Starting /dee2/code/volunteer_pipeline.sh SRR7166169 current disk space = 3109825462272 free memory = 1575072112 SRR7166169 SRAfilesize 6cb6d79aba3623851f51e1d196d7099d SRR7166169.sra SRR7166169.sra file validated SRR7166169 is paired end SRR7166169 is conventional basespace SRR7166169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.12875 33.0 28.0 33.0 18.0 34.0 2 31.7015 33.0 31.0 33.0 27.0 34.0 3 31.03225 33.0 31.0 33.0 28.0 34.0 4 32.49275 33.0 33.0 33.0 32.0 34.0 5 32.79975 33.0 33.0 33.0 32.0 34.0 6 36.344 38.0 36.0 38.0 33.0 38.0 7 37.16375 38.0 37.0 38.0 35.0 38.0 8 37.20325 38.0 38.0 38.0 36.0 38.0 9 37.56975 38.0 38.0 38.0 37.0 38.0 10-14 37.6376 38.0 38.0 38.0 38.0 38.0 15-19 37.6072 38.0 38.0 38.0 38.0 38.0 20-24 37.58555 38.0 38.0 38.0 38.0 38.0 25-29 37.58315 38.0 38.0 38.0 38.0 38.0 30-34 37.57695 38.0 38.0 38.0 38.0 38.0 35-39 37.52505 38.0 38.0 38.0 37.8 38.0 40-44 37.50795 38.0 38.0 38.0 37.6 38.0 45-49 37.495000000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.4722 38.0 38.0 38.0 37.2 38.0 55-59 37.155199999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2645 38.0 38.0 38.0 37.0 38.0 65-69 37.31945 38.0 38.0 38.0 37.0 38.0 70-74 37.266999999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.1403 38.0 38.0 38.0 36.0 38.0 80-84 37.0957 38.0 38.0 38.0 36.0 38.0 85-89 37.0064 38.0 38.0 38.0 36.0 38.0 90-94 36.8551 38.0 38.0 38.0 35.4 38.0 95-99 36.79755 38.0 38.0 38.0 35.0 38.0 100-104 36.6599 38.0 38.0 38.0 34.8 38.0 105-109 36.5942 38.0 38.0 38.0 34.0 38.0 110-114 36.65885 38.0 38.0 38.0 34.2 38.0 115-119 36.4572 38.0 38.0 38.0 34.0 38.0 120-124 36.1614 38.0 37.6 38.0 33.6 38.0 125-129 35.9692 38.0 37.0 38.0 33.0 38.0 130-134 35.8313 38.0 36.8 38.0 32.4 38.0 135-139 35.67935 38.0 36.2 38.0 32.2 38.0 140-144 35.312200000000004 38.0 36.0 38.0 30.6 38.0 145-149 34.9058 38.0 35.8 38.0 30.0 38.0 150-151 31.734625 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 1.0 20 2.0 21 3.0 22 4.0 23 7.0 24 9.0 25 5.0 26 7.0 27 12.0 28 13.0 29 26.0 30 23.0 31 53.0 32 69.0 33 68.0 34 136.0 35 233.0 36 652.0 37 2673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.51282051282051 17.282051282051285 11.051282051282051 28.153846153846153 2 20.225 23.325000000000003 38.725 17.724999999999998 3 16.575 31.874999999999996 27.950000000000003 23.599999999999998 4 20.275000000000002 37.824999999999996 21.9 20.0 5 20.030007501875467 35.533883470867714 24.48112028007002 19.954988747186796 6 17.974999999999998 35.449999999999996 25.674999999999997 20.9 7 11.425 19.650000000000002 47.825 21.099999999999998 8 17.8 21.375 29.349999999999998 31.474999999999998 9 18.925 20.95 29.75 30.375000000000004 10-14 19.99 29.53 26.974999999999998 23.505000000000003 15-19 20.34 28.345 28.315 23.0 20-24 19.585 29.01 27.845 23.56 25-29 20.86 29.270000000000003 27.42 22.45 30-34 20.075000000000003 28.38 28.249999999999996 23.294999999999998 35-39 19.835 29.26 28.015 22.89 40-44 20.115 29.43 27.705000000000002 22.75 45-49 20.365 29.425 27.060000000000002 23.150000000000002 50-54 20.43 28.970000000000002 27.685 22.915 55-59 19.97179977842683 28.598046127505288 28.23547185013597 23.194682243931915 60-64 