Starting /dee2/code/volunteer_pipeline.sh SRR7166164 current disk space = 3110611496960 free memory = 1448676008 SRR7166164 SRAfilesize ec1cb2bec02209a996a0b0bd16daa37f SRR7166164.sra SRR7166164.sra file validated SRR7166164 is paired end SRR7166164 is conventional basespace SRR7166164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.063 18.0 18.0 28.0 18.0 33.0 2 23.59875 18.0 18.0 30.0 18.0 33.0 3 28.5505 29.0 27.0 31.0 25.0 33.0 4 30.4915 32.0 31.0 33.0 25.0 33.0 5 31.68475 33.0 32.0 33.0 30.0 33.0 6 35.37475 37.0 35.0 38.0 31.0 38.0 7 36.27975 38.0 36.0 38.0 33.0 38.0 8 37.08375 38.0 38.0 38.0 35.0 38.0 9 37.29425 38.0 38.0 38.0 36.0 38.0 10-14 37.456900000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.533899999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.59125 38.0 38.0 38.0 37.8 38.0 25-29 37.5717 38.0 38.0 38.0 38.0 38.0 30-34 37.533 38.0 38.0 38.0 37.6 38.0 35-39 37.54015 38.0 38.0 38.0 37.6 38.0 40-44 37.48115 38.0 38.0 38.0 37.0 38.0 45-49 37.4313 38.0 38.0 38.0 37.0 38.0 50-54 37.32445 38.0 38.0 38.0 37.0 38.0 55-59 37.02570000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.15975 38.0 38.0 38.0 36.2 38.0 65-69 37.24235 38.0 38.0 38.0 36.8 38.0 70-74 37.20895 38.0 38.0 38.0 36.2 38.0 75-79 37.1171 38.0 38.0 38.0 36.0 38.0 80-84 36.9288 38.0 38.0 38.0 35.6 38.0 85-89 36.798950000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.7692 38.0 38.0 38.0 34.8 38.0 95-99 36.62785 38.0 38.0 38.0 34.4 38.0 100-104 36.553250000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.2883 38.0 38.0 38.0 33.8 38.0 110-114 36.362750000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.0354 38.0 37.4 38.0 33.0 38.0 120-124 35.71825 38.0 36.6 38.0 31.4 38.0 125-129 35.71714999999999 38.0 36.6 38.0 31.4 38.0 130-134 35.5848 38.0 36.0 38.0 31.2 38.0 135-139 35.331900000000005 38.0 36.0 38.0 30.4 38.0 140-144 35.1764 38.0 35.8 38.0 30.0 38.0 145-149 34.6725 38.0 35.0 38.0 28.0 38.0 150-151 31.3975 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 1.0 18 1.0 19 3.0 20 4.0 21 2.0 22 4.0 23 5.0 24 8.0 25 8.0 26 11.0 27 17.0 28 23.0 29 17.0 30 36.0 31 54.0 32 68.0 33 114.0 34 177.0 35 285.0 36 829.0 37 2327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.70109665901556 22.5707727620505 10.226982912522315 35.50114766641163 2 17.775 28.549999999999997 35.425000000000004 18.25 3 16.900000000000002 33.4 25.75 23.95 4 19.225 39.6 21.5 19.675 5 19.625 38.574999999999996 23.075000000000003 18.725 6 16.45 37.65 24.55 21.349999999999998 7 11.924999999999999 19.675 47.199999999999996 21.2 8 19.25 20.25 27.575 32.925 9 18.4 21.125 30.725 29.75 10-14 19.395 30.245 26.334999999999997 24.025 15-19 19.31 28.994999999999997 28.084999999999997 23.61 20-24 19.86 28.715000000000003 27.939999999999998 23.485 25-29 19.34 29.235 28.435 22.99 30-34 19.555 29.395 27.575 23.474999999999998 35-39 19.265 29.5 27.66 23.575 40-44 19.295 29.609999999999996 27.555000000000003 23.54 45-49 19.905 29.62 27.134999999999998 23.34 50-54 20.27054108216433 28.68236472945892 27.5751503006012 23.471943887775552 55-59 19.633851119628808 28.802703247932214 27.945329836594713 23.61811579584426 60-64 20.209355905038564 28.99429029349895 27.576880697185214 23.21947310427727 65-69 20.16 28.52 27.694999999999997 23.625 70-74 19.66 28.994999999999997 28.04 23.305 75-79 19.994999999999997 28.4 28.015 23.59 80-84 20.14 29.025000000000002 27.63 23.205000000000002 85-89 19.97 29.160000000000004 26.955000000000002 23.915 90-94 20.285 29.18 27.450000000000003 23.085 95-99 20.294999999999998 28.544999999999998 27.825 23.335 100-104 20.435 28.65 28.02 22.895 105-109 20.089173889083714 29.071689795100447 27.343319472972293 23.495816842843546 110-114 20.244999999999997 28.43 28.050000000000004 23.275000000000002 115-119 20.810000000000002 28.99 27.375 22.825 120-124 