999999998 28.58 27.88 23.905 55-59 19.205 28.044999999999998 29.195 23.555 60-64 19.63 29.595 27.250000000000004 23.525 65-69 20.01 28.84 28.310000000000002 22.84 70-74 19.736973697369738 28.987898789878987 28.08780878087809 23.187318731873187 75-79 19.826931835433427 28.444916755224938 28.21213501341025 23.51601639593138 80-84 19.932055572457156 28.952438900720008 27.887638170570938 23.227867356251902 85-89 19.830000000000002 28.895 27.865000000000002 23.41 90-94 20.135 29.175 27.105 23.585 95-99 19.705000000000002 29.080000000000002 27.834999999999997 23.380000000000003 100-104 20.005 28.62 27.98 23.395 105-109 20.14 28.585 27.42 23.855 110-114 19.825 28.939999999999998 27.51 23.724999999999998 115-119 20.45 28.994999999999997 27.450000000000003 23.105 120-124 19.91194716830098 28.672203321993194 27.9467680608365 23.46908144886932 125-129 20.1970197019702 28.897889788978897 27.602760276027606 23.3023302330233 130-134 20.39460438896718 28.946043889671834 26.907590094624524 23.75176162673646 135-139 20.576605435707492 28.7802192301917 27.14850593122779 23.49466940287302 140-144 20.476381104883906 28.672938350680543 26.761409127301842 24.089271417133705 145-149 20.874931018913358 28.620879947825212 26.789745647920533 23.714443385340893 150-151 21.280862263441534 26.78280486276476 27.37185110916155 24.56448176463216 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 1.5 20 1.5 21 2.0 22 2.5 23 3.0 24 3.0 25 2.5 26 7.0 27 13.0 28 13.5 29 13.5 30 23.0 31 27.0 32 34.0 33 42.0 34 57.5 35 81.5 36 94.0 37 125.0 38 162.0 39 199.5 40 228.5 41 250.5 42 289.5 43 303.5 44 284.5 45 253.0 46 249.0 47 239.0 48 208.5 49 179.0 50 148.0 51 123.0 52 91.5 53 69.0 54 45.0 55 28.0 56 28.0 57 23.0 58 13.0 59 9.5 60 6.0 61 4.5 62 3.5 63 3.0 64 2.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 1.195 80-84 1.39 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06 125-129 0.01 130-134 0.66 135-139 0.105 140-144 0.08 145-149 0.335 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.9 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.487 33.0 33.0 34.0 32.0 34.0 2 32.57075 33.0 33.0 34.0 32.0 34.0 3 32.68925 33.0 33.0 34.0 32.0 34.0 4 32.5405 33.0 33.0 34.0 32.0 34.0 5 32.55925 33.0 33.0 34.0 32.0 34.0 6 36.7295 38.0 38.0 38.0 35.0 38.0 7 36.74125 38.0 38.0 38.0 35.0 38.0 8 36.79875 38.0 38.0 38.0 35.0 38.0 9 36.729 38.0 38.0 38.0 35.0 38.0 10-14 36.571749999999994 38.0 38.0 38.0 34.4 38.0 15-19 36.48655000000001 38.0 38.0 38.0 34.0 38.0 20-24 36.30645 38.0 38.0 38.0 33.6 38.0 25-29 36.49275 38.0 38.0 38.0 34.0 38.0 30-34 36.459050000000005 38.0 38.0 38.0 34.0 38.0 35-39 36.29255 38.0 38.0 38.0 33.8 38.0 40-44 36.1333 38.0 37.8 38.0 33.0 38.0 45-49 35.878150000000005 38.0 37.4 38.0 31.6 38.0 50-54 35.920399999999994 38.0 37.2 38.0 31.4 38.0 55-59 35.929750000000006 38.0 37.0 38.0 31.8 38.0 60-64 35.92190000000001 38.0 37.0 38.0 31.8 38.0 65-69 35.7744 38.0 37.0 38.0 31.0 38.0 70-74 35.6723 38.0 37.0 38.0 29.8 38.0 75-79 35.396249999999995 38.0 36.6 38.0 29.6 38.0 80-84 35.125299999999996 38.0 36.0 38.0 28.6 38.0 85-89 35.098699999999994 38.0 36.0 38.0 28.2 38.0 90-94 34.88805000000001 38.0 35.8 38.0 27.2 38.0 95-99 34.75725 38.0 36.0 38.0 26.0 38.0 100-104 34.333749999999995 38.0 34.8 38.0 24.0 