Starting /dee2/code/volunteer_pipeline.sh SRR7166170 current disk space = 3109690220544 free memory = 1568928352 SRR7166170 SRAfilesize 4c2ae80fc672a1f70f579806eb82b81b SRR7166170.sra SRR7166170.sra file validated SRR7166170 is paired end SRR7166170 is conventional basespace SRR7166170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95625 33.0 32.0 34.0 31.0 34.0 2 32.06475 33.0 31.0 34.0 29.0 34.0 3 32.25275 33.0 33.0 34.0 29.0 34.0 4 32.0995 33.0 33.0 34.0 29.0 34.0 5 32.1655 33.0 33.0 34.0 31.0 34.0 6 36.60725 38.0 37.0 38.0 34.0 38.0 7 36.76025 38.0 37.0 38.0 35.0 38.0 8 37.02625 38.0 38.0 38.0 35.0 38.0 9 36.643 38.0 38.0 38.0 34.0 38.0 10-14 36.975300000000004 38.0 38.0 38.0 35.4 38.0 15-19 36.963649999999994 38.0 38.0 38.0 35.4 38.0 20-24 36.984950000000005 38.0 38.0 38.0 35.6 38.0 25-29 36.7253 38.0 38.0 38.0 34.4 38.0 30-34 36.24820000000001 38.0 37.2 38.0 33.2 38.0 35-39 36.23745 38.0 37.0 38.0 33.0 38.0 40-44 36.1192 38.0 37.0 38.0 32.6 38.0 45-49 35.892450000000004 38.0 37.0 38.0 31.2 38.0 50-54 35.63415 38.0 36.6 38.0 30.2 38.0 55-59 35.621500000000005 38.0 36.2 38.0 29.4 38.0 60-64 35.3591 38.0 36.0 38.0 28.8 38.0 65-69 35.40070000000001 38.0 36.0 38.0 28.8 38.0 70-74 35.273799999999994 38.0 36.0 38.0 28.6 38.0 75-79 34.79295 38.0 35.6 38.0 27.2 38.0 80-84 34.620999999999995 38.0 35.6 38.0 26.2 38.0 85-89 34.36515000000001 38.0 34.4 38.0 23.4 38.0 90-94 34.53995 38.0 34.6 38.0 25.6 38.0 95-99 34.25554999999999 38.0 34.2 38.0 24.4 38.0 100-104 33.753 37.8 34.0 38.0 18.4 38.0 105-109 33.24395 37.6 32.8 38.0 17.8 38.0 110-114 32.3347 37.0 31.0 38.0 15.0 38.0 115-119 32.1558 37.0 30.6 38.0 15.0 38.0 120-124 31.394399999999997 36.2 28.8 38.0 15.0 38.0 125-129 30.51905 35.4 26.4 38.0 14.4 38.0 130-134 29.187599999999996 34.2 23.2 38.0 13.0 38.0 135-139 27.8456 33.0 20.8 38.0 6.4 38.0 140-144 26.338899999999995 33.0 14.0 38.0 2.0 38.0 145-149 24.267649999999996 31.8 8.2 38.0 2.0 38.0 150-151 18.426375 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 4.0 16 3.0 17 7.0 18 7.0 19 17.0 20 21.0 21 19.0 22 25.0 23 43.0 24 44.0 25 67.0 26 82.0 27 81.0 28 111.0 29 132.0 30 174.0 31 195.0 32 246.0 33 337.0 34 411.0 35 621.0 36 817.0 37 528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.58009095502779 18.595250126326427 9.979787771601819 32.84487114704396 2 19.6 25.6 36.475 18.325 3 16.45 32.35 28.299999999999997 22.900000000000002 4 20.95 37.475 22.05 19.525000000000002 5 21.075 37.4 23.200000000000003 18.325 6 16.025 37.95 24.6 21.425 7 11.475 21.675 46.125 20.724999999999998 8 17.875 20.875 27.925 33.324999999999996 9 16.225 23.150000000000002 30.725 29.9 10-14 19.515 30.64 26.32 23.525 15-19 19.98 29.99 27.224999999999998 22.805 20-24 19.88 30.154999999999998 27.21 22.755 25-29 19.785 29.555 27.325 23.335 30-34 19.93 29.285 27.99 22.795 35-39 19.81 29.555 27.58 23.055 40-44 19.900000000000002 29.349999999999998 27.905 22.845 45-49 19.915 29.799999999999997 26.935 23.35 50-54 19.53 29.310000000000002 27.845 23.315 55-59 19.775000000000002 29.265 27.689999999999998 23.27 60-64 19.925 29.755 27.35 22.97 65-69 19.6 29.755 27.834999999999997 22.81 70-74 19.817653541729285 29.40587115519487 27.612463680993887 23.164011622081958 