20.47 28.694999999999997 27.38 23.455000000000002 125-129 20.715 28.29 27.189999999999998 23.805 130-134 20.135 28.595 27.265 24.005000000000003 135-139 20.655 28.49 27.265 23.59 140-144 20.674999999999997 28.050000000000004 27.77 23.505000000000003 145-149 20.405 28.310000000000002 27.1 24.185000000000002 150-151 20.715089386173272 28.86610826353294 26.465808226028255 23.952994124265533 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.5 21 3.0 22 1.5 23 2.0 24 4.5 25 5.0 26 4.5 27 8.0 28 13.0 29 13.5 30 16.5 31 30.0 32 43.0 33 52.5 34 76.0 35 92.5 36 106.0 37 135.5 38 165.5 39 187.5 40 203.0 41 230.0 42 247.0 43 262.0 44 274.0 45 250.5 46 236.5 47 246.0 48 228.5 49 178.0 50 138.5 51 122.0 52 103.5 53 83.5 54 66.5 55 48.5 56 34.5 57 21.0 58 13.5 59 11.0 60 8.5 61 7.0 62 5.0 63 4.5 64 3.5 65 3.0 66 1.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.2 55-59 0.86 60-64 0.16999999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.19499999999999998 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.137499999999999 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.75 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.775 0.0 0.0 0.0 0.0 138-139 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAGAA 10 0.006601011 146.64557 1 ACAGAAC 10 0.0068573058 144.8125 2 >>END_MODULE SRR7166164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0785 33.0 33.0 34.0 32.0 34.0 2 33.09475 34.0 33.0 34.0 32.0 34.0 3 33.23075 34.0 33.0 34.0 33.0 34.0 4 33.20875 34.0 33.0 34.0 33.0 34.0 5 33.209 34.0 33.0 34.0 33.0 34.0 6 37.404 38.0 38.0 38.0 37.0 38.0 7 37.39225 38.0 38.0 38.0 37.0 38.0 8 37.37525 38.0 38.0 38.0 37.0 38.0 9 37.3435 38.0 38.0 38.0 37.0 38.0 10-14 37.3695 38.0 38.0 38.0 37.0 38.0 15-19 37.38275 38.0 38.0 38.0 37.0 38.0 20-24 37.3611 38.0 38.0 38.0 37.0 38.0 25-29 37.33835 38.0 38.0 38.0 37.0 38.0 30-34 37.28175 38.0 38.0 38.0 37.0 38.0 35-39 37.243199999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.221399999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.09885 38.0 38.0 38.0 36.2 38.0 50-54 37.002849999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.9305 38.0 38.0 38.0 36.0 38.0 60-64 36.93175 38.0 38.0 38.0 35.8 38.0 65-69 36.9514 38.0 38.0 38.0 36.0 38.0 70-74 36.85085 38.0 38.0 38.0 35.4 38.0 75-79 36.754650000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.66 38.0 38.0 38.0 34.4 38.0 85-89 36.5563 38.0 38.0 38.0 34.0 38.0 90-94 36.27915 38.0 37.8 38.0 33.6 38.0 95-99 36.097300000000004 38.0 37.0 38.0 33.0 38.0 100-104 35.92275000000001 38.0 37.0 38.0 32.6 38.0 105-109 35.7989 38.0 37.0 38.0 32.0 38.0 110-114 35.46505 38.0 36.4 38.0 30.2 38.0 115-119 35.3843 38.0 36.0 38.0 29.8 38.0 120-124 34.96084999999999 38.0 35.8 38.0 27.6 38.0 125-129 34.90525 38.0 35.4 38.0 27.8 38.0 130-134 34.5152 38.0 35.0 38.0 26.2 38.0 135-139 33.9387 38.0 34.4 38.0 22.6 38.0 140-144 33.5965 38.0 34.2 38.0 21.0 38.0 145-149 32.35125 38.0 32.8 38.0 11.8 38.0 150-151 27.872374999999998 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 3.0 13 0.0 14 1.0 15 2.0 16 4.0 17 2.0 18 10.0 19 5.0 20 5.0 21 10.0 22 8.0 23 14.0 24 11.0 25 17.0 26 11.0 27 16.0 28 37.0 29 30.0 30 46.0 31 66.0 32 94.0 33 131.0 34 189.0 35 332.0 36 778.0 37 2172.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.175 17.275 14.149999999999999 29.4 2 24.975 22.85 35.85 16.325 3 21.224999999999998 25.874999999999996 32.5 20.4 4 22.825 36.175000000000004 21.5 19.5 5 22.775000000000002 38.6 21.675 16.950000000000003 6 18.075 38.75 23.05 20.125 7 15.950000000000001 15.975 46.85 21.224999999999998 8 20.849999999999998 20.825 28.225 30.099999999999998 9 21.525 23.575 29.425 25.474999999999998 10-14 22.955000000000002 28.410000000000004 27.26 21.375 15-19 23.095 27.605 28.035 21.265 20-24 22.425 28.685 28.4 20.49 25-29 22.6 28.325 28.4 