Starting /dee2/code/volunteer_pipeline.sh SRR7166166 current disk space = 3110526730240 free memory = 1467843516 SRR7166166 SRAfilesize 32ac402a66024bfd796917e6b8b7fe1a SRR7166166.sra SRR7166166.sra file validated SRR7166166 is paired end SRR7166166 is conventional basespace SRR7166166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05225 33.0 33.0 34.0 32.0 34.0 2 32.87725 33.0 33.0 34.0 32.0 34.0 3 31.5545 33.0 31.0 33.0 28.0 33.0 4 32.67025 33.0 33.0 33.0 32.0 34.0 5 32.63075 33.0 33.0 33.0 32.0 34.0 6 36.59125 38.0 37.0 38.0 34.0 38.0 7 37.33775 38.0 38.0 38.0 36.0 38.0 8 37.5325 38.0 38.0 38.0 37.0 38.0 9 37.54275 38.0 38.0 38.0 38.0 38.0 10-14 37.571299999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.603649999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.5444 38.0 38.0 38.0 37.8 38.0 25-29 37.54905 38.0 38.0 38.0 37.8 38.0 30-34 37.509550000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.502250000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.4578 38.0 38.0 38.0 37.2 38.0 45-49 37.4031 38.0 38.0 38.0 37.0 38.0 50-54 37.26805 38.0 38.0 38.0 37.0 38.0 55-59 36.87715 38.0 38.0 38.0 36.2 38.0 60-64 37.0554 38.0 38.0 38.0 36.0 38.0 65-69 37.241949999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.151650000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.042649999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.9135 38.0 38.0 38.0 35.4 38.0 85-89 36.85925 38.0 38.0 38.0 35.6 38.0 90-94 36.7681 38.0 38.0 38.0 35.2 38.0 95-99 36.640249999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.5582 38.0 38.0 38.0 34.0 38.0 105-109 36.400600000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.354150000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.252050000000004 38.0 37.6 38.0 33.6 38.0 120-124 36.038650000000004 38.0 37.0 38.0 33.0 38.0 125-129 35.90689999999999 38.0 36.6 38.0 32.8 38.0 130-134 35.7659 38.0 36.6 38.0 31.4 38.0 135-139 35.4718 38.0 36.0 38.0 31.0 38.0 140-144 35.127250000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.671800000000005 38.0 35.2 38.0 28.2 38.0 150-151 31.616625 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 0.0 18 2.0 19 2.0 20 3.0 21 3.0 22 5.0 23 5.0 24 8.0 25 6.0 26 16.0 27 20.0 28 23.0 29 22.0 30 35.0 31 40.0 32 67.0 33 95.0 34 156.0 35 241.0 36 629.0 37 2620.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.050153531218015 19.1914022517912 12.128966223132037 30.62947799385875 2 21.375 23.549999999999997 37.95 17.125 3 18.85 31.0 27.750000000000004 22.400000000000002 4 21.099999999999998 36.15 22.975 19.775000000000002 5 20.83124687030546 35.878818227341014 23.209814722083124 20.080120180270406 6 17.375 35.825 25.05 21.75 7 13.825000000000001 20.0 44.725 21.45 8 18.0 20.875 28.325 32.800000000000004 9 17.95 21.125 30.875000000000004 30.049999999999997 10-14 20.255000000000003 29.525000000000002 26.419999999999998 23.799999999999997 15-19 20.599999999999998 28.634999999999998 26.950000000000003 23.815 20-24 20.65 28.735 27.04 23.575 25-29 20.055 28.845 27.99 23.11 30-34 20.380000000000003 28.465 28.155 23.0 35-39 20.31 28.93 27.229999999999997 23.53 