Starting /dee2/code/volunteer_pipeline.sh SRR7166165 current disk space = 3110127366144 free memory = 1574682808 SRR7166165 SRAfilesize bd3003d6f61fbd519a323fdbdc59a7f7 SRR7166165.sra SRR7166165.sra file validated SRR7166165 is paired end SRR7166165 is conventional basespace SRR7166165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.002 33.0 32.0 34.0 31.0 34.0 2 32.05025 33.0 31.0 34.0 29.0 34.0 3 32.28675 33.0 33.0 34.0 29.0 34.0 4 32.11325 33.0 33.0 34.0 29.0 34.0 5 32.235 33.0 33.0 34.0 31.0 34.0 6 36.60325 38.0 37.0 38.0 34.0 38.0 7 36.77125 38.0 38.0 38.0 35.0 38.0 8 37.00975 38.0 38.0 38.0 36.0 38.0 9 36.62225 38.0 38.0 38.0 34.0 38.0 10-14 36.986900000000006 38.0 38.0 38.0 35.6 38.0 15-19 36.953 38.0 38.0 38.0 35.4 38.0 20-24 36.930150000000005 38.0 38.0 38.0 35.4 38.0 25-29 36.68554999999999 38.0 38.0 38.0 34.4 38.0 30-34 36.1884 38.0 37.2 38.0 32.2 38.0 35-39 36.10915 38.0 37.0 38.0 32.6 38.0 40-44 36.1164 38.0 37.0 38.0 32.2 38.0 45-49 35.93865 38.0 37.0 38.0 31.4 38.0 50-54 35.59115 38.0 36.4 38.0 29.4 38.0 55-59 35.42685 38.0 36.0 38.0 29.0 38.0 60-64 35.346450000000004 38.0 36.0 38.0 28.6 38.0 65-69 35.36195 38.0 36.0 38.0 28.6 38.0 70-74 35.23745 38.0 36.0 38.0 28.8 38.0 75-79 34.7462 38.0 35.6 38.0 27.0 38.0 80-84 34.4569 38.0 35.2 38.0 25.6 38.0 85-89 34.18085 38.0 34.0 38.0 23.0 38.0 90-94 34.3454 38.0 34.2 38.0 25.0 38.0 95-99 34.13525 38.0 34.2 38.0 21.0 38.0 100-104 33.54465 37.2 33.6 38.0 16.6 38.0 105-109 33.038850000000004 37.2 32.2 38.0 15.0 38.0 110-114 32.35744999999999 37.0 30.6 38.0 15.0 38.0 115-119 32.16715 37.0 30.6 38.0 15.0 38.0 120-124 31.393349999999998 36.0 28.6 38.0 15.0 38.0 125-129 30.3956 35.2 25.4 38.0 14.4 38.0 130-134 28.911199999999997 34.0 22.8 38.0 13.0 38.0 135-139 27.5637 33.0 19.6 38.0 4.2 38.0 140-144 26.163249999999998 33.0 13.8 38.0 2.0 38.0 145-149 23.9507 31.8 6.4 38.0 2.0 38.0 150-151 17.8755 16.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 3.0 13 1.0 14 4.0 15 4.0 16 6.0 17 3.0 18 12.0 19 18.0 20 12.0 21 22.0 22 32.0 23 34.0 24 52.0 25 58.0 26 100.0 27 87.0 28 125.0 29 133.0 30 148.0 31 204.0 32 264.0 33 317.0 34 446.0 35 598.0 36 821.0 37 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.56810715188274 19.509729593126103 9.42633308061663 34.495830174374525 2 19.175 25.05 38.75 17.025000000000002 3 17.150000000000002 31.825 27.224999999999998 23.799999999999997 4 20.549999999999997 36.85 23.425 19.175 5 19.375 39.525 24.075 17.025000000000002 6 16.775000000000002 38.475 24.375 20.375 7 12.025 21.375 45.225 21.375 8 17.075000000000003 23.25 29.15 30.525000000000002 9 17.7 22.525000000000002 32.1 27.675 10-14 18.66 31.935000000000002 26.009999999999998 23.395 15-19 19.42 30.130000000000003 27.605 22.845 20-24 19.225 30.34 27.315 23.119999999999997 25-29 19.175 29.799999999999997 27.87 23.155 30-34 19.095000000000002 30.380000000000003 28.235 22.29 35-39 20.005 29.115000000000002 28.225 22.655 40-44 19.48 29.909999999999997 27.755000000000003 22.855 45-49 19.965 29.509999999999998 27.810000000000002 22.715 50-54 20.135 29.304999999999996 27.74 22.82 55-59 19.5 29.835 27.845 22.82 60-64 19.88 29.945 27.55 22.625 65-69 19.56 29.64 27.900000000000002 