Starting /dee2/code/volunteer_pipeline.sh SRR7166175 current disk space = 3108909862912 free memory = 1573359696 SRR7166175 SRAfilesize 83416f62585325fdb318a8931832f3e0 SRR7166175.sra SRR7166175.sra file validated SRR7166175 is paired end SRR7166175 is conventional basespace SRR7166175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.4245 33.0 30.0 33.0 18.0 34.0 2 31.95925 33.0 31.0 33.0 28.0 34.0 3 31.63875 33.0 31.0 33.0 29.0 34.0 4 31.8785 33.0 32.0 33.0 31.0 33.0 5 32.227 33.0 32.0 33.0 31.0 33.0 6 36.79375 38.0 37.0 38.0 35.0 38.0 7 37.17475 38.0 38.0 38.0 36.0 38.0 8 37.473 38.0 38.0 38.0 37.0 38.0 9 37.61725 38.0 38.0 38.0 38.0 38.0 10-14 37.61995 38.0 38.0 38.0 38.0 38.0 15-19 37.6086 38.0 38.0 38.0 38.0 38.0 20-24 37.61225 38.0 38.0 38.0 38.0 38.0 25-29 37.58515 38.0 38.0 38.0 38.0 38.0 30-34 37.556650000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.5252 38.0 38.0 38.0 38.0 38.0 40-44 37.520950000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.49235 38.0 38.0 38.0 37.8 38.0 50-54 37.4754 38.0 38.0 38.0 37.4 38.0 55-59 37.06485 38.0 38.0 38.0 36.8 38.0 60-64 37.22005 38.0 38.0 38.0 37.0 38.0 65-69 37.29385 38.0 38.0 38.0 37.0 38.0 70-74 37.22240000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.1503 38.0 38.0 38.0 36.2 38.0 80-84 37.142849999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.992900000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.8374 38.0 38.0 38.0 35.4 38.0 95-99 36.8635 38.0 38.0 38.0 35.4 38.0 100-104 36.703799999999994 38.0 38.0 38.0 34.6 38.0 105-109 36.56485 38.0 38.0 38.0 34.4 38.0 110-114 36.5542 38.0 38.0 38.0 34.2 38.0 115-119 36.29515 38.0 37.8 38.0 33.8 38.0 120-124 36.1689 38.0 37.6 38.0 33.6 38.0 125-129 36.039300000000004 38.0 37.2 38.0 33.2 38.0 130-134 35.860749999999996 38.0 36.8 38.0 33.0 38.0 135-139 35.6782 38.0 36.2 38.0 31.4 38.0 140-144 35.29235 38.0 36.0 38.0 30.6 38.0 145-149 34.98405 38.0 36.0 38.0 30.4 38.0 150-151 31.819000000000003 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 4.0 20 2.0 21 3.0 22 3.0 23 3.0 24 15.0 25 4.0 26 12.0 27 13.0 28 21.0 29 29.0 30 28.0 31 35.0 32 58.0 33 73.0 34 128.0 35 232.0 36 564.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.562419562419564 18.352638352638355 11.737451737451737 30.347490347490346 2 21.375 24.2 38.224999999999994 16.2 3 16.625 32.125 28.425 22.825 4 21.2 36.175000000000004 23.599999999999998 19.025 5 19.59949937421777 38.1476846057572 24.155193992490613 18.097622027534417 6 16.6 36.925000000000004 24.175 22.3 7 12.9 20.674999999999997 44.275 22.15 8 17.0 21.85 27.200000000000003 33.95 9 17.05 23.45 29.7 29.799999999999997 10-14 19.465 30.395 26.985 23.155 15-19 19.495 29.465000000000003 27.634999999999998 23.405 20-24 19.985 29.735 27.62 22.66 25-29 19.855 29.549999999999997 27.589999999999996 23.005 30-34 19.37 29.765000000000004 27.93 22.935 35-39 19.855 29.335 27.37 23.44 40-44 20.18 29.67 27.22 22.93 45-49 19.645000000000003 29.975 27.560000000000002 22.82 50-54 20.064999999999998 28.939999999999998 27.634999999999998 23.36 55-59 19.860908128811168 28.942196240487828 27.516000604747266 23.68089502595374 60-64 20.054051348781343 29.062609479005054 28.001601521445373 22.88173765076823 65-69 19.869999999999997 29.075 27.650000000000002 