Starting /dee2/code/volunteer_pipeline.sh SRR7166168 current disk space = 3109968613376 free memory = 1574606452 SRR7166168 SRAfilesize ab2b21bf575c3913b77b4e8228265738 SRR7166168.sra SRR7166168.sra file validated SRR7166168 is paired end SRR7166168 is conventional basespace SRR7166168 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166168_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96325 33.0 32.0 34.0 30.0 34.0 2 32.13975 33.0 33.0 34.0 29.0 34.0 3 32.24775 33.0 33.0 34.0 29.0 34.0 4 32.032 33.0 33.0 34.0 29.0 34.0 5 32.2775 33.0 33.0 34.0 31.0 34.0 6 36.48025 38.0 37.0 38.0 34.0 38.0 7 36.69925 38.0 38.0 38.0 34.0 38.0 8 37.07425 38.0 38.0 38.0 36.0 38.0 9 36.7225 38.0 38.0 38.0 34.0 38.0 10-14 37.00865 38.0 38.0 38.0 35.8 38.0 15-19 36.985299999999995 38.0 38.0 38.0 35.8 38.0 20-24 36.982949999999995 38.0 38.0 38.0 35.6 38.0 25-29 36.674549999999996 38.0 38.0 38.0 34.4 38.0 30-34 36.236200000000004 38.0 37.2 38.0 33.2 38.0 35-39 36.14704999999999 38.0 37.0 38.0 32.6 38.0 40-44 36.05225 38.0 37.0 38.0 32.2 38.0 45-49 35.8741 38.0 36.6 38.0 31.0 38.0 50-54 35.55015 38.0 36.6 38.0 29.6 38.0 55-59 35.380849999999995 38.0 36.0 38.0 28.8 38.0 60-64 35.3657 38.0 36.0 38.0 28.6 38.0 65-69 35.37445 38.0 36.0 38.0 28.8 38.0 70-74 35.1803 38.0 35.8 38.0 28.6 38.0 75-79 34.65095 38.0 35.6 38.0 26.2 38.0 80-84 34.49465 38.0 35.2 38.0 25.6 38.0 85-89 34.29275 38.0 34.4 38.0 23.2 38.0 90-94 34.3985 38.0 34.4 38.0 24.8 38.0 95-99 34.243100000000005 38.0 34.0 38.0 24.2 38.0 100-104 33.557900000000004 37.4 33.2 38.0 16.6 38.0 105-109 33.0892 37.0 32.2 38.0 15.0 38.0 110-114 32.3587 37.0 30.2 38.0 15.0 38.0 115-119 32.19075 37.0 30.2 38.0 15.0 38.0 120-124 31.4543 36.2 29.0 38.0 15.0 38.0 125-129 30.517500000000002 35.2 26.2 38.0 14.4 38.0 130-134 29.161199999999997 34.2 23.2 38.0 13.0 38.0 135-139 27.9169 33.0 20.4 38.0 6.4 38.0 140-144 26.4135 33.0 14.6 38.0 2.0 38.0 145-149 24.1841 32.2 6.4 38.0 2.0 38.0 150-151 18.11125 16.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 0.0 12 3.0 13 0.0 14 3.0 15 4.0 16 5.0 17 4.0 18 7.0 19 12.0 20 16.0 21 20.0 22 41.0 23 43.0 24 51.0 25 70.0 26 72.0 27 70.0 28 124.0 29 133.0 30 181.0 31 194.0 32 236.0 33 318.0 34 420.0 35 635.0 36 854.0 37 480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.807692307692307 18.95242914979757 10.349190283400809 40.89068825910931 2 17.9 25.525 41.0 15.575 3 15.25 31.45 28.549999999999997 24.75 4 20.349999999999998 36.975 23.474999999999998 19.2 5 19.650000000000002 37.325 24.0 19.025 6 17.150000000000002 35.5 25.974999999999998 21.375 7 11.725 21.6 45.65 21.025 8 18.475 20.849999999999998 28.549999999999997 32.125 9 18.425 20.025000000000002 32.375 29.175 10-14 18.705 30.835 26.534999999999997 23.925 15-19 19.285 29.67 27.935 23.11 20-24 19.775000000000002 29.57 27.515 23.14 25-29 19.744999999999997 29.62 28.075 22.56 30-34 19.5 29.725 27.925 22.85 35-39 19.655 29.035 28.125 23.185 40-44 19.77 29.654999999999998 27.77 22.805 45-49 19.36 29.154999999999998 27.975 23.51 50-54 19.195 29.675 27.905 23.225 55-59 19.585 29.29 28.1 23.025000000000002 60-64 19.15 28.83 28.689999999999998 23.330000000000002 65-69 19.759999999999998 29.56 27.495000000000005 