40-44 20.549999999999997 29.060000000000002 27.43 22.96 45-49 20.705000000000002 28.975 26.979999999999997 23.34 50-54 20.522462896109104 27.93321299638989 27.918170878459687 23.626153229041318 55-59 20.85886463766648 27.989061629614625 27.78649921507064 23.36557451764825 60-64 20.777331995987964 28.09929789368104 27.221664994984955 23.90170511534604 65-69 20.765 28.28 27.245 23.71 70-74 20.615 29.125 27.134999999999998 23.125 75-79 20.69 28.505000000000003 27.500000000000004 23.305 80-84 20.51 28.29 27.250000000000004 23.95 85-89 20.8 28.895 27.560000000000002 22.745 90-94 21.075 28.03 27.49 23.405 95-99 20.885 28.84 27.325 22.95 100-104 21.404999999999998 28.749999999999996 27.125 22.720000000000002 105-109 21.45896960897211 28.55855404796475 27.25679667551194 22.725679667551194 110-114 21.14 28.499999999999996 26.974999999999998 23.385 115-119 21.240000000000002 28.720000000000002 27.125 22.915 120-124 21.335 28.315 27.250000000000004 23.1 125-129 21.584999999999997 28.435 26.435 23.544999999999998 130-134 21.39 28.62 26.8 23.189999999999998 135-139 20.435 29.13 26.51 23.925 140-144 21.654999999999998 28.21 26.8 23.335 145-149 21.555 28.199999999999996 26.279999999999998 23.965 150-151 21.53325817361894 29.287235375172244 25.579356131780035 23.600150319428785 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 3.0 23 3.5 24 1.5 25 2.5 26 8.0 27 10.5 28 10.0 29 19.0 30 29.5 31 31.0 32 36.5 33 51.0 34 65.5 35 70.5 36 77.5 37 113.0 38 150.5 39 165.0 40 189.0 41 228.5 42 237.0 43 256.5 44 278.5 45 251.5 46 242.5 47 233.5 48 203.5 49 192.0 50 165.5 51 141.5 52 114.5 53 71.5 54 63.5 55 54.0 56 45.5 57 45.0 58 33.5 59 21.5 60 13.0 61 16.5 62 17.0 63 9.0 64 7.0 65 6.5 66 4.5 67 3.0 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.27999999999999997 55-59 1.265 60-64 0.3 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.135 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.675 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.225 0.0 0.0 0.0 0.0 138-139 9.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03725 33.0 33.0 34.0 32.0 34.0 2 33.1325 34.0 33.0 34.0 32.0 34.0 3 33.18625 34.0 33.0 34.0 33.0 34.0 4 33.11425 34.0 33.0 34.0 33.0 34.0 5 33.091 34.0 33.0 34.0 33.0 34.0 6 37.36725 38.0 38.0 38.0 37.0 38.0 7 37.398 38.0 38.0 38.0 37.0 38.0 8 37.3815 38.0 38.0 38.0 38.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.36865 38.0 38.0 38.0 37.0 38.0 15-19 37.31995 38.0 38.0 38.0 37.0 38.0 20-24 37.307900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.25365000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.19435 38.0 38.0 38.0 37.0 38.0 35-39 37.15945000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.15325 38.0 38.0 38.0 36.6 38.0 45-49 37.031349999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.9357 38.0 38.0 38.0 35.8 38.0 55-59 36.81985 38.0 38.0 38.0 35.4 38.0 60-64 36.8203 38.0 38.0 38.0 35.8 38.0 65-69 36.8035 38.0 38.0 38.0 35.6 38.0 70-74 36.71225 38.0 38.0 38.0 35.0 38.0 75-79 36.7102 38.0 38.0 38.0 35.0 38.0 80-84 36.60515 38.0 38.0 38.0 34.6 38.0 85-89 36.4614 38.0 38.0 38.0 34.0 38.0 90-94 36.2693 38.0 