20.06104883907126 28.963170536429146 27.17674139311449 23.79903923138511 65-69 20.415 29.345 27.37 22.869999999999997 70-74 20.66 28.084999999999997 28.185 23.07 75-79 20.645 29.005 27.26 23.09 80-84 20.52 28.565 28.15 22.765 85-89 20.630000000000003 28.349999999999998 27.61 23.41 90-94 20.155 28.515 27.875 23.455000000000002 95-99 20.47 28.660000000000004 27.810000000000002 23.06 100-104 21.00760456273764 28.907344406643986 27.24634780868521 22.83870322193316 105-109 21.15827410151166 28.646511162278504 27.395134648112922 22.80008008809691 110-114 20.855 28.499999999999996 27.169999999999998 23.474999999999998 115-119 20.895 28.915000000000003 27.384999999999998 22.805 120-124 20.69 28.425 27.625 23.26 125-129 21.58 28.345 26.805 23.27 130-134 21.279999999999998 28.865000000000002 26.27 23.585 135-139 21.5 28.22 26.815 23.465 140-144 20.53 28.395 27.075 24.0 145-149 21.445 28.435 26.669999999999998 23.45 150-151 21.1639549436796 28.635794743429287 26.170212765957444 24.030037546933666 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.0 25 3.5 26 5.5 27 6.0 28 12.0 29 17.5 30 22.5 31 31.0 32 47.0 33 55.5 34 64.0 35 85.0 36 105.0 37 116.5 38 143.0 39 173.5 40 198.5 41 234.5 42 253.0 43 268.0 44 291.0 45 284.5 46 256.0 47 223.5 48 195.0 49 183.5 50 162.5 51 133.5 52 106.5 53 90.0 54 66.5 55 37.0 56 27.5 57 24.0 58 17.0 59 11.0 60 9.0 61 6.5 62 6.0 63 6.5 64 5.5 65 3.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.7100000000000001 60-64 0.08 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.11 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.2999999999999998 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.9 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.925 0.0 0.0 0.0 0.0 124-125 5.487500000000001 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.550000000000001 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 8.225000000000001 0.0 0.0 0.0 0.0 134-135 8.9625 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 10.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACCG 10 0.0068484643 144.875 7 >>END_MODULE SRR7166169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01725 33.0 33.0 34.0 32.0 34.0 2 33.10825 33.0 33.0 34.0 32.0 34.0 3 33.149 34.0 33.0 34.0 33.0 34.0 4 33.20375 34.0 33.0 34.0 33.0 34.0 5 33.1725 34.0 33.0 34.0 33.0 34.0 6 37.3665 38.0 38.0 38.0 37.0 38.0 7 37.36275 38.0 38.0 38.0 37.0 38.0 8 37.35125 38.0 38.0 38.0 37.0 38.0 9 37.4155 38.0 38.0 38.0 37.0 38.0 10-14 37.405249999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.35935 38.0 38.0 38.0 37.0 38.0 20-24 37.327600000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.2967 38.0 38.0 38.0 37.0 38.0 30-34 37.2528 38.0 38.0 38.0 37.0 38.0 35-39 37.2134 38.0 38.0 38.0 37.0 38.0 40-44 37.1244 38.0 38.0 38.0 36.4 38.0 45-49 37.02585 38.0 38.0 38.0 36.0 38.0 50-54 36.89045 38.0 38.0 38.0 36.0 38.0 55-59 36.84695000000001 38.0 38.0 38.0 35.4 38.0 60-64 36.78175 38.0 38.0 38.0 35.0 38.0 65-69 36.81955000000001 38.0 38.0 38.0 35.0 38.0 70-74 36.665499999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.561 38.0 38.0 38.0 34.2 38.0 80-84 36.411 38.0 38.0 38.0 34.0 38.0 85-89 36.31765 