Starting /dee2/code/volunteer_pipeline.sh SRR7166167 current disk space = 3110554939392 free memory = 1378404252 SRR7166167 SRAfilesize a322582ce2b24ecc429871c12ccb7afa SRR7166167.sra SRR7166167.sra file validated SRR7166167 is paired end SRR7166167 is conventional basespace SRR7166167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27875 33.0 33.0 34.0 32.0 34.0 2 33.09275 34.0 33.0 34.0 32.0 34.0 3 33.01225 34.0 33.0 34.0 32.0 34.0 4 32.3365 33.0 33.0 33.0 31.0 34.0 5 32.816 33.0 33.0 34.0 32.0 34.0 6 36.3195 38.0 36.0 38.0 33.0 38.0 7 37.36975 38.0 38.0 38.0 36.0 38.0 8 37.51325 38.0 38.0 38.0 37.0 38.0 9 37.56925 38.0 38.0 38.0 38.0 38.0 10-14 37.554500000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.60385 38.0 38.0 38.0 38.0 38.0 20-24 37.5647 38.0 38.0 38.0 38.0 38.0 25-29 37.531150000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.52434999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.454550000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.44840000000001 38.0 38.0 38.0 37.2 38.0 45-49 37.4274 38.0 38.0 38.0 37.0 38.0 50-54 37.32175 38.0 38.0 38.0 37.0 38.0 55-59 36.99005 38.0 38.0 38.0 36.8 38.0 60-64 37.11325 38.0 38.0 38.0 36.0 38.0 65-69 37.2249 38.0 38.0 38.0 36.4 38.0 70-74 37.16845 38.0 38.0 38.0 36.0 38.0 75-79 37.1142 38.0 38.0 38.0 36.0 38.0 80-84 36.9697 38.0 38.0 38.0 36.0 38.0 85-89 36.94055 38.0 38.0 38.0 36.0 38.0 90-94 36.839200000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.69135 38.0 38.0 38.0 35.0 38.0 100-104 36.6164 38.0 38.0 38.0 34.6 38.0 105-109 36.41285 38.0 38.0 38.0 34.0 38.0 110-114 36.412 38.0 38.0 38.0 34.0 38.0 115-119 36.302099999999996 38.0 37.8 38.0 33.8 38.0 120-124 36.09929999999999 38.0 37.4 38.0 33.4 38.0 125-129 35.98135 38.0 37.0 38.0 32.6 38.0 130-134 35.85305 38.0 36.6 38.0 32.6 38.0 135-139 35.546549999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.3396 38.0 36.0 38.0 30.6 38.0 145-149 34.8992 38.0 35.8 38.0 28.4 38.0 150-151 32.1665 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 3.0 20 4.0 21 2.0 22 4.0 23 4.0 24 6.0 25 7.0 26 10.0 27 13.0 28 15.0 29 30.0 30 47.0 31 36.0 32 45.0 33 79.0 34 158.0 35 236.0 36 618.0 37 2675.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.468030690537084 20.383631713554987 9.974424552429667 32.17391304347826 2 20.125 25.374999999999996 38.525 15.975 3 18.075 30.575000000000003 27.200000000000003 24.15 4 20.75 36.825 22.900000000000002 19.525000000000002 5 20.590442832124094 37.02777082812109 23.817863397548162 18.563922942206652 6 16.825000000000003 36.075 25.525 21.575 7 13.525 19.325 46.25 20.9 8 17.8 21.05 28.749999999999996 32.4 9 18.325 21.525 30.175 29.975 10-14 19.5 29.635 26.825 24.04 15-19 20.505000000000003 28.645 27.084999999999997 23.765 20-24 20.14 29.244999999999997 27.455000000000002 23.16 25-29 19.925 29.080000000000002 28.294999999999998 22.7 30-34 20.080000000000002 29.14 26.979999999999997 23.799999999999997 35-39 20.485 29.025000000000002 27.425 23.064999999999998 40-44 20.515 29.235 27.450000000000003 22.8 45-49 20.465 28.67 27.525 23.34 50-54 19.89675737984263 28.42179120934195 27.70009522377587 23.981356187039545 55-59 20.480468355708084 28.015544564449378 28.16695265973554 23.337034420106995 60-64 20.21249937352779 29.26878163684659 27.19390567834411 23.32481331128151 65-69 20.815 28.470000000000002 27.675 23.04 70-74 20.39 28.660000000000004 28.060000000000002 22.89 75-79 20.77 28.294999999999998 27.655 23.28 80-84 20.89 28.77 27.205000000000002 23.135 85-89 20.255000000000003 28.360000000000003 28.075 23.31 90-94 20.07 28.22 28.58 23.13 95-99 20.935000000000002 28.035 27.1 23.93 100-104 21.075 28.22 27.865000000000002 22.84 105-109 21.078455915485904 28.178040354478544 27.757472587993792 22.986031142041757 110-114 21.065 