38.0 38.0 33.4 38.0 95-99 36.10850000000001 38.0 37.8 38.0 33.0 38.0 100-104 35.9842 38.0 37.0 38.0 33.0 38.0 105-109 35.8643 38.0 37.0 38.0 32.6 38.0 110-114 35.64845 38.0 37.0 38.0 31.0 38.0 115-119 35.410000000000004 38.0 36.4 38.0 30.2 38.0 120-124 35.1924 38.0 36.0 38.0 29.0 38.0 125-129 34.930049999999994 38.0 35.8 38.0 27.8 38.0 130-134 34.66909999999999 38.0 35.2 38.0 27.0 38.0 135-139 34.33165 38.0 35.0 38.0 25.2 38.0 140-144 33.60585 38.0 34.2 38.0 21.8 38.0 145-149 32.5604 38.0 33.6 38.0 13.6 38.0 150-151 28.62975 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 3.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 3.0 16 7.0 17 1.0 18 6.0 19 7.0 20 7.0 21 12.0 22 8.0 23 11.0 24 11.0 25 18.0 26 11.0 27 24.0 28 28.0 29 34.0 30 36.0 31 60.0 32 89.0 33 115.0 34 182.0 35 306.0 36 707.0 37 2300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 16.225 15.85 28.825 2 24.675 22.525000000000002 34.925 17.875 3 20.775 25.95 31.874999999999996 21.4 4 23.05 36.325 21.099999999999998 19.525000000000002 5 23.45 35.625 22.225 18.7 6 18.9 36.825 22.875 21.4 7 16.275000000000002 16.025 45.1 22.6 8 18.975 21.325 27.575 32.125 9 21.425 23.849999999999998 27.725 27.0 10-14 22.645 28.625 26.83 21.9 15-19 22.335 27.625 28.48 21.560000000000002 20-24 22.73 27.750000000000004 28.365000000000002 21.154999999999998 25-29 22.689999999999998 27.650000000000002 28.33 21.33 30-34 22.42 28.194999999999997 28.42 20.965 35-39 22.835 27.93 27.665 21.57 40-44 22.564999999999998 27.54 28.51 21.385 45-49 22.98 27.675 27.87 21.475 50-54 23.105 27.54 27.939999999999998 21.415 55-59 23.185 27.435 28.360000000000003 21.02 60-64 22.770000000000003 27.694999999999997 28.165000000000003 21.37 65-69 23.27 27.215 28.375 21.14 70-74 23.215 27.279999999999998 28.01 21.495 75-79 22.825 27.58 28.705000000000002 20.89 80-84 23.18 28.04 27.85 20.93 85-89 23.31 28.095 27.584999999999997 21.01 90-94 23.305 27.935 27.955000000000002 20.805 95-99 23.91 27.55 27.925 20.615 100-104 23.445 27.445000000000004 28.345 20.765 105-109 23.485 27.310000000000002 28.565 20.64 110-114 23.66 27.485 28.110000000000003 20.745 115-119 24.075 27.965 27.495000000000005 20.465 120-124 23.5 27.49 27.99 21.02 125-129 23.915 27.46 27.975 20.65 130-134 24.21 28.76 27.18 19.85 135-139 24.560000000000002 28.439999999999998 27.22 19.78 140-144 24.81 28.34 26.955000000000002 19.895 145-149 25.16 28.425 26.445 19.97 150-151 25.581686264698522 27.5331498623968 27.020265198899175 19.864898674005506 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 3.0 27 3.5 28 8.5 29 13.5 30 17.0 31 22.0 32 31.0 33 43.0 34 54.0 35 70.0 36 78.0 37 104.5 38 136.5 39 152.5 40 193.0 41 215.5 42 240.5 43 266.0 44 266.5 45 272.0 46 266.0 47 245.5 48 224.0 49 200.0 50 164.0 51 141.0 52 121.0 53 97.0 54 70.5 55 56.5 56 46.5 57 29.0 58 27.5 59 23.0 60 17.5 61 15.5 62 14.0 63 13.0 64 8.5 65 4.5 66 4.5 67 2.5 68 2.0 69 2.