23.185 70-74 19.643393769407993 29.5452268857057 27.9324852248823 22.878894120004006 75-79 18.993111831442462 29.25952188006483 28.322528363047 23.424837925445704 80-84 19.33421293007206 29.782807266822285 27.70222267329747 23.18075712980818 85-89 19.752962944441666 29.539430914637194 27.489123368505275 23.218482772415864 90-94 20.02 29.21 27.805000000000003 22.965 95-99 19.695 29.220000000000002 28.244999999999997 22.84 100-104 20.125 29.715000000000003 27.62 22.54 105-109 20.185 29.349999999999998 27.62 22.845 110-114 20.525 28.999999999999996 27.779999999999998 22.695 115-119 21.029999999999998 29.080000000000002 27.1 22.79 120-124 20.803723351015915 29.176258632769493 27.129416474827345 22.890601541387248 125-129 20.76067348165965 29.780517137702944 27.10964121066346 22.349168169973943 130-134 20.90058183657981 29.172780166961804 27.00733620035416 22.919301796104225 135-139 21.578657038262875 29.30645403941628 27.415876836668176 21.699012085652676 140-144 22.16 29.595 26.395000000000003 21.85 145-149 21.023443408116965 28.802621628434583 26.56415427275019 23.60978069069826 150-151 21.482223335002505 26.940410615923888 27.954431647471207 23.622934401602404 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.5 22 2.5 23 3.5 24 5.0 25 5.0 26 7.0 27 10.5 28 12.5 29 19.0 30 27.0 31 33.0 32 41.5 33 59.0 34 78.5 35 102.0 36 126.0 37 150.5 38 179.0 39 207.5 40 228.5 41 236.5 42 250.5 43 267.0 44 276.5 45 259.0 46 240.0 47 226.0 48 204.0 49 169.5 50 131.5 51 112.0 52 91.0 53 64.0 54 40.5 55 38.5 56 32.0 57 18.5 58 12.5 59 7.0 60 6.5 61 3.5 62 1.5 63 1.5 64 1.5 65 2.0 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.16999999999999998 75-79 1.28 80-84 1.47 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.09 125-129 0.22 130-134 1.175 135-139 0.295 140-144 0.0 145-149 0.8250000000000001 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4500000000000002 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.262499999999999 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.7625 0.0 0.0 0.0 0.0 132-133 6.55 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.862500000000001 0.0 0.0 0.0 0.0 138-139 8.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCAA 10 0.006843168 144.91249 1 >>END_MODULE SRR7166168 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166168_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60575 33.0 33.0 34.0 32.0 34.0 2 32.72 33.0 33.0 34.0 32.0 34.0 3 32.60825 34.0 33.0 34.0 31.0 34.0 4 32.406 33.0 33.0 34.0 31.0 34.0 5 32.716 34.0 33.0 34.0 32.0 34.0 6 36.7875 38.0 38.0 38.0 35.0 38.0 7 36.75525 38.0 38.0 38.0 35.0 38.0 8 36.73725 38.0 38.0 38.0 35.0 38.0 9 36.77325 38.0 38.0 38.0 35.0 38.0 10-14 36.7025 38.0 38.0 38.0 35.2 38.0 15-19 36.40145 38.0 38.0 38.0 33.8 38.0 20-24 36.4043 38.0 38.0 38.0 34.0 38.0 25-29 36.4157 38.0 38.0 38.0 34.0 38.0 30-34 36.44175 38.0 38.0 38.0 34.2 38.0 35-39 36.108349999999994 38.0 38.0 38.0 33.0 38.0 40-44 36.183899999999994 38.0 38.0 38.0 33.4 38.0 45-49 35.86055 38.0 37.4 38.0 31.2 38.0 50-54 35.882349999999995 38.0 37.4 38.0 30.6 38.0 55-59 35.83305 38.0 37.2 38.0 31.4 38.0 60-64 35.8529 38.0 37.2 38.0 31.4 38.0 65-69 35.52695 38.0 37.0 38.0 29.2 