75-79 19.963536918869647 29.438873695938415 27.595462372126 23.002127013065937 80-84 19.965524234435208 30.211924558913 27.10910565808152 22.71344554857027 85-89 20.33906781356271 29.07581516303261 27.60552110422084 22.979595919183836 90-94 20.266013300665033 29.301465073253663 27.801390069503473 22.63113155657783 95-99 19.994999999999997 28.884999999999998 27.98 23.14 100-104 20.24 29.035 27.905 22.82 105-109 20.44 28.98 27.935 22.645 110-114 20.549999999999997 29.075 27.295 23.080000000000002 115-119 20.544999999999998 29.205 27.485 22.765 120-124 21.41141141141141 29.384384384384383 26.891891891891888 22.31231231231231 125-129 20.637785800240675 29.24689129562776 27.627356598475732 22.48796630565584 130-134 21.429655486416756 29.665604289978248 26.478474224717964 22.426265998887036 135-139 21.779048765803733 30.24784266506121 26.660646197070037 21.31246237206502 140-144 20.965 30.34 26.19 22.505 145-149 20.950313068067057 28.44374873762876 26.73197333871945 23.87396485558473 150-151 21.262999624107255 29.2319258238316 26.35008144342814 23.154993108633004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 0.5 23 3.0 24 8.0 25 7.5 26 7.5 27 11.5 28 15.0 29 22.0 30 31.5 31 34.5 32 40.5 33 57.5 34 84.0 35 97.0 36 101.5 37 124.5 38 163.0 39 201.0 40 217.5 41 227.0 42 254.0 43 278.0 44 262.0 45 246.0 46 247.0 47 232.5 48 218.0 49 183.5 50 146.5 51 113.0 52 79.0 53 68.0 54 61.5 55 47.0 56 29.0 57 22.5 58 16.0 59 13.0 60 9.5 61 4.0 62 3.5 63 3.0 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.19 75-79 1.27 80-84 1.38 85-89 0.02 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.1 125-129 0.27999999999999997 130-134 1.165 135-139 0.33999999999999997 140-144 0.0 145-149 0.98 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 4.112500000000001 0.0 0.0 0.0 0.0 130-131 4.550000000000001 0.0 0.0 0.0 0.0 132-133 5.112500000000001 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTCT 10 0.006875036 144.6875 3 GTCGAGA 10 0.006875036 144.6875 1 ATAAACT 10 0.006875036 144.6875 1 TAACATC 10 0.006875036 144.6875 2 TCGAGAT 10 0.006875036 144.6875 2 TGAGATT 10 0.006875036 144.6875 2 GGGGGGG 20 0.0059980154 28.937498 115-119 >>END_MODULE SRR7166170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.536 33.0 33.0 34.0 32.0 34.0 2 32.58525 33.0 33.0 34.0 32.0 34.0 3 32.5 33.0 33.0 34.0 31.0 34.0 4 32.30725 33.0 33.0 34.0 31.0 34.0 5 32.47325 33.0 33.0 34.0 32.0 34.0 6 36.49625 38.0 38.0 38.0 34.0 38.0 7 36.599 38.0 38.0 38.0 35.0 38.0 8 36.573 38.0 38.0 38.0 35.0 38.0 9 36.683 38.0 38.0 38.0 35.0 38.0 10-14 36.449200000000005 38.0 38.0 38.0 34.2 38.0 15-19 36.267 38.0 38.0 38.0 33.8 38.0 20-24 36.162099999999995 38.0 38.0 38.0 33.4 38.0 25-29 36.199799999999996 38.0 38.0 38.0 33.6 38.0 30-34 36.249300000000005 38.0 38.0 38.0 33.8 38.0 35-39 35.8597 38.0 38.0 38.0 31.4 38.0 40-44 36.0067 38.0 38.0 38.0 32.6 38.0 45-49 35.60855 38.0 37.0 38.0 30.2 38.0 50-54 35.6629 38.0 37.0 38.0 30.2 38.0 55-59 35.634299999999996 38.0 37.0 38.0 30.2 38.0 60-64 35.63195 38.0 37.0 38.0 30.6 38.0 65-69 35.2063 38.0 36.6 38.0 28.4 38.0 70-74 35.32645000000001 38.0 37.0 38.0 28.8 38.0 75-79 35.0646 38.0 36.2 38.0 28.2 38.0 80-84 34.86715 38.0 36.0 