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 60 1.0196794E-5 19.333334 130-134 >>END_MODULE Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777425 spots for SRR7166166.sra Written 777425 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra Read 777408 spots for SRR7166166.sra Written 777408 spots for SRR7166166.sra SRR ids: ['SRR7166166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qi1kg2hv SRR7166166.sra spots: 15548177 blocks: [[1, 777408], [777409, 1554816], [1554817, 2332224], [2332225, 3109632], [3109633, 3887040], [3887041, 4664448], [4664449, 5441856], [5441857, 6219264], [6219265, 6996672], [6996673, 7774080], [7774081, 8551488], [8551489, 9328896], [9328897, 10106304], [10106305, 10883712], [10883713, 11661120], [11661121, 12438528], [12438529, 13215936], [13215937, 13993344], [13993345, 14770752], [14770753, 15548177]] SRR7166166 file size 5247066 SRR7166166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166166 SRR7166166_1.fastq SRR7166166_2.fastq Input file: SRR7166166_1.fastq Paired file: SRR7166166_2.fastq trimmed: SRR7166166-trimmed-pair1.fastq, SRR7166166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:46:18 2025 >> started Fri Feb 14 18:46:37 2025 >> done (18.735s) 15548177 read pairs processed; of these: 9031 ( 0.06%) short read pairs filtered out after trimming by size control 12211 ( 0.08%) empty read pairs filtered out after trimming by size control 15526935 (99.86%) read pairs available; of these: 7112272 (45.81%) trimmed read pairs available after processing 8414663 (54.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 16 0.00% 21 5 0.00% 22 10 0.00% 23 8 0.00% 24 6 0.00% 25 7 0.00% 26 3 0.00% 27 10 0.00% 28 8 0.00% 29 8 0.00% 30 12 0.00% 31 14 0.00% 32 11 0.00% 33 15 0.00% 34 12 0.00% 35 9 0.00% 36 14 0.00% 37 12 0.00% 38 23 0.00% 39 24 0.00% 40 20 0.00% 41 18 0.00% 42 27 0.00% 43 37 0.00% 44 35 0.00% 45 33 0.00% 46 43 0.00% 47 64 0.00% 48 52 0.00% 49 78 0.00% 50 79 0.00% 51 119 0.00% 52 89 0.00% 53 112 0.00% 54 98 0.00% 55 138 0.00% 56 167 0.00% 57 185 0.00% 58 214 0.00% 59 247 0.00% 60 302 0.00% 61 381 0.00% 62 398 0.00% 63 420 0.00% 64 473 0.00% 65 494 0.00% 66 505 0.00% 67 634 0.00% 68 662 0.00% 69 868 0.01% 70 983 0.01% 71 1156 0.01% 72 1339 0.01% 73 1555 0.01% 74 1770 0.01% 75 1890 0.01% 76 2022 0.01% 77 2270 0.01% 78 2480 0.02% 79 2762 0.02% 80 3171 0.02% 81 3720 0.02% 82 4315 0.03% 83 4849 0.03% 84 5693 0.04% 85 6360 0.04% 86 6640 0.04% 87 7092 0.05% 88 7479 0.05% 89 7963 0.05% 90 8745 0.06% 91 9741 0.06% 92 10981 0.07% 93 11977 0.08% 94 12854 0.08% 95 13432 0.09% 96 14098 0.09% 97 14326 0.09% 98 14814 0.10% 99 16040 0.10% 100 16195 0.10% 101 17651 0.11% 102 19319 0.12% 103 20647 0.13% 104 22084 0.14% 105 23241 0.15% 106 23780 0.15% 107 24112 0.16% 108 24744 0.16% 109 25155 0.16% 110 26513 0.17% 111 27924 0.18% 112 29781 0.19% 113 31765 0.20% 114 33634 0.22% 115 35415 0.23% 116 36353 0.23% 117 37260 0.24% 118 37560 0.24% 119 38167 0.25% 120 38712 0.25% 121 40598 0.26% 122 42108 0.27% 123 45136 0.29% 124 48074 0.31% 125 49916 0.32% 126 51798 0.33% 127 52263 0.34% 128 52827 0.34% 129 54127 0.35% 130 55122 0.36% 131 57498 0.37% 132 60324 0.39% 133 63640 0.41% 134 67306 0.43% 135 71212 0.46% 136 73635 0.47% 137 77365 0.50% 138 79511 0.51% 139 82904 0.53% 140 86820 0.56% 141 93264 0.60% 142 100920 0.65% 143 