22.900000000000002 70-74 19.8737538199489 29.903311457341818 27.688993537397927 22.533941185311356 75-79 19.24012158054711 29.417426545086116 28.039513677811552 23.302938196555218 80-84 19.512937595129376 29.340436326737695 27.798072044647387 23.34855403348554 85-89 20.08901780356071 28.985797159431886 27.595519103820763 23.32966593318664 90-94 19.68295244286643 29.789468420263038 26.864029604440663 23.663549532429865 95-99 20.235 29.160000000000004 27.98 22.625 100-104 20.445 29.12 27.67 22.765 105-109 20.015 28.655 27.91 23.419999999999998 110-114 20.325 28.96 27.505000000000003 23.21 115-119 20.215 29.15 27.474999999999998 23.16 120-124 20.57042782086565 29.66224668501376 27.380535401551164 22.386790092569427 125-129 20.971379880707733 29.31682622424941 27.111422986316473 22.60037090872638 130-134 20.805708790930716 29.839566779695332 26.565109570322388 22.78961485905157 135-139 20.866991119361796 29.968390948773266 27.123576338367368 22.041041593497567 140-144 21.349999999999998 30.29 26.39 21.97 145-149 20.910146977120057 28.55194706803374 26.476084650739935 24.061821304106267 150-151 21.764189951133943 26.976569352211506 27.891241699035206 23.367998997619345 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 1.0 21 2.0 22 3.0 23 3.5 24 5.5 25 7.5 26 10.0 27 11.5 28 15.0 29 20.5 30 30.0 31 44.0 32 52.5 33 68.5 34 83.5 35 98.0 36 125.5 37 154.0 38 164.0 39 185.0 40 224.0 41 241.5 42 246.5 43 249.5 44 256.5 45 260.0 46 256.0 47 235.5 48 202.0 49 173.5 50 132.5 51 105.0 52 94.0 53 68.0 54 51.0 55 37.0 56 20.5 57 16.5 58 12.5 59 9.0 60 7.5 61 3.0 62 2.0 63 1.5 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.19499999999999998 75-79 1.3 80-84 1.4500000000000002 85-89 0.02 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.075 125-129 0.245 130-134 1.205 135-139 0.345 140-144 0.0 145-149 1.005 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0125 0.0 88-89 0.1375 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.2875 0.0 0.0 0.025 0.0 94-95 0.4 0.0 0.0 0.025 0.0 96-97 0.5375 0.0 0.0 0.025 0.0 98-99 0.6625000000000001 0.0 0.0 0.025 0.0 100-101 0.7625 0.0 0.0 0.025 0.0 102-103 0.8875 0.0 0.0 0.025 0.0 104-105 1.0375 0.0 0.0 0.025 0.0 106-107 1.1625 0.0 0.0 0.025 0.0 108-109 1.375 0.0 0.0 0.025 0.0 110-111 1.65 0.0 0.0 0.025 0.0 112-113 1.8875 0.0 0.0 0.025 0.0 114-115 2.0999999999999996 0.0 0.0 0.025 0.0 116-117 2.25 0.0 0.0 0.025 0.0 118-119 2.5625 0.0 0.0 0.025 0.0 120-121 3.0 0.0 0.0 0.025 0.0 122-123 3.3375000000000004 0.0 0.0 0.025 0.0 124-125 3.6875 0.0 0.0 0.025 0.0 126-127 4.1 0.0 0.0 0.025 0.0 128-129 4.575 0.0 0.0 0.025 0.0 130-131 4.862500000000001 0.0 0.0 0.025 0.0 132-133 5.425 0.0 0.0 0.025 0.0 134-135 5.9375 0.0 0.0 0.025 0.0 136-137 6.425 0.0 0.0 0.025 0.0 138-139 6.975 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGTT 10 0.00692859 144.3125 4 ATCCAAC 10 0.00692859 144.3125 6 >>END_MODULE SRR7166165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54925 33.0 33.0 34.0 32.0 34.0 2 32.589 33.0 33.0 34.0 32.0 34.0 3 32.4605 33.0 33.0 34.0 31.0 34.0 4 32.3715 33.0 33.0 34.0 31.0 34.0 5 32.51975 33.0 33.0 34.0 32.0 34.0 6 36.63175 38.0 38.0 38.0 35.0 38.0 7 36.61425 38.0 38.0 38.0 34.0 38.0 8 