Starting /dee2/code/volunteer_pipeline.sh SRR7166174 current disk space = 3109922672640 free memory = 1458793956 SRR7166174 SRAfilesize 75eff2495ba1f31c12509b301a4ebb9a SRR7166174.sra SRR7166174.sra file validated SRR7166174 is paired end SRR7166174 is conventional basespace SRR7166174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.18675 25.0 18.0 31.0 18.0 33.0 2 29.73125 32.0 27.0 33.0 25.0 33.0 3 31.53775 33.0 31.0 33.0 29.0 33.0 4 32.29075 33.0 33.0 33.0 31.0 34.0 5 32.87675 33.0 33.0 34.0 32.0 34.0 6 36.91625 38.0 37.0 38.0 35.0 38.0 7 37.39075 38.0 38.0 38.0 37.0 38.0 8 37.50125 38.0 38.0 38.0 37.0 38.0 9 37.53825 38.0 38.0 38.0 38.0 38.0 10-14 37.5707 38.0 38.0 38.0 37.8 38.0 15-19 37.5495 38.0 38.0 38.0 37.6 38.0 20-24 37.522099999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.4885 38.0 38.0 38.0 37.2 38.0 30-34 37.468 38.0 38.0 38.0 37.6 38.0 35-39 37.416999999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.41575 38.0 38.0 38.0 37.0 38.0 45-49 37.38035 38.0 38.0 38.0 37.0 38.0 50-54 37.1586 38.0 38.0 38.0 36.8 38.0 55-59 36.61465 38.0 38.0 38.0 36.0 38.0 60-64 36.888850000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.100550000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.05955 38.0 38.0 38.0 36.0 38.0 75-79 36.99705 38.0 38.0 38.0 36.0 38.0 80-84 36.94015 38.0 38.0 38.0 35.8 38.0 85-89 36.7834 38.0 38.0 38.0 35.0 38.0 90-94 36.64515 38.0 38.0 38.0 34.8 38.0 95-99 36.5887 38.0 38.0 38.0 34.2 38.0 100-104 36.5044 38.0 38.0 38.0 34.4 38.0 105-109 36.19725 38.0 38.0 38.0 34.0 38.0 110-114 36.1592 38.0 38.0 38.0 33.8 38.0 115-119 36.0221 38.0 37.4 38.0 33.4 38.0 120-124 35.89305 38.0 37.2 38.0 32.8 38.0 125-129 35.70575 38.0 37.0 38.0 31.2 38.0 130-134 35.46385 38.0 36.2 38.0 31.0 38.0 135-139 35.270250000000004 38.0 36.0 38.0 30.6 38.0 140-144 34.89835000000001 38.0 36.0 38.0 28.0 38.0 145-149 34.54175 38.0 35.6 38.0 27.8 38.0 150-151 31.527749999999997 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 2.0 16 1.0 17 6.0 18 3.0 19 2.0 20 2.0 21 8.0 22 4.0 23 6.0 24 6.0 25 13.0 26 16.0 27 18.0 28 16.0 29 35.0 30 43.0 31 43.0 32 62.0 33 119.0 34 148.0 35 261.0 36 650.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.36462093862816 19.907168643630737 12.403300670448685 30.324909747292416 2 18.95 26.575 35.775 18.7 3 17.349999999999998 32.875 27.325 22.45 4 21.325 38.0 21.7 18.975 5 18.575 38.725 23.674999999999997 19.025 6 16.925 37.225 24.4 21.45 7 12.775 21.025 45.725 20.474999999999998 8 17.025000000000002 22.375 27.875 32.725 9 17.275 23.175 29.825000000000003 29.725 10-14 19.56 31.019999999999996 26.31 23.11 15-19 19.759999999999998 29.985 27.065 23.189999999999998 20-24 19.575 29.805 27.52 23.1 25-29 19.33 30.305 27.41 22.955000000000002 30-34 19.74 29.909999999999997 27.41 22.939999999999998 35-39 19.475 29.635 27.650000000000002 23.24 40-44 19.31 30.64 27.200000000000003 22.85 45-49 19.575 29.865000000000002 27.685 22.875 50-54 19.64438193781707 29.82570696669848 27.319302827866792 23.210608267617662 55-59 19.45646088859484 29.22795053183368 27.482314621609245 23.833273957962238 60-64 20.13368849575313 29.808513846308486 27.029200381967133 23.02859727597125 65-69 19.591652904969223 29.334934694490318 27.5434119001151 23.53000050042536 70-74 19.869999999999997 29.42 27.805000000000003 22.905 75-79 19.915 29.635 27.500000000000004 22.95 80-84 20.255000000000003 29.715000000000003 26.685 23.345 85-89 20.16 29.330000000000002 26.905 23.605 90-94 20.39 29.315 27.495000000000005 22.8 95-99 20.39 29.24 27.229999999999997 23.14 100-104 20.325162581290645 