28.725 27.305 22.905 115-119 20.4 28.255000000000003 27.655 23.69 120-124 21.18 28.21 26.935 23.674999999999997 125-129 20.66 28.49 27.515 23.335 130-134 21.175 28.444999999999997 27.26 23.119999999999997 135-139 21.94 28.365000000000002 26.35 23.345 140-144 21.125 28.16 26.685 24.03 145-149 20.974999999999998 29.335 26.52 23.169999999999998 150-151 21.65915915915916 27.57757757757758 26.88938938938939 23.873873873873876 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 6.0 26 8.5 27 5.5 28 6.5 29 13.0 30 24.5 31 32.5 32 35.5 33 38.5 34 53.5 35 77.5 36 99.5 37 119.5 38 136.5 39 181.5 40 216.5 41 224.5 42 254.0 43 279.0 44 269.0 45 253.0 46 256.5 47 247.0 48 215.5 49 187.0 50 161.0 51 137.0 52 105.0 53 75.0 54 61.0 55 49.5 56 45.0 57 38.0 58 28.0 59 20.0 60 10.5 61 7.5 62 4.5 63 1.0 64 2.5 65 3.0 66 1.0 67 0.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.23500000000000001 55-59 0.9299999999999999 60-64 0.23500000000000001 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.135 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 5.0125 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.9625 0.0 0.0 0.0 0.0 136-137 6.5125 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAT 10 0.006832588 144.9875 9 CCACTGC 10 0.006832588 144.9875 8 CTGCCTT 25 8.716269E-4 86.9925 8 >>END_MODULE SRR7166167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0295 33.0 33.0 34.0 32.0 34.0 2 33.1195 34.0 33.0 34.0 32.0 34.0 3 33.175 34.0 33.0 34.0 33.0 34.0 4 33.165 34.0 33.0 34.0 33.0 34.0 5 33.17625 34.0 33.0 34.0 33.0 34.0 6 37.393 38.0 38.0 38.0 37.0 38.0 7 37.388 38.0 38.0 38.0 37.0 38.0 8 37.381 38.0 38.0 38.0 37.0 38.0 9 37.40925 38.0 38.0 38.0 37.0 38.0 10-14 37.34505 38.0 38.0 38.0 37.0 38.0 15-19 37.28680000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.248400000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.23215 38.0 38.0 38.0 37.0 38.0 30-34 37.1751 38.0 38.0 38.0 37.0 38.0 35-39 37.11625 38.0 38.0 38.0 37.0 38.0 40-44 37.10195 38.0 38.0 38.0 36.6 38.0 45-49 36.98475 38.0 38.0 38.0 36.0 38.0 50-54 36.8874 38.0 38.0 38.0 36.0 38.0 55-59 36.826950000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.815999999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.7597 38.0 38.0 38.0 35.6 38.0 70-74 36.7106 38.0 38.0 38.0 35.6 38.0 75-79 36.59455 38.0 38.0 38.0 35.0 38.0 80-84 36.5154 38.0 38.0 38.0 34.6 38.0 85-89 36.440549999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.20890000000001 38.0 38.0 38.0 33.8 38.0 95-99 36.08675000000001 38.0 37.8 38.0 33.6 38.0 100-104 35.95960000000001 38.0 37.2 38.0 33.0 38.0 105-109 35.8461 38.0 37.0 38.0 32.6 38.0 110-114 35.613099999999996 38.0 37.0 38.0 31.4 38.0 115-119 35.41345 38.0 37.0 38.0 30.2 38.0 120-124 35.315349999999995 38.0 36.0 38.0 30.2 38.0 125-129 34.964749999999995 38.0 36.0 38.0 28.0 38.0 130-134 34.603899999999996 38.0 35.0 38.0 27.2 38.0 135-139 34.4023 38.0 35.0 38.0 25.8 38.0 140-144 33.58605 38.0 34.6 38.0 21.0 38.0 145-149 32.7558 38.0 33.8 38.0 13.8 38.0 150-151 28.9815 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 3.0 5 1.0 6 4.0 7 2.0 8 1.0 9 1.0 10 2.0 11 2.0 12 3.0 13 3.0 14 4.0 15 3.0 16 5.0 17 3.0 18 1.0 19 5.0 20 7.0 21 6.0 22 12.0 23 3.0 24 14.0 25 16.0 26 13.0 27 23.0 28 28.0 29 38.0 30 45.0 31 55.0 32 68.0 33 116.0 34 166.0 35 286.0 36 713.0 37 2341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.375 15.675 13.4 31.55 2 22.7 23.45 36.7 17.150000000000002 3 20.424999999999997 26.400000000000002 31.025000000000002 22.15 4 21.975 36.625 21.925 19.475 5 23.674999999999997 36.925000000000004 22.3 17.1 6 17.849999999999998 37.675 23.25 21.224999999999998 7 16.475 16.175 44.675 22.675 8 21.2 21.875 28.000000000000004 28.925 9 22.575 22.900000000000002 28.7 25.825 10-14 22.46 