36.6375 38.0 38.0 38.0 35.0 38.0 9 36.62525 38.0 38.0 38.0 34.0 38.0 10-14 36.5304 38.0 38.0 38.0 34.0 38.0 15-19 36.235 38.0 38.0 38.0 33.2 38.0 20-24 36.1487 38.0 38.0 38.0 33.2 38.0 25-29 36.353699999999996 38.0 38.0 38.0 34.0 38.0 30-34 36.310950000000005 38.0 38.0 38.0 34.0 38.0 35-39 35.9245 38.0 37.8 38.0 31.4 38.0 40-44 35.989000000000004 38.0 37.8 38.0 32.2 38.0 45-49 35.6392 38.0 37.0 38.0 30.0 38.0 50-54 35.7188 38.0 37.0 38.0 30.2 38.0 55-59 35.623599999999996 38.0 37.0 38.0 29.4 38.0 60-64 35.604499999999994 38.0 37.0 38.0 29.8 38.0 65-69 35.25765 38.0 36.6 38.0 28.2 38.0 70-74 35.42035 38.0 36.6 38.0 28.8 38.0 75-79 35.06705 38.0 36.2 38.0 28.0 38.0 80-84 35.0139 38.0 36.0 38.0 27.8 38.0 85-89 35.06225 38.0 36.0 38.0 27.8 38.0 90-94 34.857150000000004 38.0 36.0 38.0 26.6 38.0 95-99 34.621249999999996 38.0 35.6 38.0 25.6 38.0 100-104 34.1819 38.0 34.8 38.0 23.0 38.0 105-109 34.174099999999996 38.0 34.6 38.0 22.0 38.0 110-114 33.59335 38.0 34.0 38.0 16.6 38.0 115-119 33.2733 38.0 33.6 38.0 17.4 38.0 120-124 32.47405 37.6 32.2 38.0 15.0 38.0 125-129 31.366650000000003 36.6 29.6 38.0 14.2 38.0 130-134 30.46535 36.0 27.2 38.0 13.0 38.0 135-139 29.827800000000003 35.4 26.2 38.0 10.8 38.0 140-144 28.378300000000003 34.0 21.6 38.0 2.0 38.0 145-149 26.45165 33.4 13.4 38.0 2.0 38.0 150-151 20.191000000000003 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 3.0 5 1.0 6 1.0 7 1.0 8 4.0 9 8.0 10 3.0 11 2.0 12 3.0 13 6.0 14 4.0 15 7.0 16 5.0 17 13.0 18 12.0 19 19.0 20 18.0 21 23.0 22 22.0 23 32.0 24 48.0 25 40.0 26 61.0 27 72.0 28 68.0 29 105.0 30 123.0 31 136.0 32 184.0 33 234.0 34 317.0 35 484.0 36 780.0 37 1148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875 17.1 13.65 30.375000000000004 2 23.575 23.375 36.25 16.8 3 20.674999999999997 26.450000000000003 32.85 20.025000000000002 4 22.875 35.525 22.475 19.125 5 22.825 37.925 21.425 17.825 6 17.8 37.425000000000004 24.349999999999998 20.424999999999997 7 16.950000000000003 15.4 46.0 21.65 8 20.225 23.0 27.250000000000004 29.525000000000002 9 21.65 23.775 29.4 25.174999999999997 10-14 21.995 29.395 27.705000000000002 20.905 15-19 22.965 27.694999999999997 28.505000000000003 20.835 20-24 22.79 27.750000000000004 28.82 20.64 25-29 22.355 28.12 28.96 20.565 30-34 22.575 28.535 28.355000000000004 20.535 35-39 22.59 28.249999999999996 28.57 20.59 40-44 22.765 28.715000000000003 28.244999999999997 20.275000000000002 45-49 23.01 27.195000000000004 29.21 20.585 50-54 22.365 28.025 28.915000000000003 20.695 55-59 22.305 28.110000000000003 28.939999999999998 20.645 60-64 22.675 27.55 29.335 20.44 65-69 22.5 28.249999999999996 28.715000000000003 20.535 70-74 23.075000000000003 28.384999999999998 28.335 20.205000000000002 75-79 23.05 27.334999999999997 29.525000000000002 20.09 80-84 22.71 28.225 28.785 20.28 85-89 23.225 27.905 28.76 20.11 90-94 23.155 28.265 28.360000000000003 20.22 95-99 22.82 28.42 28.675 20.085 100-104 23.335 28.194999999999997 28.875 19.595000000000002 105-109 23.845 27.794999999999998 28.515 19.845 110-114 23.330000000000002 27.875 28.835 19.96 115-119 23.485 28.03 28.985 19.5 120-124 23.26 28.144999999999996 28.499999999999996 20.095 125-129 23.91 27.61 29.015 19.465 130-134 24.545 27.37 28.294999999999998 19.79 135-139 24.29 27.634999999999998 28.92 19.155 140-144 24.52 27.310000000000002 28.455000000000002 19.715 145-149 25.11 27.43 27.700000000000003 19.759999999999998 150-151 25.924999999999997 27.3375 27.537499999999998 19.