38.0 37.6 38.0 33.8 38.0 90-94 36.1174 38.0 37.0 38.0 33.2 38.0 95-99 35.9316 38.0 37.0 38.0 32.2 38.0 100-104 35.8611 38.0 37.0 38.0 32.2 38.0 105-109 35.580400000000004 38.0 36.8 38.0 30.6 38.0 110-114 35.352999999999994 38.0 36.0 38.0 29.2 38.0 115-119 35.01385 38.0 35.6 38.0 28.0 38.0 120-124 34.6588 38.0 35.2 38.0 26.6 38.0 125-129 34.407000000000004 38.0 35.0 38.0 25.4 38.0 130-134 33.6851 38.0 34.2 38.0 20.6 38.0 135-139 33.2211 38.0 34.0 38.0 17.4 38.0 140-144 32.25165 37.8 33.0 38.0 14.0 38.0 145-149 30.9418 36.8 31.0 38.0 8.6 38.0 150-151 26.305875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 4.0 17 3.0 18 6.0 19 9.0 20 5.0 21 8.0 22 11.0 23 9.0 24 14.0 25 12.0 26 25.0 27 28.0 28 25.0 29 48.0 30 64.0 31 88.0 32 101.0 33 144.0 34 230.0 35 394.0 36 937.0 37 1821.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 16.325 13.850000000000001 29.475 2 23.674999999999997 24.425 35.425000000000004 16.475 3 20.474999999999998 26.700000000000003 31.225 21.6 4 22.975 37.0 21.15 18.875 5 22.5 38.125 22.625 16.75 6 18.6 37.9 23.724999999999998 19.775000000000002 7 16.625 14.85 46.150000000000006 22.375 8 19.75 21.725 26.875 31.65 9 22.225 24.775 27.750000000000004 25.25 10-14 22.765 28.205000000000002 27.215 21.815 15-19 22.84 27.71 28.225 21.224999999999998 20-24 22.82 27.87 28.294999999999998 21.015 25-29 22.71 28.175 28.37 20.745 30-34 22.625 28.03 28.235 21.11 35-39 22.189999999999998 28.499999999999996 28.435 20.875 40-44 22.939999999999998 28.09 28.175 20.794999999999998 45-49 23.169999999999998 27.96 28.349999999999998 20.52 50-54 22.71 28.285 28.294999999999998 20.71 55-59 22.650000000000002 27.450000000000003 28.575 21.325 60-64 23.315 28.249999999999996 28.075 20.36 65-69 22.75 28.01 28.57 20.669999999999998 70-74 22.875 27.779999999999998 28.560000000000002 20.785 75-79 22.925 27.98 28.12 20.974999999999998 80-84 23.0 28.155 28.43 20.415 85-89 22.93 27.944999999999997 28.915000000000003 20.21 90-94 23.79 27.71 28.18 20.32 95-99 23.87 28.01 27.955000000000002 20.165 100-104 23.724999999999998 28.185 28.285 19.805 105-109 23.615 27.615000000000002 27.925 20.845 110-114 23.445 28.705000000000002 27.544999999999998 20.305 115-119 23.51 28.175 27.99 20.325 120-124 23.775 28.015 28.12 20.09 125-129 23.95 28.48 27.255000000000003 20.315 130-134 24.545 27.875 27.875 19.705000000000002 135-139 24.560000000000002 28.405 26.985 20.05 140-144 25.1 27.82 27.16 19.919999999999998 145-149 25.77 27.58 27.42 19.23 150-151 25.328330206378986 27.842401500938085 26.091307066916826 20.737961225766107 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.5 25 2.0 26 4.0 27 5.0 28 6.5 29 13.0 30 18.0 31 25.5 32 32.0 33 41.5 34 60.0 35 73.0 36 91.0 37 109.0 38 134.5 39 161.5 40 190.0 41 232.0 42 272.0 43 290.5 44 276.0 45 267.5 46 273.5 47 262.5 48 223.0 49 190.5 50 154.0 51 124.5 52 113.5 53 87.0 54 64.5 55 48.0 56 34.0 57 27.5 58 26.5 59 18.0 60 9.0 61 9.5 62 8.0 63 4.5 64 3.