28.82 27.26 21.46 15-19 22.935 27.615000000000002 27.915 21.535 20-24 22.66 27.6 28.494999999999997 21.245 25-29 22.96 28.115000000000002 28.175 20.75 30-34 22.470000000000002 28.03 28.82 20.68 35-39 22.475 28.349999999999998 28.37 20.805 40-44 22.814999999999998 28.17 28.03 20.985 45-49 22.855 28.16 28.055000000000003 20.93 50-54 22.95 28.384999999999998 28.235 20.43 55-59 23.32 27.384999999999998 28.384999999999998 20.91 60-64 23.01 28.01 28.194999999999997 20.785 65-69 22.49 28.13 28.38 21.0 70-74 22.900000000000002 28.395 27.474999999999998 21.23 75-79 22.685 28.689999999999998 27.36 21.265 80-84 23.335 28.4 27.689999999999998 20.575 85-89 22.63 28.199999999999996 28.13 21.04 90-94 23.235 27.46 28.51 20.794999999999998 95-99 23.375 27.975 28.449999999999996 20.200000000000003 100-104 23.53 28.57 27.655 20.244999999999997 105-109 23.185 27.785 28.499999999999996 20.53 110-114 23.78 28.345 27.52 20.355 115-119 23.875 28.225 27.715 20.185 120-124 23.575 27.925 28.01 20.49 125-129 23.685000000000002 28.325 27.73 20.26 130-134 23.825 28.26 27.650000000000002 20.265 135-139 24.26 27.884999999999998 27.595 20.26 140-144 25.34 27.700000000000003 27.705000000000002 19.255 145-149 25.21 27.57 26.784999999999997 20.435 150-151 25.31582238899312 27.12945590994372 27.21701063164478 20.337711069418386 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 1.0 22 1.5 23 2.5 24 4.0 25 4.5 26 3.5 27 6.5 28 9.0 29 8.0 30 13.0 31 24.5 32 30.0 33 36.0 34 55.0 35 69.0 36 78.0 37 104.0 38 134.5 39 165.0 40 213.0 41 247.5 42 256.0 43 259.5 44 279.5 45 283.5 46 264.5 47 240.0 48 224.0 49 198.0 50 164.0 51 147.0 52 105.0 53 80.0 54 75.0 55 55.5 56 38.0 57 28.5 58 21.5 59 17.5 60 15.5 61 10.0 62 5.5 63 3.5 64 3.5 65 2.5 66 1.5 67 1.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCGA 10 0.006830828 145.0 4 AATCGAA 10 0.006830828 145.0 5 GCTCAGG 10 0.006830828 145.0 5 >>END_MODULE Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739110 spots for SRR7166167.sra Written 739110 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra Read 739101 spots for SRR7166167.sra Written 739101 spots for SRR7166167.sra SRR ids: ['SRR7166167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w30m20n4 SRR7166167.sra spots: 14782029 blocks: [[1, 739101], [739102, 1478202], [1478203, 2217303], [2217304, 2956404], [2956405, 3695505], [3695506, 4434606], [4434607, 5173707], [5173708, 5912808], [5912809, 6651909], [6651910, 7391010], [7391011, 8130111], [8130112, 8869212], [8869213, 9608313], [9608314, 10347414], [10347415, 11086515], [11086516, 11825616], [11825617, 12564717], [12564718, 13303818], [13303819, 14042919], [14042920, 14782029]] SRR7166167 file size 4987444 SRR7166167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166167 SRR7166167_1.fastq SRR7166167_2.fastq Input file: SRR7166167_1.fastq Paired file: SRR7166167_2.fastq trimmed: SRR7166167-trimmed-pair1.fastq, SRR7166167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:21:32 2025 >> started Fri Feb 14 18:21:55 2025 >> done (22.179s) 14782029 read pairs processed; of these: 7582 ( 0.05%) short read pairs filtered out after trimming by size control 5749 ( 0.04%) empty read pairs filtered out after trimming by size control 14768698 (99.91%) read pairs available; of these: 6571754 (44.50%) trimmed read pairs available after processing 8196944 (55.