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 1.0 25 1.5 26 4.0 27 6.0 28 11.0 29 14.0 30 23.0 31 31.5 32 33.5 33 40.0 34 57.5 35 76.5 36 103.0 37 126.5 38 161.5 39 182.5 40 191.5 41 247.5 42 277.0 43 263.0 44 280.5 45 297.5 46 271.0 47 251.0 48 222.0 49 183.0 50 151.5 51 119.0 52 98.5 53 76.0 54 53.5 55 38.0 56 28.5 57 25.0 58 17.5 59 9.0 60 6.0 61 4.0 62 1.5 63 2.5 64 2.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.7875 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCTT 10 0.006830828 145.0 5 >>END_MODULE Read 631450 spots for SRR7166165.sra Written 631450 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra Read 631438 spots for SRR7166165.sra Written 631438 spots for SRR7166165.sra SRR ids: ['SRR7166165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u8772tyu SRR7166165.sra spots: 12628772 blocks: [[1, 631438], [631439, 1262876], [1262877, 1894314], [1894315, 2525752], [2525753, 3157190], [3157191, 3788628], [3788629, 4420066], [4420067, 5051504], [5051505, 5682942], [5682943, 6314380], [6314381, 6945818], [6945819, 7577256], [7577257, 8208694], [8208695, 8840132], [8840133, 9471570], [9471571, 10103008], [10103009, 10734446], [10734447, 11365884], [11365885, 11997322], [11997323, 12628772]] SRR7166165 file size 4257776 SRR7166165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166165 SRR7166165_1.fastq SRR7166165_2.fastq Input file: SRR7166165_1.fastq Paired file: SRR7166165_2.fastq trimmed: SRR7166165-trimmed-pair1.fastq, SRR7166165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:49:08 2025 >> started Fri Feb 14 19:49:23 2025 >> done (15.454s) 12628772 read pairs processed; of these: 15047 ( 0.12%) short read pairs filtered out after trimming by size control 15344 ( 0.12%) empty read pairs filtered out after trimming by size control 12598381 (99.76%) read pairs available; of these: 8210415 (65.17%) trimmed read pairs available after processing 4387966 (34.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 2 0.00% 30 7 0.00% 31 9 0.00% 32 13 0.00% 33 6 0.00% 34 12 0.00% 35 5 0.00% 36 13 0.00% 37 10 0.00% 38 9 0.00% 39 12 0.00% 40 9 0.00% 41 19 0.00% 42 18 0.00% 43 20 0.00% 44 31 0.00% 45 29 0.00% 46 31 0.00% 47 33 0.00% 48 36 0.00% 49 51 0.00% 50 52 0.00% 51 71 0.00% 52 74 0.00% 53 76 0.00% 54 95 0.00% 55 99 0.00% 56 107 0.00% 57 123 0.00% 58 173 0.00% 59 188 0.00% 60 206 0.00% 61 263 0.00% 62 289 0.00% 63 315 0.00% 64 352 0.00% 65 392 0.00% 66 487 0.00% 67 555 0.00% 68 631 0.01% 69 754 0.01% 70 852 0.01% 71 963 0.01% 72 1074 0.01% 73 1235 0.01% 74 1309 0.01% 75 1390 0.01% 76 1441 0.01% 77 1550 0.01% 78 1650 0.01% 79 1757 0.01% 80 1899 0.02% 81 2357 0.02% 82 2757 0.02% 83 3165 0.03% 84 4138 0.03% 85 4509 0.04% 86 4727 0.04% 87 5083 0.04% 88 5414 0.04% 89 5770 0.05% 90 6692 0.05% 91 7582 0.06% 92 8585 0.07% 93 9047 0.07% 94 9311 0.07% 95 9483 0.08% 96 9944 0.08% 97 10786 0.09% 98 11574 0.09% 99 13017 