38.0 27.2 38.0 85-89 35.0394 38.0 36.2 38.0 28.2 38.0 90-94 34.9083 38.0 36.0 38.0 27.8 38.0 95-99 34.4802 38.0 35.2 38.0 25.4 38.0 100-104 34.079499999999996 38.0 34.8 38.0 21.6 38.0 105-109 34.005449999999996 38.0 34.4 38.0 22.6 38.0 110-114 33.4538 38.0 34.0 38.0 15.0 38.0 115-119 33.294349999999994 38.0 33.8 38.0 15.0 38.0 120-124 32.51545 37.8 32.4 38.0 15.0 38.0 125-129 31.594600000000003 36.8 30.6 38.0 14.4 38.0 130-134 30.693099999999998 36.0 28.2 38.0 13.0 38.0 135-139 29.83805 35.4 26.4 38.0 10.8 38.0 140-144 28.6154 34.8 22.2 38.0 2.0 38.0 145-149 26.56185 33.2 13.4 38.0 2.0 38.0 150-151 20.488500000000002 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 6.0 4 4.0 5 7.0 6 8.0 7 4.0 8 2.0 9 1.0 10 2.0 11 2.0 12 3.0 13 6.0 14 5.0 15 7.0 16 6.0 17 8.0 18 17.0 19 12.0 20 17.0 21 15.0 22 34.0 23 35.0 24 32.0 25 46.0 26 41.0 27 74.0 28 82.0 29 97.0 30 98.0 31 136.0 32 163.0 33 230.0 34 296.0 35 483.0 36 833.0 37 1169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.300000000000004 17.275 13.8 29.625 2 23.674999999999997 22.675 37.1 16.55 3 20.275000000000002 26.674999999999997 32.0 21.05 4 24.0 35.025 22.35 18.625 5 23.025000000000002 39.275 21.125 16.575 6 17.549999999999997 38.324999999999996 25.025 19.1 7 17.150000000000002 15.575 46.150000000000006 21.125 8 20.025000000000002 21.099999999999998 29.549999999999997 29.325000000000003 9 21.825 23.974999999999998 28.625 25.575 10-14 22.49 28.985 27.495000000000005 21.029999999999998 15-19 22.28 28.560000000000002 28.095 21.065 20-24 22.545 28.59 28.410000000000004 20.455000000000002 25-29 21.975 27.779999999999998 29.115000000000002 21.13 30-34 22.505 28.015 28.744999999999997 20.735 35-39 22.79 28.21 28.439999999999998 20.560000000000002 40-44 22.405 28.315 28.645 20.635 45-49 22.495 27.889999999999997 28.849999999999998 20.765 50-54 22.535 27.73 29.099999999999998 20.635 55-59 22.455 28.375 28.610000000000003 20.560000000000002 60-64 22.58 27.52 29.37 20.53 65-69 22.915 27.785 28.7 20.599999999999998 70-74 23.05 28.565 28.025 20.36 75-79 22.21 28.175 29.18 20.435 80-84 23.29 27.500000000000004 28.884999999999998 20.325 85-89 22.39 27.975 29.160000000000004 20.474999999999998 90-94 23.549999999999997 27.38 28.455000000000002 20.615 95-99 22.82 28.08 28.439999999999998 20.66 100-104 23.235 27.265 28.785 20.715 105-109 23.392339233923394 28.032803280328032 28.697869786978696 19.876987698769877 110-114 23.365 28.125 28.610000000000003 19.900000000000002 115-119 23.505000000000003 27.785 28.96 19.75 120-124 23.494999999999997 27.07 29.025000000000002 20.41 125-129 23.669999999999998 28.065 28.439999999999998 19.825 130-134 23.880000000000003 27.189999999999998 28.835 20.095 135-139 23.97 27.51 28.384999999999998 20.135 140-144 24.27 27.515 27.955000000000002 20.26 145-149 24.97 27.224999999999998 27.97 19.835 150-151 25.775 25.674999999999997 28.1875 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.5 23 3.5 24 2.5 25 2.0 26 4.0 27 11.5 28 14.5 29 16.0 30 18.5 31 21.0 32 30.0 33 37.5 34 49.0 35 74.5 36 100.5 37 122.0 38 142.0 39 174.5 40 220.5 41 246.5 42 264.0 43 280.5 44 298.5 45 306.0 46 275.5 47 233.0 48 214.0 49 182.0 50 136.5 51 122.0 52 112.0 53 85.5 54 53.0 