29.034517258629318 27.63881940970485 23.001500750375186 105-109 20.142656218605588 28.877838055053246 28.044002411091018 22.93550331525015 110-114 20.956526089349143 28.830856971334235 26.739706838761318 23.472910100555307 115-119 21.04920658757571 29.068428692996946 26.925964859588525 22.956399859838815 120-124 20.479095819163835 29.23084616923385 26.855371074214844 23.43468693738748 125-129 20.24 28.98 27.155 23.625 130-134 20.73 28.1 27.084999999999997 24.085 135-139 20.94 29.075 26.66 23.325000000000003 140-144 20.94 28.53 26.415 24.115000000000002 145-149 21.075 28.76 25.97 24.195 150-151 20.330082520630157 29.144786196549138 25.581395348837212 24.943735933983497 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 1.5 23 3.0 24 6.5 25 9.0 26 10.5 27 13.0 28 17.5 29 29.5 30 33.0 31 35.5 32 49.5 33 63.0 34 83.5 35 104.0 36 122.0 37 129.5 38 150.0 39 190.5 40 216.0 41 222.5 42 224.0 43 240.5 44 247.5 45 249.0 46 246.0 47 225.5 48 204.5 49 184.5 50 157.5 51 136.0 52 110.5 53 76.5 54 52.5 55 39.5 56 34.5 57 21.0 58 9.5 59 9.5 60 10.5 61 6.0 62 3.5 63 3.5 64 2.0 65 3.5 66 3.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.455 55-59 1.755 60-64 0.515 65-69 0.08499999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.45999999999999996 110-114 0.055 115-119 0.11499999999999999 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.7875 0.0 0.0 0.0 0.0 116-117 4.262499999999999 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.3625 0.0 0.0 0.0 0.0 122-123 5.8 0.0 0.0 0.0 0.0 124-125 6.262499999999999 0.0 0.0 0.0 0.0 126-127 6.8375 0.0 0.0 0.0 0.0 128-129 7.6 0.0 0.0 0.0 0.0 130-131 8.3125 0.0 0.0 0.0 0.0 132-133 8.825 0.0 0.0 0.0 0.0 134-135 9.4875 0.0 0.0 0.0 0.0 136-137 10.2625 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAAT 10 0.0063824113 148.28204 1 CTTCACT 10 0.0068910434 144.575 6 ACCACCC 10 0.0068910434 144.575 5 >>END_MODULE SRR7166174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.146 33.0 33.0 34.0 33.0 34.0 2 33.2045 34.0 33.0 34.0 33.0 34.0 3 33.20625 34.0 33.0 34.0 33.0 34.0 4 33.20275 34.0 33.0 34.0 33.0 34.0 5 33.16725 34.0 33.0 34.0 33.0 34.0 6 37.37575 38.0 38.0 38.0 37.0 38.0 7 37.395 38.0 38.0 38.0 38.0 38.0 8 37.387 38.0 38.0 38.0 37.0 38.0 9 37.34 38.0 38.0 38.0 37.0 38.0 10-14 37.32425 38.0 38.0 38.0 37.4 38.0 15-19 37.317249999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.339099999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.2626 38.0 38.0 38.0 37.0 38.0 30-34 37.22765 38.0 38.0 38.0 37.0 38.0 35-39 37.16295 38.0 38.0 38.0 37.0 38.0 40-44 37.0934 38.0 38.0 38.0 37.0 38.0 45-49 37.01985 38.0 38.0 38.0 36.6 38.0 50-54 36.94355 38.0 38.0 38.0 36.0 38.0 55-59 36.9116 38.0 38.0 38.0 36.0 38.0 60-64 36.9512 38.0 38.0 38.0 36.0 38.0 65-69 36.86935 38.0 38.0 38.0 36.0 38.0 70-74 36.79385 38.0 38.0 38.0 35.8 38.0 75-79 36.71625 38.0 38.0 38.0 35.4 38.0 80-84 36.6177 38.0 38.0 38.0 34.8 38.0 85-89 36.505900000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.42685 38.0 38.0 38.0 34.2 38.0 95-99 36.2305 38.0 38.0 38.0 34.2 38.0 100-104 36.1309 38.0 38.0 38.0 33.8 38.0 105-109 35.94115 38.0 37.8 38.0 33.0 38.0 110-114 35.747 38.0 37.0 38.0 31.4 38.0 115-119 35.4731 38.0 37.0 38.0 30.2 38.0 120-124 35.317400000000006 38.0 36.4 38.0 29.6 38.0 125-129 35.0935 38.0 36.0 38.0 28.8 38.0 130-134 34.66875 38.0 35.6 38.0 27.0 38.0 135-139 34.4671 38.0 35.0 38.0 26.0 38.0 140-144 33.91445 38.0 35.0 38.0 23.0 38.0 145-149 33.111000000000004 38.0 34.2 38.0 16.6 38.0 150-151 29.031374999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 3.