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.27631248430042704 0.5499999999999999 3 0.025119316754584273 0.075 4 0.050238633509168545 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.0875000000000004 0.0 0.0 0.0 0.0 116-117 3.4625000000000004 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.425000000000001 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.949999999999999 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 7.1 0.0 0.0 0.0 0.0 132-133 8.024999999999999 0.0 0.0 0.0 0.0 134-135 8.725000000000001 0.0 0.0 0.0 0.0 136-137 9.3875 0.0 0.0 0.0 0.0 138-139 10.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTT 10 0.006830828 145.0 5 CAGATTT 10 0.006830828 145.0 9 TGCAGAT 25 8.7132835E-4 87.0 7 >>END_MODULE Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886539 spots for SRR7166169.sra Written 886539 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra Read 886528 spots for SRR7166169.sra Written 886528 spots for SRR7166169.sra SRR ids: ['SRR7166169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jcb1g8ck SRR7166169.sra spots: 17730571 blocks: [[1, 886528], [886529, 1773056], [1773057, 2659584], [2659585, 3546112], [3546113, 4432640], [4432641, 5319168], [5319169, 6205696], [6205697, 7092224], [7092225, 7978752], [7978753, 8865280], [8865281, 9751808], [9751809, 10638336], [10638337, 11524864], [11524865, 12411392], [12411393, 13297920], [13297921, 14184448], [14184449, 15070976], [15070977, 15957504], [15957505, 16844032], [16844033, 17730571]] SRR7166169 file size 5986608 SRR7166169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166169 SRR7166169_1.fastq SRR7166169_2.fastq Input file: SRR7166169_1.fastq Paired file: SRR7166169_2.fastq trimmed: SRR7166169-trimmed-pair1.fastq, SRR7166169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:18:15 2025 >> started Fri Feb 14 20:18:33 2025 >> done (18.336s) 17730571 read pairs processed; of these: 9279 ( 0.05%) short read pairs filtered out after trimming by size control 10486 ( 0.06%) empty read pairs filtered out after trimming by size control 17710806 (99.89%) read pairs available; of these: 8935789 (50.45%) trimmed read pairs available after processing 8775017 (49.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 11 0.00% 21 5 0.00% 22 9 0.00% 23 4 0.00% 24 10 0.00% 25 5 0.00% 26 10 0.00% 27 7 0.00% 28 8 0.00% 29 6 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 15 0.00% 34 11 0.00% 35 12 0.00% 36 8 0.00% 37 10 0.00% 38 15 0.00% 39 17 0.00% 40 18 0.00% 41 26 0.00% 42 16 0.00% 43 30 0.00% 44 31 0.00% 45 29 0.00% 46 23 0.00% 47 47 0.00% 48 45 0.00% 49 62 0.00% 50 87 0.00% 51 74 0.00% 52 80 0.00% 53 87 0.00% 54 102 0.00% 55 111 0.00% 56 151 0.00% 57 176 0.00% 58 191 0.00% 59 236 0.00% 60 286 0.00% 61 360 0.00% 62 333 0.00% 63 407 0.00% 64 474 0.00% 65 516 0.00% 66 568 0.00% 67 594 0.00% 68 691 0.00% 69 818 0.00% 70 988 0.01% 71 1191 0.01% 72 1360 0.01% 73 1557 0.01% 74 1732 0.01% 75 1977 0.01% 76 2112 0.01% 77 2335 0.01% 78 2593 0.01% 79 2975 0.02% 80 3415 0.02% 81 4061 0.02% 82 4554 0.03% 83 5094 0.03% 84 6045 0.03% 85 6973 0.04% 86 7277 0.04% 87 7845 0.04% 88 8567 0.05% 89 9070 0.05% 90 9916 0.06% 91 11149 0.06% 92 12116 0.07% 93 13686 0.08% 94 14672 0.08% 95 15449 0.09% 96 16169 0.09% 97 16846 0.10% 98 18067 0.10% 99 19304 0.11% 100 19458 0.11% 101 21200 0.12% 102 22924 0.13% 103 24758 0.14% 104 25829 0.15% 105 