111026 0.72% 144 127555 0.82% 145 150342 0.97% 146 181269 1.17% 147 234047 1.51% 148 342088 2.20% 149 644183 4.15% 150 3115631 20.07% 151 8414663 54.19% 15526935 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=15 prefix-density=0.50 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=35 fanout-score=11.37 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.3 sequence=CACACTTGCAGTCAGAGCCACAGCTACA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=17 prefix-density=0.45 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=42.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.1 sequence=CAAGTGCTTACTCCTCTTCCTCCAGGAGAATCAGCATGAAGATGAGTAAGATTGCCCTAGCAATTATCTCTCTAGTAAGTCTAGCCACAGTGCACCACGCACATGCCCAGGACTCCCCGCAAGACTTCCTCAATGCTCACAATGCTGCCCGTGCATCGGTGGGCGTAGGGCCCATGAGATGGGACGATAAAGTGGCTGCTTTTGCACGAAGCTACATCAATGGACTAAGGGACGGTTGCAGAATGGTGCACTCCGGGGGTCCTTATGGTGAAAACCTTGCATGGGGCAGCCCTGACCTTGCCGGCACGGGTGCTGTGAAAATGTGGGTGGATGAGAGGGCAAACTATGACTACAACTCGAATTCCTGTGTTGGTGGGCAGTGCTTGCATTACACTCAGGTAGTTTGGCGCAACTCGGTTCGTCTAGGATGTGCTAAGGTGAGGTGCAATAATGGCGCCGGCACACTCATCAGTTGCAACTAT SRR7166166 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:48:28 Started mapping on | Feb 14 18:48:29 Finished on | Feb 14 18:52:52 Mapping speed, Million of reads per hour | 212.54 Number of input reads | 15526935 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13311700 Uniquely mapped reads % | 85.73% Average mapped length | 292.14 Number of splices: Total | 11774469 Number of splices: Annotated (sjdb) | 11514923 Number of splices: GT/AG | 11571107 Number of splices: GC/AG | 153352 Number of splices: AT/AC | 9163 Number of splices: Non-canonical | 40847 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453190 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 56704 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.81% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1770628 1770628 1770628 N_multimapping 453190 453190 453190 N_noFeature 440667 13144573 529681 N_ambiguous 175320 820 96642 UnstrandedReadsAssigned:12695713 PositiveStrandReadsAssigned:166307 NegativeStrandReadsAssigned:12685377 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166166-trimmed-pair1.fastq SRR7166166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,526,935 reads, 12,669,343 reads pseudoaligned [quant] estimated average fragment length: 231.218 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7166166.ke.tsv 34699 SRR7166166.se.tsv 87100 total ==> SRR7166166.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.78 2421 104.418 Potri.005G024800.1.v4.1 1035 804.782 907 86.9007 Potri.004G059700.1.v4.1 961 730.793 4 0.422046 Potri.007G009000.2.v4.1 1416 1185.78 0 0 Potri.003G141000.2.v4.1 2943 2712.78 356 10.1188 Potri.016G087400.1.v4.1 270 88.2849 340 296.952 Potri.015G069301.1.v4.1 564 338.212 0 0 Potri.010G195200.1.v4.1 1773 1542.78 1003.94 50.1761 Potri.012G127500.1.v4.1 977 746.793 14015 1447.06 ==> SRR7166166.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 448 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 932 SRR7166166 completed mapping pipeline successfully