Starting /dee2/code/volunteer_pipeline.sh SRR7166173 current disk space = 3110526390272 free memory = 1279751144 SRR7166173 SRAfilesize 74aba84c631feb210bfe015357f4cd46 SRR7166173.sra SRR7166173.sra file validated SRR7166173 is paired end SRR7166173 is conventional basespace SRR7166173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.1585 31.0 18.0 32.0 18.0 33.0 2 30.5045 32.0 30.0 33.0 25.0 33.0 3 32.094 33.0 33.0 33.0 29.0 33.0 4 32.45825 33.0 33.0 33.0 31.0 34.0 5 32.94625 33.0 33.0 34.0 32.0 34.0 6 36.80275 38.0 37.0 38.0 35.0 38.0 7 37.3235 38.0 38.0 38.0 37.0 38.0 8 37.45725 38.0 38.0 38.0 37.0 38.0 9 37.48225 38.0 38.0 38.0 37.0 38.0 10-14 37.512049999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.4997 38.0 38.0 38.0 37.6 38.0 20-24 37.5084 38.0 38.0 38.0 37.4 38.0 25-29 37.405 38.0 38.0 38.0 37.0 38.0 30-34 37.3608 38.0 38.0 38.0 37.0 38.0 35-39 37.32385 38.0 38.0 38.0 37.0 38.0 40-44 37.365899999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.314750000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.10625 38.0 38.0 38.0 36.6 38.0 55-59 36.60525 38.0 38.0 38.0 35.8 38.0 60-64 36.889599999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.05465 38.0 38.0 38.0 36.0 38.0 70-74 36.98485000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.886250000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.86765 38.0 38.0 38.0 35.6 38.0 85-89 36.7376 38.0 38.0 38.0 35.0 38.0 90-94 36.58995 38.0 38.0 38.0 34.2 38.0 95-99 36.5647 38.0 38.0 38.0 34.4 38.0 100-104 36.53335 38.0 38.0 38.0 34.0 38.0 105-109 36.22245 38.0 38.0 38.0 34.0 38.0 110-114 36.117399999999996 38.0 37.8 38.0 33.2 38.0 115-119 35.95585 38.0 37.0 38.0 33.0 38.0 120-124 35.81095 38.0 37.0 38.0 32.0 38.0 125-129 35.65585 38.0 36.8 38.0 31.2 38.0 130-134 35.4656 38.0 36.0 38.0 31.0 38.0 135-139 35.164 38.0 36.0 38.0 28.8 38.0 140-144 34.850199999999994 38.0 35.8 38.0 28.0 38.0 145-149 34.54075 38.0 35.4 38.0 27.6 38.0 150-151 31.262375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 1.0 16 3.0 17 3.0 18 2.0 19 3.0 20 3.0 21 3.0 22 6.0 23 8.0 24 8.0 25 12.0 26 14.0 27 14.0 28 20.0 29 40.0 30 48.0 31 42.0 32 76.0 33 103.0 34 153.0 35 272.0 36 663.0 37 2496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.39085772984078 18.798151001540834 11.941448382126348 31.86954288649204 2 19.875 25.2 36.1 18.825 3 17.7 30.875000000000004 26.224999999999998 25.2 4 21.4 36.575 22.15 19.875 5 19.734867433716857 37.143571785892945 23.611805902951478 19.50975487743872 6 17.0 36.575 23.674999999999997 22.75 7 12.1 20.1 47.725 20.075000000000003 8 17.25 20.7 29.225 32.824999999999996 9 18.224999999999998 21.025 30.45 30.3 10-14 19.595000000000002 30.769999999999996 26.46 23.175 15-19 19.830000000000002 28.660000000000004 28.165000000000003 23.345 20-24 19.775000000000002 29.604999999999997 27.189999999999998 23.43 25-29 19.695 29.935000000000002 27.700000000000003 22.67 30-34 20.01 28.904999999999998 27.52 23.565 35-39 19.97 29.275000000000002 27.3 23.455000000000002 40-44 20.275000000000002 28.970000000000002 27.500000000000004 23.255 45-49 20.66 28.68 27.605 23.055 50-54 20.197910387783804 28.757283504118945 27.868193690978497 23.176612417118747 55-59 20.51060806009542 28.920921733834128 27.6012587554563 22.96721145061415 60-64 20.311401305876444 28.643897538925163 27.86037167252637 23.184329482672027 65-69 20.467280368220933 28.842305383229938 27.506503902341407 23.183910346207725 70-74 20.355 28.355000000000004 