38.0 70-74 35.6464 38.0 37.0 38.0 29.8 38.0 75-79 35.355599999999995 38.0 36.6 38.0 28.8 38.0 80-84 35.183499999999995 38.0 36.0 38.0 28.6 38.0 85-89 35.28035 38.0 36.6 38.0 28.4 38.0 90-94 35.248000000000005 38.0 36.6 38.0 28.6 38.0 95-99 34.80215 38.0 36.0 38.0 26.6 38.0 100-104 34.494299999999996 38.0 35.2 38.0 24.8 38.0 105-109 34.4031 38.0 35.0 38.0 24.6 38.0 110-114 33.9298 38.0 34.2 38.0 22.2 38.0 115-119 33.71215 38.0 34.0 38.0 19.4 38.0 120-124 32.96475 38.0 33.2 38.0 15.0 38.0 125-129 31.9797 37.0 31.2 38.0 15.0 38.0 130-134 31.143849999999997 36.6 29.4 38.0 13.4 38.0 135-139 30.49525 36.0 28.4 38.0 13.0 38.0 140-144 29.2788 35.4 25.2 38.0 5.6 38.0 145-149 27.3084 33.6 17.0 38.0 2.0 38.0 150-151 21.039 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 8.0 4 0.0 5 1.0 6 6.0 7 3.0 8 1.0 9 0.0 10 4.0 11 4.0 12 2.0 13 4.0 14 10.0 15 3.0 16 6.0 17 11.0 18 10.0 19 12.0 20 12.0 21 20.0 22 33.0 23 35.0 24 31.0 25 38.0 26 55.0 27 66.0 28 66.0 29 83.0 30 101.0 31 132.0 32 159.0 33 215.0 34 302.0 35 450.0 36 833.0 37 1278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.025 16.25 13.775 35.949999999999996 2 22.2 22.7 40.300000000000004 14.799999999999999 3 18.025 25.124999999999996 35.125 21.725 4 22.45 35.199999999999996 22.55 19.8 5 21.45 39.85 21.175 17.525 6 18.45 36.125 24.725 20.7 7 15.675 15.6 47.099999999999994 21.625 8 19.3 21.224999999999998 29.549999999999997 29.925 9 21.0 22.05 31.874999999999996 25.074999999999996 10-14 21.92 28.67 28.055000000000003 21.355 15-19 22.23 27.66 28.96 21.15 20-24 21.78 28.244999999999997 29.07 20.905 25-29 21.955 28.349999999999998 28.79 20.905 30-34 22.49 28.33 28.485 20.695 35-39 22.645 27.785 28.93 20.64 40-44 22.195 27.855 28.89 21.060000000000002 45-49 21.61 28.17 29.385 20.835 50-54 22.25 27.950000000000003 28.865000000000002 20.935000000000002 55-59 22.775000000000002 27.994999999999997 28.634999999999998 20.595 60-64 22.830000000000002 27.97 29.29 19.91 65-69 22.6 27.93 28.93 20.54 70-74 23.1 27.575 28.925 20.4 75-79 22.99 27.685 28.865000000000002 20.46 80-84 22.650000000000002 28.139999999999997 28.975 20.235 85-89 22.830000000000002 27.355 29.215000000000003 20.599999999999998 90-94 22.66 28.425 29.275000000000002 19.64 95-99 22.555 28.165000000000003 29.060000000000002 20.22 100-104 22.985 28.52 28.485 20.01 105-109 23.49 27.845 29.085 19.580000000000002 110-114 23.605 28.09 28.439999999999998 19.865 115-119 23.400000000000002 28.105000000000004 28.505000000000003 19.99 120-124 23.995 28.549999999999997 28.265 19.189999999999998 125-129 24.01 27.994999999999997 28.055000000000003 19.939999999999998 130-134 24.224999999999998 28.025 27.93 19.82 135-139 24.115000000000002 28.244999999999997 28.24 19.400000000000002 140-144 25.05 28.52 27.11 19.32 145-149 25.535000000000004 27.48 27.675 19.31 150-151 25.45 26.924999999999997 28.599999999999998 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 4.0 26 7.0 27 10.0 28 11.0 29 11.5 30 21.0 31 27.0 32 28.0 33 34.5 34 53.5 35 79.5 36 111.5 37 130.0 38 160.5 39 199.5 40 212.5 41 236.5 42 282.0 43 303.5 44 301.5 45 289.5 46 251.5 47 250.0 48 222.0 49 172.0 50 153.0 51 114.5 52 81.5 53 67.0 54 51.5 55 34.0 56 25.0 57 15.5 58 10.5 59 10.0 60 7.5 61 4.5 62 3.5 63 2.