27830 0.16% 106 28552 0.16% 107 29394 0.17% 108 30060 0.17% 109 30945 0.17% 110 32636 0.18% 111 34285 0.19% 112 36585 0.21% 113 38582 0.22% 114 40950 0.23% 115 42738 0.24% 116 44414 0.25% 117 45197 0.26% 118 46387 0.26% 119 46825 0.26% 120 47748 0.27% 121 50452 0.28% 122 52821 0.30% 123 56125 0.32% 124 58937 0.33% 125 60821 0.34% 126 63082 0.36% 127 64527 0.36% 128 65834 0.37% 129 67225 0.38% 130 69864 0.39% 131 72013 0.41% 132 76023 0.43% 133 80335 0.45% 134 84247 0.48% 135 89153 0.50% 136 92669 0.52% 137 97593 0.55% 138 102053 0.58% 139 106800 0.60% 140 112582 0.64% 141 122388 0.69% 142 133364 0.75% 143 147955 0.84% 144 168936 0.95% 145 198447 1.12% 146 241840 1.37% 147 315267 1.78% 148 459410 2.59% 149 854655 4.83% 150 3817105 21.55% 151 8775017 49.55% 17710806 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=17 prefix-density=0.94 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=172.43 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=15.0 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=30 prefix-density=0.87 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=27.32 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.6 sequence=GAGAAGGCAATGAGAGATGC SRR7166169 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:20:13 Started mapping on | Feb 14 20:20:14 Finished on | Feb 14 20:22:22 Mapping speed, Million of reads per hour | 498.12 Number of input reads | 17710806 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16653830 Uniquely mapped reads % | 94.03% Average mapped length | 291.60 Number of splices: Total | 16227759 Number of splices: Annotated (sjdb) | 15922514 Number of splices: GT/AG | 15962423 Number of splices: GC/AG | 206681 Number of splices: AT/AC | 11852 Number of splices: Non-canonical | 46803 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458576 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 41077 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 608829 608829 608829 N_multimapping 458576 458576 458576 N_noFeature 552935 16436748 689137 N_ambiguous 162979 1336 81231 UnstrandedReadsAssigned:15937916 PositiveStrandReadsAssigned:215746 NegativeStrandReadsAssigned:15883462 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166169-trimmed-pair1.fastq SRR7166169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,710,806 reads, 15,759,157 reads pseudoaligned [quant] estimated average fragment length: 224.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7166169.ke.tsv 34699 SRR7166169.se.tsv 87100 total ==> SRR7166169.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.3 1357 45.1844 Potri.005G024800.1.v4.1 1035 811.295 494 36.379 Potri.004G059700.1.v4.1 961 737.305 21 1.70167 Potri.007G009000.2.v4.1 1416 1192.3 0 0 Potri.003G141000.2.v4.1 2943 2719.3 676.598 14.8654 Potri.016G087400.1.v4.1 270 89.5477 1084.51 723.573 Potri.015G069301.1.v4.1 564 344.398 0 0 Potri.010G195200.1.v4.1 1773 1549.3 354.86 13.6844 Potri.012G127500.1.v4.1 977 753.3 5629 446.443 ==> SRR7166169.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 531 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 459 SRR7166169 completed mapping pipeline successfully