27.965 23.325000000000003 75-79 20.235 28.215 27.810000000000002 23.74 80-84 20.175 28.535 27.83 23.46 85-89 20.61 28.715000000000003 27.310000000000002 23.365 90-94 20.4 29.044999999999998 26.950000000000003 23.605 95-99 20.175 28.425 28.515 22.884999999999998 100-104 19.90597179153746 28.583575072521754 28.038411523457036 23.472041612483746 105-109 20.767222333801968 28.404298051817634 27.520586463145207 23.307893151235188 110-114 19.821937678187364 28.980143050067525 27.604661631571048 23.593257640174063 115-119 20.544381066746723 28.66506554588212 27.34414089862904 23.44641248874212 120-124 20.236011800590028 28.536426821341067 27.571378568928445 23.656182809140457 125-129 21.115000000000002 28.720000000000002 27.215 22.95 130-134 20.97 28.73 26.75 23.549999999999997 135-139 21.235 29.049999999999997 26.43 23.285 140-144 20.735 28.57 26.86 23.835 145-149 21.08 29.035 26.135 23.75 150-151 21.211362783131023 28.156676260793397 26.692529095232135 23.93943186084345 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 3.0 24 4.5 25 5.0 26 5.0 27 6.0 28 13.0 29 15.5 30 21.5 31 34.5 32 38.5 33 49.0 34 67.5 35 84.0 36 109.5 37 124.5 38 142.0 39 174.5 40 207.5 41 222.0 42 245.5 43 255.0 44 266.5 45 290.5 46 266.5 47 234.5 48 218.0 49 185.5 50 149.0 51 124.5 52 98.5 53 77.5 54 55.0 55 44.0 56 36.0 57 29.0 58 24.5 59 17.5 60 12.0 61 7.5 62 5.5 63 6.0 64 4.0 65 4.0 66 3.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.45999999999999996 55-59 1.49 60-64 0.44999999999999996 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.42 110-114 0.034999999999999996 115-119 0.06999999999999999 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.9500000000000002 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAACT 10 0.006905315 144.475 145 >>END_MODULE SRR7166173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90525 33.0 33.0 34.0 32.0 34.0 2 33.00425 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 33.01675 34.0 33.0 34.0 32.0 34.0 5 33.00075 34.0 33.0 34.0 32.0 34.0 6 37.156 38.0 38.0 38.0 37.0 38.0 7 37.15375 38.0 38.0 38.0 37.0 38.0 8 37.19275 38.0 38.0 38.0 37.0 38.0 9 37.14975 38.0 38.0 38.0 37.0 38.0 10-14 37.11805 38.0 38.0 38.0 37.0 38.0 15-19 37.122749999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.102500000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.08445 38.0 38.0 38.0 36.6 38.0 30-34 37.076049999999995 38.0 38.0 38.0 36.4 38.0 35-39 36.97395 38.0 38.0 38.0 36.0 38.0 40-44 36.9689 38.0 38.0 38.0 36.0 38.0 45-49 36.8321 38.0 38.0 38.0 36.0 38.0 50-54 36.7332 38.0 38.0 38.0 35.2 38.0 55-59 36.62215 38.0 38.0 38.0 34.6 38.0 60-64 36.64095 38.0 38.0 38.0 34.8 38.0 65-69 36.6423 38.0 38.0 38.0 34.6 38.0 70-74 36.5826 38.0 38.0 38.0 34.8 38.0 75-79 36.41115 38.0 38.0 38.0 34.0 38.0 80-84 36.282799999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.181650000000005 38.0 38.0 38.0 33.6 38.0 90-94 36.0489 38.0 37.2 38.0 33.2 38.0 95-99 35.759550000000004 38.0 37.2 38.0 31.4 38.0 100-104 35.744800000000005 38.0 37.0 38.0 31.6 38.0 105-109 35.6246 38.0 37.0 38.0 31.0 38.0 110-114 35.29774999999999 38.0 36.2 38.0 29.4 38.0 115-119 35.0359 38.0 36.0 38.0 28.4 38.0 120-124 34.74905 38.0 35.6 38.0 27.0 38.0 125-129 34.5572 38.0 35.0 38.0 26.8 38.0 130-134 34.103300000000004 38.0 35.0 38.0 23.2 38.0 135-139 33.8523 38.0 34.8 38.0 22.6 38.0 140-144 33.410250000000005 38.0 34.0 38.0 20.2 38.0 145-149 32.5542 38.0 33.8 38.0 11.4 38.0 150-151 28.235125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 