38.0 105-109 34.274300000000004 38.0 34.8 38.0 23.8 38.0 110-114 34.1017 38.0 34.6 38.0 21.6 38.0 115-119 33.50285000000001 38.0 34.0 38.0 16.2 38.0 120-124 33.15045 38.0 33.2 38.0 16.2 38.0 125-129 32.52419999999999 37.4 32.2 38.0 15.0 38.0 130-134 31.53775 36.8 31.0 38.0 14.2 38.0 135-139 30.5246 36.0 28.6 38.0 12.8 38.0 140-144 29.47065 36.0 27.0 38.0 3.8 38.0 145-149 27.018400000000003 33.6 15.2 38.0 2.0 38.0 150-151 21.32575 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 7.0 4 3.0 5 3.0 6 0.0 7 3.0 8 1.0 9 4.0 10 4.0 11 1.0 12 3.0 13 7.0 14 2.0 15 3.0 16 5.0 17 11.0 18 8.0 19 10.0 20 12.0 21 19.0 22 21.0 23 33.0 24 41.0 25 33.0 26 65.0 27 65.0 28 63.0 29 81.0 30 109.0 31 121.0 32 182.0 33 237.0 34 297.0 35 473.0 36 829.0 37 1239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.24362181090545 14.85742871435718 13.556778389194598 34.34217108554277 2 21.61080540270135 24.16208104052026 38.26913456728364 15.957978989494748 3 20.060030015007506 25.68784392196098 32.59129564782391 21.660830415207606 4 24.0180135101326 35.876907680760574 20.815611708781585 19.289467100325243 5 22.377972465581976 39.34918648310388 20.876095118898625 17.39674593241552 6 16.925 39.375 24.8 18.9 7 17.349999999999998 14.124999999999998 47.15 21.375 8 19.900000000000002 21.275 29.825000000000003 28.999999999999996 9 23.0 22.575 28.7 25.724999999999998 10-14 22.725 29.12 27.255000000000003 20.9 15-19 22.49 28.360000000000003 28.505000000000003 20.645 20-24 22.695 28.83 27.83 20.645 25-29 22.785 27.915 28.84 20.46 30-34 22.66 28.744999999999997 28.810000000000002 19.785 35-39 22.999599919983996 28.160632126425284 28.025605121024206 20.814162832566513 40-44 22.57 28.17 29.185 20.075000000000003 45-49 22.725 28.18 28.92 20.175 50-54 22.915 28.310000000000002 28.7 20.075000000000003 55-59 23.061153057652884 28.496424821241064 28.31641582079104 20.126006300315016 60-64 22.945 27.965 28.985 20.105 65-69 23.015 28.12 28.71 20.155 70-74 23.075000000000003 28.249999999999996 28.33 20.345 75-79 23.369999999999997 28.02 28.599999999999998 20.01 80-84 22.86 28.395 28.799999999999997 19.945 85-89 23.605 27.994999999999997 28.325 20.075000000000003 90-94 22.67 28.22 28.749999999999996 20.36 95-99 23.735 28.384999999999998 27.779999999999998 20.1 100-104 23.54324013404692 28.16985945080778 28.024808683039065 20.26209173210624 105-109 23.70778083562672 28.19114335751814 28.71653740305229 19.384538403802853 110-114 23.769507803121247 28.0062024809924 28.311324529811927 19.91296518607443 115-119 23.851192559627982 28.106405320266013 28.441422071103556 19.60098004900245 120-124 23.785 28.58 28.01 19.625 125-129 23.965 28.185 28.060000000000002 19.79 130-134 23.880000000000003 28.575 27.715 19.830000000000002 135-139 25.290000000000003 27.750000000000004 28.37 18.59 140-144 24.490000000000002 28.555000000000003 27.57 19.384999999999998 145-149 24.925 27.67 28.315 19.09 150-151 26.187500000000004 27.2625 28.287499999999998 18.