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62292609351434 99.075 2 0.301659125188537 0.6 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.487500000000001 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.7125 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGGT 10 0.006830828 145.0 2 ACTTGAG 10 0.006830828 145.0 5 TCTCTCG 10 0.006830828 145.0 3 AAGAAGA 35 0.0035366106 20.714287 10-14 >>END_MODULE Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603841 spots for SRR7166168.sra Written 603841 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra Read 603840 spots for SRR7166168.sra Written 603840 spots for SRR7166168.sra SRR ids: ['SRR7166168.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ae8gs2ay SRR7166168.sra spots: 12076801 blocks: [[1, 603840], [603841, 1207680], [1207681, 1811520], [1811521, 2415360], [2415361, 3019200], [3019201, 3623040], [3623041, 4226880], [4226881, 4830720], [4830721, 5434560], [5434561, 6038400], [6038401, 6642240], [6642241, 7246080], [7246081, 7849920], [7849921, 8453760], [8453761, 9057600], [9057601, 9661440], [9661441, 10265280], [10265281, 10869120], [10869121, 11472960], [11472961, 12076801]] SRR7166168 file size 4070731 SRR7166168 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166168 SRR7166168_1.fastq SRR7166168_2.fastq Input file: SRR7166168_1.fastq Paired file: SRR7166168_2.fastq trimmed: SRR7166168-trimmed-pair1.fastq, SRR7166168-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:05:23 2025 >> started Fri Feb 14 20:05:37 2025 >> done (13.588s) 12076801 read pairs processed; of these: 8137 ( 0.07%) short read pairs filtered out after trimming by size control 7580 ( 0.06%) empty read pairs filtered out after trimming by size control 12061084 (99.87%) read pairs available; of these: 7771742 (64.44%) trimmed read pairs available after processing 4289342 (35.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 13 0.00% 21 1 0.00% 22 8 0.00% 23 6 0.00% 24 9 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 8 0.00% 29 10 0.00% 30 8 0.00% 31 9 0.00% 32 14 0.00% 33 6 0.00% 34 11 0.00% 35 5 0.00% 36 21 0.00% 37 8 0.00% 38 15 0.00% 39 15 0.00% 40 15 0.00% 41 22 0.00% 42 18 0.00% 43 25 0.00% 44 30 0.00% 45 35 0.00% 46 31 0.00% 47 29 0.00% 48 46 0.00% 49 44 0.00% 50 60 0.00% 51 45 0.00% 52 75 0.00% 53 81 0.00% 54 83 0.00% 55 128 0.00% 56 116 0.00% 57 136 0.00% 58 146 0.00% 59 182 0.00% 60 227 0.00% 61 278 0.00% 62 297 0.00% 63 369 0.00% 64 389 0.00% 65 424 0.00% 66 431 0.00% 67 526 0.00% 68 597 0.00% 69 739 0.01% 70 846 0.01% 71 960 0.01% 72 1136 0.01% 73 1194 0.01% 74 1381 0.01% 75 1418 0.01% 76 1527 0.01% 77 1518 0.01% 78 1649 0.01% 79 1862 0.02% 80 2055 0.02% 81 2495 0.02% 82 2826 0.02% 83 3213 0.03% 84 3847 0.03% 85 4314 0.04% 86 4369 0.04% 87 5050 0.04% 88 5427 0.04% 89 5638 0.05% 90 6691 0.06% 91 7923 0.07% 92 8706 0.07% 93 9531 0.08% 94 9846 0.08% 95 9997 0.08% 96 10245 0.08% 97 11387 0.09% 98 11901 0.10% 99 13178 0.11% 100 14255 0.12% 101 14373 0.12% 102 14648 0.12% 103 15576 0.13% 104 17497 0.15% 105 18541 0.15% 106 18911 0.16% 107 19320 0.16% 108 20122 0.17% 109 20866 0.17% 110 22381 0.19% 111 23117 