4.0 15 7.0 16 4.0 17 4.0 18 2.0 19 10.0 20 11.0 21 10.0 22 16.0 23 13.0 24 17.0 25 21.0 26 20.0 27 30.0 28 38.0 29 29.0 30 50.0 31 60.0 32 74.0 33 127.0 34 190.0 35 326.0 36 735.0 37 2181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.075 16.225 14.174999999999999 28.525 2 22.6 22.975 35.875 18.55 3 20.625 25.900000000000002 31.65 21.825 4 24.85 35.05 21.45 18.65 5 22.6 38.625 21.3 17.474999999999998 6 17.658829414707352 36.568284142071036 25.887943971985994 19.884942471235618 7 16.483241620810404 15.43271635817909 46.673336668334166 21.410705352676338 8 18.63431715857929 22.311155577788895 29.114557278639317 29.939969984992498 9 24.412206103051524 23.936968484242122 27.01350675337669 24.637318659329665 10-14 22.546273136568285 28.594297148574288 26.828414207103553 22.031015507753875 15-19 23.171585792896447 27.893946973486745 27.973986993496748 20.96048024012006 20-24 22.754101640656263 28.406362545018006 27.991196478591434 20.848339335734295 25-29 23.121560780390197 27.383691845922964 28.414207103551774 21.080540270135067 30-34 22.801400700350175 27.958979489744873 28.31415707853927 20.92546273136568 35-39 22.481240620310157 27.828914457228613 28.53926963481741 21.15057528764382 40-44 22.861430715357677 27.283641820910454 28.844422211105552 21.010505252626313 45-49 22.121060530265133 28.019009504752372 28.38919459729865 21.47073536768384 50-54 23.212767021862025 27.685226874781126 27.92535894742108 21.176647155935765 55-59 23.271635817908955 27.71885942971486 28.099049524762382 20.910455227613806 60-64 23.376688344172088 28.119059529764883 28.129064532266135 20.3751875937969 65-69 23.261630815407706 27.838919459729865 27.883941970985493 21.01550775387694 70-74 23.2874655991994 28.051038278709033 28.401300975731797 20.26019514635977 75-79 22.631973980485366 28.116087065298974 28.701526144608458 20.550412809607206 80-84 22.813688212927758 28.34700820492295 28.29697818691215 20.542325395237143 85-89 23.176588294147074 28.354177088544276 28.099049524762382 20.370185092546272 90-94 23.81190595297649 27.843921960980488 27.673836918459227 20.670335167583794 95-99 24.279567740644385 27.56153692215329 28.10686411847108 20.05203121873124 100-104 23.5029266096353 27.630196608134472 28.185502026114364 20.681374756115865 105-109 23.39669834917459 27.953976988494244 28.409204602301152 20.240120060030016 110-114 23.88813847616189 28.145480014007706 28.030416729201065 19.935964780629345 115-119 23.68131318186368 27.45971374236813 28.120308277449706 20.73866479831849 120-124 23.743743743743746 28.20820820820821 27.902902902902905 20.145145145145147 125-129 23.91293470102577 28.386289717287966 27.46559919939955 20.235176382286717 130-134 24.39719859929965 28.584292146073036 27.048524262131064 19.969984992496247 135-139 24.10705352676338 27.92896448224112 27.94897448724362 20.015007503751875 140-144 24.502251125562783 28.544272136068034 27.123561780890444 19.82991495747874 145-149 25.012506253126567 28.14407203601801 27.358679339669834 19.484742371185593 150-151 24.656164041010253 27.831957989497376 27.544386096524132 19.967491872968242 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 1.0 25 3.5 26 5.5 27 5.5 28 6.5 29 14.5 30 20.0 31 20.0 32 24.0 33 31.5 34 47.0 35 61.5 36 76.5 37 108.5 38 138.0 39 177.5 40 218.5 41 234.5 42 248.0 43 259.0 44 271.0 45 286.5 46 275.5 47 254.5 48 238.0 49 199.0 50 156.0 51 125.5 52 108.5 53 88.5 54 63.0 55 51.0 56 42.5 57 30.0 58 23.5 59 20.5 