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 2.0 24 4.5 25 6.5 26 5.5 27 7.5 28 12.5 29 16.0 30 16.0 31 22.0 32 32.0 33 35.5 34 49.0 35 81.0 36 102.0 37 122.0 38 163.0 39 181.0 40 211.5 41 252.5 42 266.0 43 276.0 44 270.0 45 278.5 46 284.0 47 255.0 48 219.5 49 190.5 50 157.0 51 127.0 52 99.0 53 73.0 54 53.5 55 31.0 56 23.0 57 20.5 58 13.5 59 9.0 60 7.0 61 5.0 62 4.0 63 4.0 64 2.0 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.075 110-114 0.04 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.17557060446450964 0.35000000000000003 3 0.0 0.0 4 0.05016302984700275 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.487500000000001 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.449999999999999 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCAA 10 0.006830828 145.0 4 CAATGCA 10 0.006830828 145.0 8 TTGAGGC 10 0.006830828 145.0 2 GCAATGC 10 0.006830828 145.0 7 TGAGGCA 10 0.006830828 145.0 3 AATGCAG 10 0.006830828 145.0 9 CATAAAA 10 0.006830828 145.0 145 >>END_MODULE Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816196 spots for SRR7166163.sra Written 816196 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra Read 816178 spots for SRR7166163.sra Written 816178 spots for SRR7166163.sra SRR ids: ['SRR7166163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55r0vtcp SRR7166163.sra spots: 16323578 blocks: [[1, 816178], [816179, 1632356], [1632357, 2448534], [2448535, 3264712], [3264713, 4080890], [4080891, 4897068], [4897069, 5713246], [5713247, 6529424], [6529425, 7345602], [7345603, 8161780], [8161781, 8977958], [8977959, 9794136], [9794137, 10610314], [10610315, 11426492], [11426493, 12242670], [12242671, 13058848], [13058849, 13875026], [13875027, 14691204], [14691205, 15507382], [15507383, 16323578]] SRR7166163 file size 5509824 SRR7166163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166163 SRR7166163_1.fastq SRR7166163_2.fastq Input file: SRR7166163_1.fastq Paired file: SRR7166163_2.fastq trimmed: SRR7166163-trimmed-pair1.fastq, SRR7166163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:05:51 2025 >> started Fri Feb 14 19:06:09 2025 >> done (17.820s) 16323578 read pairs processed; of these: 13532 ( 0.08%) short read pairs filtered out after trimming by size control 10413 ( 0.06%) empty read pairs filtered out after trimming by size control 16299633 (99.85%) read pairs available; of these: 11344351 (69.60%) trimmed read pairs available after processing 4955282 (30.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 3 0.00% 24 1 0.00% 25 5 0.00% 26 9 0.00% 27 11 0.00% 28 8 0.00% 29 11 0.00% 30 8 0.00% 31 8 0.00% 32 8 0.00% 33 9 0.00% 34 14 0.00% 35 22 0.00% 36 10 0.00% 37 8 0.00% 38 7 0.00% 39 17 0.00% 40 13 0.00% 41 15 0.00% 42 24 0.00% 43 22 0.00% 44 31 0.00% 45 33 0.00% 46 28 0.00% 47 28 0.00% 48 44 0.00% 49 59 0.00% 50 63 0.00% 51 65 0.00% 52 73 0.00% 53 88 0.00% 54 94 0.00% 55 105 0.00% 56 119 0.00% 57 138 0.00% 58 155 0.00% 59 189 0.00% 60 214 0.00% 61 215 0.00% 62 251 0.00% 63 299 0.00% 64 294 0.00% 65 343 0.00% 66 388 0.00% 67 487 0.00% 68 537 0.00% 69 608 0.00% 70 711 0.00% 71 873 0.01% 72 936 0.01% 73 983 0.01% 74 1163 0.01% 75 1343 0.01% 76 1458 0.01% 77 1624 0.01% 78 1811 0.01% 79 2008 0.01% 80 2382 0.01% 81 2571 0.02% 82 2863 0.02% 83 3425 0.02% 84 4099 0.03% 85 4627 0.03% 86 5059 0.03% 87 5484 0.03% 88 5818 0.04% 89 6124 0.04% 90 6846 0.04% 91 7487 0.05% 92 8141 0.05% 93 8926 0.05% 94 9504 0.06% 95 10009 0.06% 96 10745 0.07% 97 11421 0.07% 98 12117 0.07% 99 13175 0.08% 100 14288 0.09% 101 15060 0.09% 102 16165 