23.405 70-74 20.119999999999997 29.409999999999997 27.91 22.56 75-79 20.044999999999998 29.044999999999998 27.900000000000002 23.01 80-84 20.64 28.925 27.189999999999998 23.244999999999997 85-89 20.23 28.52 27.405 23.845 90-94 20.64 28.575 27.96 22.825 95-99 20.04 29.28 27.195000000000004 23.485 100-104 20.449426955607827 29.017566688353934 27.571192633001353 22.961813723036887 105-109 20.340510766149226 29.40911367050576 26.98047070605909 23.26990485728593 110-114 20.51 28.89 27.91 22.689999999999998 115-119 21.295 28.59 27.515 22.6 120-124 21.560000000000002 29.03 26.86 22.55 125-129 21.11 28.68 27.150000000000002 23.06 130-134 21.215 29.080000000000002 26.935 22.770000000000003 135-139 20.815 28.595 26.985 23.605 140-144 21.044999999999998 29.275000000000002 26.669999999999998 23.01 145-149 21.085 29.56 26.305 23.05 150-151 21.351554663991976 28.32246740220662 26.74272818455366 23.58324974924774 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 3.5 25 4.0 26 5.0 27 11.0 28 15.0 29 15.5 30 27.5 31 40.0 32 49.5 33 61.0 34 72.0 35 87.0 36 107.0 37 133.0 38 162.5 39 202.5 40 219.0 41 216.0 42 227.5 43 245.5 44 272.5 45 279.5 46 260.5 47 230.0 48 208.5 49 184.5 50 142.5 51 113.5 52 99.5 53 80.0 54 47.5 55 33.0 56 34.5 57 28.5 58 17.0 59 12.5 60 10.5 61 8.5 62 7.0 63 4.5 64 3.5 65 4.0 66 2.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.7849999999999999 60-64 0.095 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.095 105-109 0.15 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.8375 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.987500000000001 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTA 10 0.006894607 144.55 2 TTCCTCG 10 0.006894607 144.55 8 GAATTCC 10 0.006894607 144.55 3 >>END_MODULE SRR7166175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.957 33.0 33.0 34.0 32.0 34.0 2 33.0635 33.0 33.0 34.0 32.0 34.0 3 33.0735 34.0 33.0 34.0 33.0 34.0 4 33.1305 34.0 33.0 34.0 33.0 34.0 5 33.1045 34.0 33.0 34.0 33.0 34.0 6 37.3015 38.0 38.0 38.0 37.0 38.0 7 37.405 38.0 38.0 38.0 37.0 38.0 8 37.333 38.0 38.0 38.0 37.0 38.0 9 37.31025 38.0 38.0 38.0 37.0 38.0 10-14 37.3355 38.0 38.0 38.0 37.0 38.0 15-19 37.2919 38.0 38.0 38.0 37.0 38.0 20-24 37.24445 38.0 38.0 38.0 37.0 38.0 25-29 37.1714 38.0 38.0 38.0 36.6 38.0 30-34 37.183800000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.1276 38.0 38.0 38.0 36.0 38.0 40-44 37.044850000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.99905 38.0 38.0 38.0 36.0 38.0 50-54 36.82065 38.0 38.0 38.0 35.0 38.0 55-59 36.796800000000005 38.0 38.0 38.0 35.0 38.0 60-64 36.731049999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.719350000000006 38.0 38.0 38.0 35.0 38.0 70-74 36.596199999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.4752 38.0 38.0 38.0 34.0 38.0 80-84 36.36155 38.0 37.6 38.0 33.8 38.0 85-89 36.14085 38.0 37.2 38.0 33.6 38.0 90-94 35.93429999999999 38.0 37.0 38.0 32.6 38.0 95-99 35.75840000000001 38.0 37.0 38.0 31.8 38.0 100-104 35.6161 38.0 37.0 38.0 30.6 38.0 105-109 35.441199999999995 38.0 36.6 38.0 29.4 38.0 110-114 35.1553 38.0 36.2 38.0 28.8 38.0 115-119 34.90984999999999 38.0 35.4 38.0 27.6 38.0 120-124 34.49345 38.0 35.0 38.0 26.4 38.0 125-129 34.1321 38.0 35.0 38.0 23.0 38.0 130-134 33.59755 38.0 34.0 38.0 20.6 38.0 135-139 33.095349999999996 38.0 34.0 38.0 15.0 38.0 140-144 32.3238 37.4 33.2 38.0 14.0 38.0 145-149 31.1822 36.8 31.0 38.0 8.6 38.0 150-151 26.358125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 7.0 16 6.0 17 9.0 18 7.0 19 4.0 20 12.0 21 16.0 22 14.0 23 18.0 24 18.0 25 9.0 26 28.0 27 23.0 28 28.0 29 43.0 30 51.0 31 67.0 32 99.0 33 140.0 34 220.0 35 420.0 36 965.0 37 1787.