60 13.0 61 8.5 62 8.0 63 7.5 64 4.5 65 2.5 66 3.0 67 1.5 68 0.5 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.04 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.055 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.075 75-79 0.075 80-84 0.06 85-89 0.05 90-94 0.05 95-99 0.06 100-104 0.055 105-109 0.05 110-114 0.055 115-119 0.09 120-124 0.1 125-129 0.075 130-134 0.05 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.025 0.0 102-103 0.875 0.0 0.0 0.025 0.0 104-105 0.9375 0.0 0.0 0.025 0.0 106-107 1.0625 0.0 0.0 0.025 0.0 108-109 1.15 0.0 0.0 0.025 0.0 110-111 1.2625 0.0 0.0 0.025 0.0 112-113 1.5125 0.0 0.0 0.025 0.0 114-115 1.875 0.0 0.0 0.025 0.0 116-117 2.2625 0.0 0.0 0.025 0.0 118-119 2.6125 0.0 0.0 0.025 0.0 120-121 2.8875 0.0 0.0 0.025 0.0 122-123 3.175 0.0 0.0 0.025 0.0 124-125 3.525 0.0 0.0 0.025 0.0 126-127 3.9375 0.0 0.0 0.025 0.0 128-129 4.2875 0.0 0.0 0.025 0.0 130-131 4.7375 0.0 0.0 0.025 0.0 132-133 5.15 0.0 0.0 0.025 0.0 134-135 5.512499999999999 0.0 0.0 0.025 0.0 136-137 6.1375 0.0 0.0 0.025 0.0 138-139 6.6 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760704 spots for SRR7166173.sra Written 760704 spots for SRR7166173.sra Read 760714 spots for SRR7166173.sra Written 760714 spots for SRR7166173.sra SRR ids: ['SRR7166173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u29uffyo SRR7166173.sra spots: 15214090 blocks: [[1, 760704], [760705, 1521408], [1521409, 2282112], [2282113, 3042816], [3042817, 3803520], [3803521, 4564224], [4564225, 5324928], [5324929, 6085632], [6085633, 6846336], [6846337, 7607040], [7607041, 8367744], [8367745, 9128448], [9128449, 9889152], [9889153, 10649856], [10649857, 11410560], [11410561, 12171264], [12171265, 12931968], [12931969, 13692672], [13692673, 14453376], [14453377, 15214090]] SRR7166173 file size 5133855 SRR7166173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166173 SRR7166173_1.fastq SRR7166173_2.fastq Input file: SRR7166173_1.fastq Paired file: SRR7166173_2.fastq trimmed: SRR7166173-trimmed-pair1.fastq, SRR7166173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:11:34 2025 >> started Fri Feb 14 19:11:54 2025 >> done (19.238s) 15214090 read pairs processed; of these: 16673 ( 0.11%) short read pairs filtered out after trimming by size control 11533 ( 0.08%) empty read pairs filtered out after trimming by size control 15185884 (99.81%) read pairs available; of these: 7002353 (46.11%) trimmed read pairs available after processing 8183531 (53.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 7 0.00% 21 5 0.00% 22 10 0.00% 23 4 0.00% 24 10 0.00% 25 7 0.00% 26 8 0.00% 27 4 0.00% 28 8 0.00% 29 9 0.00% 30 7 0.00% 31 6 0.00% 32 12 0.00% 33 8 0.00% 34 10 0.00% 35 9 0.00% 36 17 0.00% 37 12 0.00% 38 14 0.00% 39 16 0.00% 40 21 0.00% 41 19 0.00% 42 26 0.00% 43 24 0.00% 44 24 0.00% 45 31 0.00% 46 35 0.00% 47 35 0.00% 48 50 0.00% 49 41 0.00% 50 45 0.00% 51 57 0.00% 52 71 0.00% 53 74 0.00% 54 73 0.00% 55 81 0.00% 56 91 0.00% 57 143 0.00% 58 122 0.00% 59 134 0.00% 60 164 0.00% 61 178 0.00% 62 207 0.00% 63 276 0.00% 64 268 0.00% 65 307 0.00% 66 360 0.00% 67 337 0.00% 68 459 0.00% 69 545 0.00% 70 622 0.00% 71 655 0.00% 72 816 0.01% 73 867 0.01% 74 894 0.01% 75 1064 0.01% 76 1306 0.01% 77 1374 0.01% 78 1548 0.01% 79 1603 0.01% 80 1956 0.01% 81 2286 0.02% 82 2634 0.02% 83 3080 0.02% 84 4337 0.03% 85 4499 0.03% 86 4690 0.03% 87 5062 0.03% 88 5440 0.04% 89 5917 0.04% 90 6338 0.04% 91 7005 0.05% 92 7671 0.05% 93 8101 