0.19% 112 25445 0.21% 113 27268 0.23% 114 28133 0.23% 115 28400 0.24% 116 30210 0.25% 117 33644 0.28% 118 35975 0.30% 119 38351 0.32% 120 38677 0.32% 121 38699 0.32% 122 39288 0.33% 123 41341 0.34% 124 45187 0.37% 125 48553 0.40% 126 50638 0.42% 127 54492 0.45% 128 56093 0.47% 129 60906 0.50% 130 63535 0.53% 131 69602 0.58% 132 74337 0.62% 133 79248 0.66% 134 84343 0.70% 135 90940 0.75% 136 92771 0.77% 137 95524 0.79% 138 103757 0.86% 139 118067 0.98% 140 137109 1.14% 141 130217 1.08% 142 139689 1.16% 143 154047 1.28% 144 177289 1.47% 145 211687 1.76% 146 266807 2.21% 147 357876 2.97% 148 510822 4.24% 149 871769 7.23% 150 2843444 23.58% 151 4289342 35.56% 12061084 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=33 prefix-density=0.63 prefix-fanout=2.1 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=139.05 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=19.8 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=24 prefix-density=0.84 prefix-fanout=2.1 sequence=TTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=25.88 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=2.7 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7166168 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:06:44 Started mapping on | Feb 14 20:06:45 Finished on | Feb 14 20:08:10 Mapping speed, Million of reads per hour | 510.82 Number of input reads | 12061084 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11378689 Uniquely mapped reads % | 94.34% Average mapped length | 289.63 Number of splices: Total | 10929673 Number of splices: Annotated (sjdb) | 10721103 Number of splices: GT/AG | 10747736 Number of splices: GC/AG | 144421 Number of splices: AT/AC | 7639 Number of splices: Non-canonical | 29877 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.29 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308226 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 23628 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 383700 383700 383700 N_multimapping 308226 308226 308226 N_noFeature 437515 11202787 558627 N_ambiguous 114665 864 59335 UnstrandedReadsAssigned:10826509 PositiveStrandReadsAssigned:175038 NegativeStrandReadsAssigned:10760727 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166168 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166168-trimmed-pair1.fastq SRR7166168-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,061,084 reads, 10,694,333 reads pseudoaligned [quant] estimated average fragment length: 229.961 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7166168.ke.tsv 34699 SRR7166168.se.tsv 87100 total ==> SRR7166168.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.04 1098 54.7878 Potri.005G024800.1.v4.1 1035 806.039 229 25.3618 Potri.004G059700.1.v4.1 961 732.049 19 2.31694 Potri.007G009000.2.v4.1 1416 1187.04 0 0 Potri.003G141000.2.v4.1 2943 2714.04 511.413 16.8212 Potri.016G087400.1.v4.1 270 87.3157 814.261 832.479 Potri.015G069301.1.v4.1 564 338.33 0 0 Potri.010G195200.1.v4.1 1773 1544.04 406 23.473 Potri.012G127500.1.v4.1 977 748.049 2091 249.532 ==> SRR7166168.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 338 SRR7166168 completed mapping pipeline successfully