0.10% 100 13862 0.11% 101 14288 0.11% 102 15218 0.12% 103 15545 0.12% 104 16015 0.13% 105 15921 0.13% 106 15777 0.13% 107 17050 0.14% 108 18560 0.15% 109 19844 0.16% 110 21890 0.17% 111 22964 0.18% 112 24853 0.20% 113 26571 0.21% 114 28191 0.22% 115 28390 0.23% 116 30223 0.24% 117 33605 0.27% 118 35629 0.28% 119 38100 0.30% 120 38972 0.31% 121 39516 0.31% 122 40348 0.32% 123 43107 0.34% 124 47311 0.38% 125 50683 0.40% 126 53683 0.43% 127 57695 0.46% 128 59265 0.47% 129 63807 0.51% 130 67304 0.53% 131 73338 0.58% 132 79554 0.63% 133 85541 0.68% 134 91812 0.73% 135 98180 0.78% 136 100262 0.80% 137 103891 0.82% 138 112915 0.90% 139 127601 1.01% 140 146541 1.16% 141 141895 1.13% 142 152326 1.21% 143 167132 1.33% 144 193946 1.54% 145 230494 1.83% 146 291258 2.31% 147 387973 3.08% 148 550919 4.37% 149 933651 7.41% 150 2972212 23.59% 151 4387966 34.83% 12598381 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=2.9 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=18.23 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.0 sequence=TCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=25 prefix-density=0.55 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=26.03 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.7 sequence=TTTGTTCTTGTCTACACTGTCTTCTCTGC SRR7166165 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:50:24 Started mapping on | Feb 14 19:50:27 Finished on | Feb 14 19:52:39 Mapping speed, Million of reads per hour | 343.59 Number of input reads | 12598381 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11827514 Uniquely mapped reads % | 93.88% Average mapped length | 289.76 Number of splices: Total | 11066060 Number of splices: Annotated (sjdb) | 10879233 Number of splices: GT/AG | 10892538 Number of splices: GC/AG | 137089 Number of splices: AT/AC | 8021 Number of splices: Non-canonical | 28412 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317595 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 17717 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468923 468923 468923 N_multimapping 317595 317595 317595 N_noFeature 377014 11682525 459873 N_ambiguous 123507 739 60909 UnstrandedReadsAssigned:11326993 PositiveStrandReadsAssigned:144250 NegativeStrandReadsAssigned:11306732 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166165-trimmed-pair1.fastq SRR7166165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,598,381 reads, 11,245,504 reads pseudoaligned [quant] estimated average fragment length: 229.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR7166165.ke.tsv 34699 SRR7166165.se.tsv 87100 total ==> SRR7166165.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.35 752 34.4608 Potri.005G024800.1.v4.1 1035 806.347 208 21.1516 Potri.004G059700.1.v4.1 961 732.361 24 2.68713 Potri.007G009000.2.v4.1 1416 1187.35 0 0 Potri.003G141000.2.v4.1 2943 2714.35 449.16 13.5687 Potri.016G087400.1.v4.1 270 85.4137 989 949.448 Potri.015G069301.1.v4.1 564 338.578 0 0 Potri.010G195200.1.v4.1 1773 1544.35 164 8.70766 Potri.012G127500.1.v4.1 977 748.356 1982 217.169 ==> SRR7166165.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 209 SRR7166165 completed mapping pipeline successfully