55 34.5 56 29.0 57 22.0 58 16.5 59 11.5 60 7.0 61 5.0 62 2.5 63 2.0 64 1.5 65 0.5 66 0.5 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67344888219041 99.2 2 0.25119316754584275 0.5 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025119316754584273 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.85 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.949999999999999 0.0 0.0 0.0 0.0 132-133 5.574999999999999 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACTA 10 0.006830828 145.0 145 TCCATTA 10 0.006830828 145.0 2 TCAAACC 25 8.7132835E-4 87.0 2 CCCCCCC 40 0.0076550315 18.125 20-24 >>END_MODULE Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597727 spots for SRR7166170.sra Written 597727 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra Read 597719 spots for SRR7166170.sra Written 597719 spots for SRR7166170.sra SRR ids: ['SRR7166170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ig4h8u_q SRR7166170.sra spots: 11954388 blocks: [[1, 597719], [597720, 1195438], [1195439, 1793157], [1793158, 2390876], [2390877, 2988595], [2988596, 3586314], [3586315, 4184033], [4184034, 4781752], [4781753, 5379471], [5379472, 5977190], [5977191, 6574909], [6574910, 7172628], [7172629, 7770347], [7770348, 8368066], [8368067, 8965785], [8965786, 9563504], [9563505, 10161223], [10161224, 10758942], [10758943, 11356661], [11356662, 11954388]] SRR7166170 file size 4029249 SRR7166170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166170 SRR7166170_1.fastq SRR7166170_2.fastq Input file: SRR7166170_1.fastq Paired file: SRR7166170_2.fastq trimmed: SRR7166170-trimmed-pair1.fastq, SRR7166170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:32:50 2025 >> started Fri Feb 14 20:33:09 2025 >> done (19.038s) 11954388 read pairs processed; of these: 18253 ( 0.15%) short read pairs filtered out after trimming by size control 21312 ( 0.18%) empty read pairs filtered out after trimming by size control 11914823 (99.67%) read pairs available; of these: 7706117 (64.68%) trimmed read pairs available after processing 4208706 (35.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 2 0.00% 21 5 0.00% 22 11 0.00% 23 13 0.00% 24 8 0.00% 25 6 0.00% 26 10 0.00% 27 7 0.00% 28 5 0.00% 29 8 0.00% 30 10 0.00% 31 9 0.00% 32 9 0.00% 33 6 0.00% 34 13 0.00% 35 9 0.00% 36 16 0.00% 37 7 0.00% 38 12 0.00% 39 18 0.00% 40 15 0.00% 41 19 0.00% 42 24 0.00% 43 23 0.00% 44 22 0.00% 45 29 0.00% 46 40 0.00% 47 38 0.00% 48 42 0.00% 49 54 0.00% 50 61 0.00% 51 65 0.00% 52 71 0.00% 53 75 0.00% 54 94 0.00% 55 101 0.00% 56 108 0.00% 57 134 0.00% 58 175 0.00% 59 147 0.00% 60 209 0.00% 61 236 0.00% 62 301 0.00% 63 305 0.00% 64 331 0.00% 65 397 0.00% 66 445 0.00% 67 468 0.00% 68 613 0.01% 69 628 0.01% 70 679 0.01% 71 878 0.01% 72 982 0.01% 73 1097 0.01% 74 1134 0.01% 75 1275 0.01% 76 1366 0.01% 77 1346 0.01% 78 1569 0.01% 79 1678 0.01% 80 1843 0.02% 81 2080 0.02% 82 2505 0.02% 83 2854 0.02% 84 3654 0.03% 85 4379 0.04% 86 4344 0.04% 87 4739 0.04% 88 4956 0.04% 89 5349 0.04% 90 6010 0.05% 91 6932 0.06% 92 7451 0.06% 93 7991 0.07% 94 8250 0.07% 95 8452 0.07% 96 8707 0.07% 97 9489 0.08% 98 10252 0.09% 99 11221 0.09% 100 12125 0.10% 101 12165 0.10% 102 12767 0.11% 