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 5.0 12 3.0 13 3.0 14 4.0 15 1.0 16 2.0 17 2.0 18 4.0 19 3.0 20 10.0 21 8.0 22 10.0 23 11.0 24 9.0 25 18.0 26 14.0 27 15.0 28 30.0 29 36.0 30 44.0 31 49.0 32 65.0 33 94.0 34 158.0 35 266.0 36 635.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.55 17.474999999999998 14.075 25.900000000000002 2 23.425 23.525 35.3 17.75 3 21.0 27.025 32.175 19.8 4 23.0 36.5 21.85 18.65 5 22.95 38.75 21.0 17.299999999999997 6 18.33416708354177 37.543771885942974 24.58729364682341 19.534767383691847 7 18.18409204602301 15.857928964482241 44.022011005502755 21.935967983991997 8 20.96048024012006 23.13656828414207 27.01350675337669 28.88944472236118 9 21.885942971485743 24.73736868434217 28.23911955977989 25.137568784392194 10-14 23.081540770385192 28.289144572286144 27.088544272136065 21.540770385192594 15-19 23.066533266633314 27.55377688844422 27.75887943971986 21.6208104052026 20-24 22.96648324162081 28.61930965482741 28.204102051025515 20.210105052526263 25-29 23.1850702956922 27.803071996797918 27.873117526392154 21.138740181117726 30-34 23.39786882785532 28.40562309270099 27.69022962629446 20.506278453149232 35-39 23.03266796738206 27.6652158687278 28.175496523087702 21.126619640802442 40-44 23.301650825412707 27.61880940470235 28.274137068534266 20.805402701350676 45-49 23.50027517886626 27.813078501025668 28.45349477160154 20.233151548506527 50-54 23.393714971977584 27.702161729383505 28.212570056044832 20.691553242594075 55-59 23.280132085855808 27.617951668584578 28.343423225096316 20.758493020463302 60-64 23.41670835417709 27.598799399699853 28.779389694847424 20.20510255127564 65-69 23.761880940470235 27.63381690845423 27.973986993496748 20.630315157578792 70-74 23.27827827827828 27.47247247247247 28.97897897897898 20.27027027027027 75-79 23.343343343343342 27.58258258258258 28.913913913913913 20.16016016016016 80-84 23.830255717359755 27.9737777110544 28.39413501476255 19.8018315568233 85-89 23.24627239067347 28.179725808065648 28.680076053237265 19.893925748023616 90-94 23.671570099069346 27.75442809966977 28.610027018913236 19.963974782347645 95-99 23.690136616123706 27.938747935745383 28.33408397137567 20.037031476755242 100-104 23.68895116092874 27.426941553242596 28.31765412329864 20.566453162530024 105-109 23.90434260556334 27.751650990594356 28.40204122473484 19.941965179107466 110-114 23.909127301841473 27.867293835068054 28.132506004803844 20.09107285828663 115-119 24.320536563391563 28.41483557735622 27.8292206817158 19.435407177536412 120-124 23.980179188147556 28.219630612142748 28.219630612142748 19.580559587566945 125-129 24.693458785846552 27.816425604324106 28.086682348230816 19.40343326159852 130-134 24.789873924354612 27.70162097258355 27.806684010406247 19.701821092655596 135-139 25.230138082849713 28.447068240944567 27.156293776265763 19.166499899939964 140-144 25.467733866933468 27.63881940970485 27.75887943971986 19.13456728364182 145-149 25.047523761880942 28.44922461230615 27.378689344672335 19.12456228114057 150-151 25.78144536134033 27.26931732933233 27.494373593398347 19.454863715928983 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 2.5 26 2.5 27 6.5 28 10.0 29 12.5 30 17.5 31 24.5 32 32.0 33 40.0 34 46.0 35 60.0 36 81.0 37 102.0 38 130.5 39 165.5 40 190.5 41 205.5 42 242.5 43 276.5 44 280.0 45 295.0 46 294.5 47 266.5 48 239.5 49 205.5 50 171.0 51 141.0 52 123.5 53 99.0 54 67.0 55 46.5 56 32.5 57 24.5 58 15.5 59 8.0 60 8.5 61 6.0 62 4.0 63 3.0 64 1.5 65 0.5 66 0.5 67 1.5 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.05 