0.05% 94 8840 0.06% 95 9384 0.06% 96 9841 0.06% 97 10511 0.07% 98 11249 0.07% 99 12385 0.08% 100 12663 0.08% 101 13570 0.09% 102 14786 0.10% 103 15639 0.10% 104 16441 0.11% 105 17638 0.12% 106 18437 0.12% 107 19423 0.13% 108 20100 0.13% 109 20957 0.14% 110 22125 0.15% 111 23467 0.15% 112 24808 0.16% 113 26654 0.18% 114 27898 0.18% 115 29527 0.19% 116 30520 0.20% 117 31840 0.21% 118 33086 0.22% 119 33763 0.22% 120 35447 0.23% 121 36729 0.24% 122 38518 0.25% 123 40553 0.27% 124 42684 0.28% 125 44525 0.29% 126 46263 0.30% 127 47713 0.31% 128 48916 0.32% 129 51557 0.34% 130 53112 0.35% 131 55208 0.36% 132 58287 0.38% 133 61400 0.40% 134 64076 0.42% 135 67993 0.45% 136 70678 0.47% 137 74886 0.49% 138 78933 0.52% 139 83470 0.55% 140 88838 0.59% 141 96713 0.64% 142 105275 0.69% 143 115895 0.76% 144 133081 0.88% 145 155474 1.02% 146 189774 1.25% 147 246522 1.62% 148 364956 2.40% 149 679510 4.47% 150 3125552 20.58% 151 8183531 53.89% 15185884 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=21 prefix-density=0.54 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=14.28 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.4 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=23 prefix-density=0.52 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=116.45 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=15.3 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7166173 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:13:22 Started mapping on | Feb 14 19:13:23 Finished on | Feb 14 19:16:16 Mapping speed, Million of reads per hour | 316.01 Number of input reads | 15185884 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13941070 Uniquely mapped reads % | 91.80% Average mapped length | 293.22 Number of splices: Total | 13208902 Number of splices: Annotated (sjdb) | 12947905 Number of splices: GT/AG | 12991565 Number of splices: GC/AG | 168632 Number of splices: AT/AC | 9739 Number of splices: Non-canonical | 38966 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388084 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 41297 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.27% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 871530 871530 871530 N_multimapping 388084 388084 388084 N_noFeature 477835 13737543 605135 N_ambiguous 149340 1243 72244 UnstrandedReadsAssigned:13313895 PositiveStrandReadsAssigned:202284 NegativeStrandReadsAssigned:13263691 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166173-trimmed-pair1.fastq SRR7166173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,185,884 reads, 13,215,043 reads pseudoaligned [quant] estimated average fragment length: 238.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7166173.ke.tsv 34699 SRR7166173.se.tsv 87100 total ==> SRR7166173.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.41 1242 53.3127 Potri.005G024800.1.v4.1 1035 797.408 197 18.8805 Potri.004G059700.1.v4.1 961 723.455 11 1.16201 Potri.007G009000.2.v4.1 1416 1178.41 0 0 Potri.003G141000.2.v4.1 2943 2705.41 575.439 16.2553 Potri.016G087400.1.v4.1 270 84.6922 669 603.686 Potri.015G069301.1.v4.1 564 333.034 0 0 Potri.010G195200.1.v4.1 1773 1535.41 591 29.4166 Potri.012G127500.1.v4.1 977 739.429 4805 496.621 ==> SRR7166173.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 106 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 462 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 251 SRR7166173 completed mapping pipeline successfully