103 13239 0.11% 104 13411 0.11% 105 13218 0.11% 106 13840 0.12% 107 14076 0.12% 108 15396 0.13% 109 17061 0.14% 110 19249 0.16% 111 20205 0.17% 112 22344 0.19% 113 23516 0.20% 114 24723 0.21% 115 25530 0.21% 116 27098 0.23% 117 29458 0.25% 118 32043 0.27% 119 34398 0.29% 120 35226 0.30% 121 35028 0.29% 122 37024 0.31% 123 38981 0.33% 124 42542 0.36% 125 45829 0.38% 126 48628 0.41% 127 52296 0.44% 128 54030 0.45% 129 58341 0.49% 130 61506 0.52% 131 67097 0.56% 132 72577 0.61% 133 77929 0.65% 134 83338 0.70% 135 89812 0.75% 136 92375 0.78% 137 95964 0.81% 138 104662 0.88% 139 119110 1.00% 140 137453 1.15% 141 132368 1.11% 142 141307 1.19% 143 156793 1.32% 144 181589 1.52% 145 216985 1.82% 146 274080 2.30% 147 366155 3.07% 148 521127 4.37% 149 884167 7.42% 150 2847008 23.89% 151 4208706 35.32% 11914823 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=16 prefix-density=0.53 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=57.43 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.0 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=14 prefix-density=0.68 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=66.71 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=16.1 sequence=TTGGTGCTGAGA SRR7166170 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:34:22 Started mapping on | Feb 14 20:34:22 Finished on | Feb 14 20:35:52 Mapping speed, Million of reads per hour | 476.59 Number of input reads | 11914823 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11251553 Uniquely mapped reads % | 94.43% Average mapped length | 290.25 Number of splices: Total | 10633225 Number of splices: Annotated (sjdb) | 10425674 Number of splices: GT/AG | 10462005 Number of splices: GC/AG | 133167 Number of splices: AT/AC | 8586 Number of splices: Non-canonical | 29467 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305575 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 29588 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375111 375111 375111 N_multimapping 305575 305575 305575 N_noFeature 412728 11091516 521391 N_ambiguous 117608 999 65457 UnstrandedReadsAssigned:10721217 PositiveStrandReadsAssigned:159038 NegativeStrandReadsAssigned:10664705 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166170-trimmed-pair1.fastq SRR7166170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,914,823 reads, 10,597,392 reads pseudoaligned [quant] estimated average fragment length: 233.237 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7166170.ke.tsv 34699 SRR7166170.se.tsv 87100 total ==> SRR7166170.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.76 971 50.0086 Potri.005G024800.1.v4.1 1035 802.763 196 22.4553 Potri.004G059700.1.v4.1 961 728.763 7 0.883407 Potri.007G009000.2.v4.1 1416 1183.76 0 0 Potri.003G141000.2.v4.1 2943 2710.76 437.177 14.8325 Potri.016G087400.1.v4.1 270 83.9937 605.501 663.005 Potri.015G069301.1.v4.1 564 335.609 0 0 Potri.010G195200.1.v4.1 1773 1540.76 445.784 26.6096 Potri.012G127500.1.v4.1 977 744.763 7471 922.592 ==> SRR7166170.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 314 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 426 SRR7166170 completed mapping pipeline successfully