25-29 0.065 30-34 0.055 35-39 0.055 40-44 0.05 45-49 0.065 50-54 0.08 55-59 0.065 60-64 0.05 65-69 0.05 70-74 0.1 75-79 0.1 80-84 0.08499999999999999 85-89 0.06999999999999999 90-94 0.06999999999999999 95-99 0.08499999999999999 100-104 0.08 105-109 0.06 110-114 0.08 115-119 0.105 120-124 0.105 125-129 0.095 130-134 0.06 135-139 0.06 140-144 0.05 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54694185753839 98.875 2 0.37754845205134663 0.75 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.05033979360684621 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.9500000000000002 0.0 0.0 0.0 0.0 108-109 2.4625000000000004 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.1 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.175 0.0 0.0 0.0 0.0 118-119 4.637499999999999 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.737500000000001 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.7125 0.0 0.0 0.0 0.0 134-135 9.3875 0.0 0.0 0.0 0.0 136-137 10.1625 0.0 0.0 0.0 0.0 138-139 10.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGATA 10 0.006830828 145.0 2 GTCAATT 10 0.006830828 145.0 1 >>END_MODULE Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806763 spots for SRR7166174.sra Written 806763 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra Read 806749 spots for SRR7166174.sra Written 806749 spots for SRR7166174.sra SRR ids: ['SRR7166174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cf9w2r4l SRR7166174.sra spots: 16134994 blocks: [[1, 806749], [806750, 1613498], [1613499, 2420247], [2420248, 3226996], [3226997, 4033745], [4033746, 4840494], [4840495, 5647243], [5647244, 6453992], [6453993, 7260741], [7260742, 8067490], [8067491, 8874239], [8874240, 9680988], [9680989, 10487737], [10487738, 11294486], [11294487, 12101235], [12101236, 12907984], [12907985, 13714733], [13714734, 14521482], [14521483, 15328231], [15328232, 16134994]] SRR7166174 file size 5445919 SRR7166174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166174 SRR7166174_1.fastq SRR7166174_2.fastq Input file: SRR7166174_1.fastq Paired file: SRR7166174_2.fastq trimmed: SRR7166174-trimmed-pair1.fastq, SRR7166174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:07:19 2025 >> started Fri Feb 14 20:07:40 2025 >> done (20.964s) 16134994 read pairs processed; of these: 17765 ( 0.11%) short read pairs filtered out after trimming by size control 14458 ( 0.09%) empty read pairs filtered out after trimming by size control 16102771 (99.80%) read pairs available; of these: 7495796 (46.55%) trimmed read pairs available after processing 8606975 (53.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 10 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 11 0.00% 25 11 0.00% 26 7 0.00% 27 7 0.00% 28 5 0.00% 29 9 0.00% 30 12 0.00% 31 8 0.00% 32 15 0.00% 33 14 0.00% 34 6 0.00% 35 9 0.00% 36 8 0.00% 37 12 0.00% 38 12 0.00% 39 20 0.00% 40 17 0.00% 41 22 0.00% 42 22 0.00% 43 29 0.00% 44 34 0.00% 45 46 0.00% 46 32 0.00% 47 46 0.00% 48 38 0.00% 49 56 0.00% 50 66 0.00% 51 76 0.00% 52 91 0.00% 53 114 0.00% 54 96 0.00% 55 119 0.00% 56 121 0.00% 57 154 0.00% 58 202 0.00% 59 220 0.00% 60 235 0.00% 61 321 0.00% 62 358 0.00% 63 410 0.00% 64 467 0.00% 65 453 0.00% 66 552 0.00% 67 633 0.00% 68 732 0.00% 69 849 0.01% 70 981 0.01% 71 1143 0.01% 72 1373 0.01% 73 1658 0.01% 74 1699 0.01% 75 1825 0.01% 76 2303 0.01% 77 2241 0.01% 78 2563 0.02% 79 2869 0.02% 80 3363 0.02% 81 3958 0.02% 82 4622 0.03% 83 5393 0.03% 84 7070 0.04% 85 7308 0.05% 86 7734 0.05% 87 8353 0.05% 88 9034 0.06% 89 9327 0.06% 90 10093 0.06% 91 11616 0.07% 