0.10% 103 17582 0.11% 104 18747 0.12% 105 19879 0.12% 106 20536 0.13% 107 21663 0.13% 108 22983 0.14% 109 24395 0.15% 110 25783 0.16% 111 27159 0.17% 112 29291 0.18% 113 31538 0.19% 114 33533 0.21% 115 35363 0.22% 116 36856 0.23% 117 38600 0.24% 118 41382 0.25% 119 43245 0.27% 120 46253 0.28% 121 49105 0.30% 122 52120 0.32% 123 55492 0.34% 124 59890 0.37% 125 63097 0.39% 126 67442 0.41% 127 71914 0.44% 128 75901 0.47% 129 81773 0.50% 130 87595 0.54% 131 94410 0.58% 132 102657 0.63% 133 111099 0.68% 134 122077 0.75% 135 134700 0.83% 136 142621 0.87% 137 148778 0.91% 138 161372 0.99% 139 177855 1.09% 140 201592 1.24% 141 203962 1.25% 142 224906 1.38% 143 253870 1.56% 144 294132 1.80% 145 352239 2.16% 146 436395 2.68% 147 574845 3.53% 148 807476 4.95% 149 1401582 8.60% 150 3994216 24.50% 151 4955282 30.40% 16299633 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.3 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=458.89 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.87 fanout-score-rank=18 prefix-density=0.44 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=446.35 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=34.4 sequence=AAGAAGAAGAAA SRR7166163 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:07:08 Started mapping on | Feb 14 19:07:09 Finished on | Feb 14 19:08:57 Mapping speed, Million of reads per hour | 543.32 Number of input reads | 16299633 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15535601 Uniquely mapped reads % | 95.31% Average mapped length | 290.04 Number of splices: Total | 15540092 Number of splices: Annotated (sjdb) | 15248631 Number of splices: GT/AG | 15289184 Number of splices: GC/AG | 200652 Number of splices: AT/AC | 11626 Number of splices: Non-canonical | 38630 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414656 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 22957 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363661 363661 363661 N_multimapping 414656 414656 414656 N_noFeature 562335 15347167 678612 N_ambiguous 149648 916 76886 UnstrandedReadsAssigned:14823618 PositiveStrandReadsAssigned:187518 NegativeStrandReadsAssigned:14780103 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=139 echo kmer=135 SRR7166163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166163-trimmed-pair1.fastq SRR7166163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,299,633 reads, 14,704,681 reads pseudoaligned [quant] estimated average fragment length: 236.72 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 978 rounds 52401 SRR7166163.ke.tsv 34699 SRR7166163.se.tsv 87100 total ==> SRR7166163.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.28 1221 48.0493 Potri.005G024800.1.v4.1 1035 799.28 584 51.2462 Potri.004G059700.1.v4.1 961 725.28 29 2.8044 Potri.007G009000.2.v4.1 1416 1180.28 0 0 Potri.003G141000.2.v4.1 2943 2707.28 544.595 14.1087 Potri.016G087400.1.v4.1 270 80.862 993.201 861.47 Potri.015G069301.1.v4.1 564 331.828 0 0 Potri.010G195200.1.v4.1 1773 1537.28 230.806 10.5303 Potri.012G127500.1.v4.1 977 741.28 3311 313.274 ==> SRR7166163.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 451 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 170 SRR7166163 completed mapping pipeline successfully