20.674999999999997 30-34 23.015 27.775 28.775000000000002 20.435 35-39 23.005 28.265 28.025 20.705000000000002 40-44 22.63 27.450000000000003 28.64 21.279999999999998 45-49 23.044999999999998 27.62 28.410000000000004 20.925 50-54 23.155 28.28 28.73 19.835 55-59 22.835 28.075 28.525 20.565 60-64 22.665 28.4 28.465 20.47 65-69 23.535 27.665 28.549999999999997 20.25 70-74 22.95 28.384999999999998 28.365000000000002 20.3 75-79 23.244999999999997 28.12 28.105000000000004 20.53 80-84 23.419999999999998 28.24 27.884999999999998 20.455000000000002 85-89 23.18 27.800000000000004 28.294999999999998 20.724999999999998 90-94 23.635 27.82 28.53 20.015 95-99 23.835 28.26 27.944999999999997 19.96 100-104 23.695 27.865000000000002 28.199999999999996 20.24 105-109 23.93 28.57 27.605 19.895 110-114 24.075 28.105000000000004 27.994999999999997 19.825 115-119 24.27 27.85 27.905 19.975 120-124 24.625 28.000000000000004 27.889999999999997 19.485 125-129 24.43 27.639999999999997 28.025 19.905 130-134 24.404999999999998 28.46 27.560000000000002 19.575 135-139 24.705 27.82 28.15 19.325 140-144 25.064999999999998 28.000000000000004 27.605 19.33 145-149 25.235000000000003 27.525 28.13 19.11 150-151 24.887500000000003 27.35 28.262500000000003 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 5.0 24 5.0 25 4.0 26 5.5 27 8.5 28 8.0 29 8.5 30 12.5 31 14.5 32 30.0 33 43.0 34 49.0 35 66.5 36 88.0 37 116.0 38 154.0 39 187.5 40 218.0 41 236.0 42 248.0 43 270.0 44 291.0 45 297.0 46 266.5 47 236.0 48 217.0 49 196.5 50 170.0 51 126.5 52 98.0 53 76.0 54 58.5 55 46.5 56 34.0 57 30.0 58 19.0 59 13.0 60 10.0 61 6.5 62 5.5 63 5.5 64 4.5 65 1.5 66 2.0 67 2.0 68 2.5 69 2.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47116595316041 98.75 2 0.4784688995215311 0.95 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02518257365902795 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 7.0875 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCAA 10 0.006830828 145.0 9 >>END_MODULE Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902450 spots for SRR7166164.sra Written 902450 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra Read 902442 spots for SRR7166164.sra Written 902442 spots for SRR7166164.sra SRR ids: ['SRR7166164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n8hq0dq2 SRR7166164.sra spots: 18048848 blocks: [[1, 902442], [902443, 1804884], [1804885, 2707326], [2707327, 3609768], [3609769, 4512210], [4512211, 5414652], [5414653, 6317094], [6317095, 7219536], [7219537, 8121978], [8121979, 9024420], [9024421, 9926862], [9926863, 10829304], [10829305, 11731746], [11731747, 12634188], [12634189, 13536630], [13536631, 14439072], [14439073, 15341514], [15341515, 16243956], [16243957, 17146398], [17146399, 18048848]] SRR7166164 file size 6094461 SRR7166164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166164 SRR7166164_1.fastq SRR7166164_2.fastq Input file: SRR7166164_1.fastq Paired file: SRR7166164_2.fastq trimmed: SRR7166164-trimmed-pair1.fastq, SRR7166164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:14:30 2025 >> started Fri Feb 14 18:15:11 2025 >> done (40.750s) 18048848 read pairs processed; of these: 11750 ( 0.07%) short read pairs filtered out after trimming by size control 12484 ( 0.07%) empty read pairs filtered out after trimming by size control 18024614 (99.87%) read pairs available; of these: 8186585 (45.42%) trimmed read pairs available after processing 9838029 (54.