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 8 0.00% 24 9 0.00% 25 3 0.00% 26 5 0.00% 27 6 0.00% 28 11 0.00% 29 9 0.00% 30 7 0.00% 31 8 0.00% 32 5 0.00% 33 12 0.00% 34 3 0.00% 35 6 0.00% 36 8 0.00% 37 13 0.00% 38 14 0.00% 39 8 0.00% 40 14 0.00% 41 19 0.00% 42 18 0.00% 43 19 0.00% 44 20 0.00% 45 16 0.00% 46 24 0.00% 47 27 0.00% 48 27 0.00% 49 37 0.00% 50 52 0.00% 51 50 0.00% 52 60 0.00% 53 59 0.00% 54 62 0.00% 55 68 0.00% 56 78 0.00% 57 106 0.00% 58 125 0.00% 59 149 0.00% 60 176 0.00% 61 181 0.00% 62 232 0.00% 63 224 0.00% 64 264 0.00% 65 311 0.00% 66 351 0.00% 67 384 0.00% 68 453 0.00% 69 516 0.00% 70 571 0.00% 71 697 0.00% 72 807 0.01% 73 930 0.01% 74 1055 0.01% 75 1191 0.01% 76 1395 0.01% 77 1465 0.01% 78 1657 0.01% 79 1837 0.01% 80 2104 0.01% 81 2475 0.02% 82 2795 0.02% 83 3286 0.02% 84 4147 0.03% 85 4543 0.03% 86 4726 0.03% 87 5071 0.03% 88 5680 0.04% 89 5887 0.04% 90 6558 0.04% 91 7321 0.05% 92 8092 0.05% 93 9046 0.06% 94 9469 0.06% 95 10395 0.07% 96 10913 0.07% 97 11223 0.08% 98 12140 0.08% 99 13385 0.09% 100 13533 0.09% 101 14808 0.10% 102 15849 0.11% 103 17106 0.12% 104 18326 0.12% 105 19249 0.13% 106 20184 0.14% 107 20562 0.14% 108 21480 0.15% 109 22175 0.15% 110 22963 0.16% 111 24622 0.17% 112 26268 0.18% 113 27636 0.19% 114 29539 0.20% 115 31021 0.21% 116 31444 0.21% 117 32858 0.22% 118 33665 0.23% 119 34145 0.23% 120 35276 0.24% 121 36728 0.25% 122 38509 0.26% 123 40809 0.28% 124 43039 0.29% 125 44953 0.30% 126 46588 0.32% 127 47385 0.32% 128 48573 0.33% 129 49936 0.34% 130 51223 0.35% 131 52572 0.36% 132 56283 0.38% 133 58514 0.40% 134 61993 0.42% 135 65460 0.44% 136 68066 0.46% 137 71773 0.49% 138 74195 0.50% 139 77658 0.53% 140 81359 0.55% 141 87423 0.59% 142 95352 0.65% 143 104672 0.71% 144 119269 0.81% 145 141090 0.96% 146 168894 1.14% 147 218181 1.48% 148 317893 2.15% 149 597558 4.05% 150 2937950 19.89% 151 8196944 55.50% 14768698 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=175.28 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.3 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=24 prefix-density=0.24 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=328.26 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=23.4 sequence=GAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCCA SRR7166167 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:23:18 Started mapping on | Feb 14 18:23:18 Finished on | Feb 14 18:25:46 Mapping speed, Million of reads per hour | 359.24 Number of input reads | 14768698 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13656179 Uniquely mapped reads % | 92.47% Average mapped length | 293.04 Number of splices: Total | 13387427 Number of splices: Annotated (sjdb) | 13143453 Number of splices: GT/AG | 13170418 Number of splices: GC/AG | 171290 Number of splices: AT/AC | 9949 Number of splices: Non-canonical | 35770 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366150 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 49060 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 754062 754062 754062 N_multimapping 366150 366150 366150 N_noFeature 413673 13491976 521192 N_ambiguous 129582 1109 72014 UnstrandedReadsAssigned:13112924 PositiveStrandReadsAssigned:163094 NegativeStrandReadsAssigned:13062973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166167-trimmed-pair1.fastq SRR7166167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,768,698 reads, 13,020,061 reads pseudoaligned [quant] estimated average fragment length: 232.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR7166167.ke.tsv 34699 SRR7166167.se.tsv 87100 total ==> SRR7166167.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.34 1237 57.5495 Potri.005G024800.1.v4.1 1035 803.339 199 20.5868 Potri.004G059700.1.v4.1 961 729.4 20 2.27877 Potri.007G009000.2.v4.1 1416 1184.34 0 0 Potri.003G141000.2.v4.1 2943 2711.34 419 12.843 Potri.016G087400.1.v4.1 270 86.5217 587 563.83 Potri.015G069301.1.v4.1 564 337.204 0 0 Potri.010G195200.1.v4.1 1773 1541.34 441.828 23.8227 Potri.012G127500.1.v4.1 977 745.367 6799 758.072 ==> SRR7166167.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 120 SRR7166167 completed mapping pipeline successfully