92 12605 0.08% 93 13769 0.09% 94 14911 0.09% 95 15611 0.10% 96 16484 0.10% 97 17125 0.11% 98 17850 0.11% 99 19282 0.12% 100 19728 0.12% 101 21723 0.13% 102 23141 0.14% 103 24852 0.15% 104 26274 0.16% 105 27884 0.17% 106 28371 0.18% 107 28917 0.18% 108 30030 0.19% 109 31071 0.19% 110 32354 0.20% 111 33929 0.21% 112 36394 0.23% 113 38443 0.24% 114 40357 0.25% 115 42793 0.27% 116 43506 0.27% 117 44798 0.28% 118 45678 0.28% 119 46114 0.29% 120 47342 0.29% 121 49128 0.31% 122 51410 0.32% 123 53879 0.33% 124 57094 0.35% 125 58758 0.36% 126 60770 0.38% 127 61332 0.38% 128 61953 0.38% 129 63834 0.40% 130 64786 0.40% 131 66462 0.41% 132 69158 0.43% 133 72750 0.45% 134 76874 0.48% 135 80480 0.50% 136 83317 0.52% 137 86720 0.54% 138 89956 0.56% 139 92728 0.58% 140 97028 0.60% 141 103789 0.64% 142 112095 0.70% 143 121156 0.75% 144 136480 0.85% 145 158059 0.98% 146 189740 1.18% 147 240101 1.49% 148 347054 2.16% 149 641737 3.99% 150 3092486 19.20% 151 8606975 53.45% 16102771 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=27 prefix-density=1.09 prefix-fanout=2.2 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=27.38 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.1 sequence=CACACACAAGAACCATAATCCAGAGTAATAGCATATAAACCAAGACATTATCTTGGACAACATGAACAGCACATCTTAAAAACCACCACGGAGACGAAGGACAAGGTGAAG criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=1.25 prefix-fanout=2.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=45.94 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166174 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:09:14 Started mapping on | Feb 14 20:09:14 Finished on | Feb 14 20:11:10 Mapping speed, Million of reads per hour | 499.74 Number of input reads | 16102771 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15301707 Uniquely mapped reads % | 95.03% Average mapped length | 291.12 Number of splices: Total | 13309552 Number of splices: Annotated (sjdb) | 13058503 Number of splices: GT/AG | 13099194 Number of splices: GC/AG | 164771 Number of splices: AT/AC | 9557 Number of splices: Non-canonical | 36030 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417354 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 38011 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.09% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400467 400467 400467 N_multimapping 417354 417354 417354 N_noFeature 464863 15090225 568093 N_ambiguous 183676 1060 74857 UnstrandedReadsAssigned:14653168 PositiveStrandReadsAssigned:210422 NegativeStrandReadsAssigned:14658757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7166174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166174-trimmed-pair1.fastq SRR7166174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,102,771 reads, 14,516,022 reads pseudoaligned [quant] estimated average fragment length: 224.442 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7166174.ke.tsv 34699 SRR7166174.se.tsv 87100 total ==> SRR7166174.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.56 1063 34.3232 Potri.005G024800.1.v4.1 1035 811.558 303 21.6339 Potri.004G059700.1.v4.1 961 737.59 21 1.64974 Potri.007G009000.2.v4.1 1416 1192.56 0 0 Potri.003G141000.2.v4.1 2943 2719.56 659 14.041 Potri.016G087400.1.v4.1 270 90.6214 877 560.764 Potri.015G069301.1.v4.1 564 345.165 0 0 Potri.010G195200.1.v4.1 1773 1549.56 273 10.2086 Potri.012G127500.1.v4.1 977 753.58 1363 104.804 ==> SRR7166174.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1014 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 380 SRR7166174 completed mapping pipeline successfully