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 11 0.00% 21 7 0.00% 22 7 0.00% 23 6 0.00% 24 6 0.00% 25 7 0.00% 26 7 0.00% 27 7 0.00% 28 11 0.00% 29 7 0.00% 30 6 0.00% 31 12 0.00% 32 9 0.00% 33 5 0.00% 34 11 0.00% 35 11 0.00% 36 19 0.00% 37 9 0.00% 38 7 0.00% 39 16 0.00% 40 13 0.00% 41 16 0.00% 42 17 0.00% 43 19 0.00% 44 24 0.00% 45 20 0.00% 46 36 0.00% 47 32 0.00% 48 38 0.00% 49 34 0.00% 50 66 0.00% 51 67 0.00% 52 72 0.00% 53 72 0.00% 54 93 0.00% 55 89 0.00% 56 105 0.00% 57 131 0.00% 58 170 0.00% 59 174 0.00% 60 225 0.00% 61 251 0.00% 62 226 0.00% 63 255 0.00% 64 351 0.00% 65 397 0.00% 66 384 0.00% 67 492 0.00% 68 578 0.00% 69 737 0.00% 70 807 0.00% 71 886 0.00% 72 1012 0.01% 73 1220 0.01% 74 1331 0.01% 75 1508 0.01% 76 1701 0.01% 77 1845 0.01% 78 2140 0.01% 79 2398 0.01% 80 2791 0.02% 81 3198 0.02% 82 3775 0.02% 83 4270 0.02% 84 5318 0.03% 85 5843 0.03% 86 6006 0.03% 87 6579 0.04% 88 6895 0.04% 89 7506 0.04% 90 8183 0.05% 91 9039 0.05% 92 9947 0.06% 93 10881 0.06% 94 11790 0.07% 95 12413 0.07% 96 13126 0.07% 97 13610 0.08% 98 14520 0.08% 99 16618 0.09% 100 16315 0.09% 101 17250 0.10% 102 18582 0.10% 103 20084 0.11% 104 21350 0.12% 105 22486 0.12% 106 23518 0.13% 107 23858 0.13% 108 24860 0.14% 109 25743 0.14% 110 26970 0.15% 111 28633 0.16% 112 30396 0.17% 113 32280 0.18% 114 33624 0.19% 115 35646 0.20% 116 37099 0.21% 117 37845 0.21% 118 38683 0.21% 119 39958 0.22% 120 40973 0.23% 121 42841 0.24% 122 44677 0.25% 123 46731 0.26% 124 49900 0.28% 125 51617 0.29% 126 53289 0.30% 127 54792 0.30% 128 55671 0.31% 129 57554 0.32% 130 59620 0.33% 131 61474 0.34% 132 64214 0.36% 133 68070 0.38% 134 71551 0.40% 135 75142 0.42% 136 79043 0.44% 137 82016 0.46% 138 86974 0.48% 139 91356 0.51% 140 97005 0.54% 141 104934 0.58% 142 114287 0.63% 143 126534 0.70% 144 145157 0.81% 145 170188 0.94% 146 208023 1.15% 147 278295 1.54% 148 411176 2.28% 149 783355 4.35% 150 3762413 20.87% 151 9838029 54.58% 18024614 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=15.16 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.6 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.79 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=33.94 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166164 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:16:56 Started mapping on | Feb 14 18:16:56 Finished on | Feb 14 18:20:13 Mapping speed, Million of reads per hour | 329.38 Number of input reads | 18024614 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16643745 Uniquely mapped reads % | 92.34% Average mapped length | 293.22 Number of splices: Total | 16004875 Number of splices: Annotated (sjdb) | 15660203 Number of splices: GT/AG | 15729492 Number of splices: GC/AG | 214996 Number of splices: AT/AC | 12103 Number of splices: Non-canonical | 48284 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429385 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 43073 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961334 961334 961334 N_multimapping 429385 429385 429385 N_noFeature 622642 16417283 756674 N_ambiguous 177691 1228 84401 UnstrandedReadsAssigned:15843412 PositiveStrandReadsAssigned:225234 NegativeStrandReadsAssigned:15802670 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166164-trimmed-pair1.fastq SRR7166164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,024,614 reads, 15,704,654 reads pseudoaligned [quant] estimated average fragment length: 236.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7166164.ke.tsv 34699 SRR7166164.se.tsv 87100 total ==> SRR7166164.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.96 1603 54.582 Potri.005G024800.1.v4.1 1035 799.963 577 43.7889 Potri.004G059700.1.v4.1 961 726.015 33 2.75948 Potri.007G009000.2.v4.1 1416 1180.96 0 0 Potri.003G141000.2.v4.1 2943 2707.96 837.28 18.771 Potri.016G087400.1.v4.1 270 86.0057 1004.56 709.102 Potri.015G069301.1.v4.1 564 334.258 0 0 Potri.010G195200.1.v4.1 1773 1537.96 872 34.4214 Potri.012G127500.1.v4.1 977 741.994 3726 304.86 ==> SRR7166164.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 557 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 639 SRR7166164 completed mapping pipeline successfully