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 16.950000000000003 13.775 29.95 2 23.575 23.45 35.25 17.724999999999998 3 19.725 26.375 31.95 21.95 4 23.125 35.949999999999996 22.375 18.55 5 23.425 38.15 21.65 16.775000000000002 6 17.474999999999998 39.1 24.15 19.275000000000002 7 17.825 16.3 45.95 19.925 8 19.85 20.925 27.575 31.65 9 22.475 22.650000000000002 29.099999999999998 25.775 10-14 22.675 28.68 26.96 21.685 15-19 23.1 27.57 28.925 20.405 20-24 22.8 28.134999999999998 28.194999999999997 20.87 25-29 22.28 28.54 28.449999999999996 20.73 30-34 23.015 27.76 28.78 20.445 35-39 22.720000000000002 28.044999999999998 28.21 21.025 40-44 23.294999999999998 27.72 28.384999999999998 20.599999999999998 45-49 22.725 27.505000000000003 28.835 20.935000000000002 50-54 22.525000000000002 28.475 28.799999999999997 20.200000000000003 55-59 23.235 27.975 28.67 20.119999999999997 60-64 23.49 28.335 28.305000000000003 19.869999999999997 65-69 23.244999999999997 28.24 28.33 20.185 70-74 23.400000000000002 28.28 27.965 20.355 75-79 23.494999999999997 27.58 28.53 20.395 80-84 22.665 27.634999999999998 29.235 20.465 85-89 22.805 28.51 28.62 20.064999999999998 90-94 23.36 28.07 27.73 20.84 95-99 23.78 28.095 28.075 20.05 100-104 23.849999999999998 27.54 28.575 20.035 105-109 23.61 28.175 28.59 19.625 110-114 23.225 28.115000000000002 28.78 19.88 115-119 23.48 28.165000000000003 28.205000000000002 20.150000000000002 120-124 23.625 27.92 28.1 20.355 125-129 23.56 28.125 28.505000000000003 19.81 130-134 24.325 27.83 28.439999999999998 19.405 135-139 25.14 27.755000000000003 27.755000000000003 19.35 140-144 24.19 27.744999999999997 27.944999999999997 20.119999999999997 145-149 25.3 27.794999999999998 27.975 18.93 150-151 26.270337922403 27.058823529411764 28.235294117647058 18.435544430538172 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 3.0 25 4.0 26 4.5 27 6.5 28 8.5 29 8.0 30 16.5 31 30.0 32 32.5 33 40.0 34 52.0 35 71.0 36 100.5 37 121.5 38 157.5 39 183.0 40 189.0 41 214.5 42 264.0 43 295.5 44 307.0 45 298.0 46 261.5 47 226.5 48 203.5 49 180.0 50 154.5 51 132.0 52 104.0 53 79.5 54 53.5 55 41.5 56 38.0 57 31.0 58 24.5 59 16.0 60 8.0 61 7.0 62 8.0 63 6.5 64 3.0 65 3.0 66 3.0 67 2.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.3 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.55 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCC 10 0.006832588 144.9875 3 >>END_MODULE Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra Read 849125 spots for SRR7166175.sra Written 849125 spots for SRR7166175.sra Read 849121 spots for SRR7166175.sra Written 849121 spots for SRR7166175.sra SRR ids: ['SRR7166175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q4d66_oj SRR7166175.sra spots: 16982424 blocks: [[1, 849121], [849122, 1698242], [1698243, 2547363], [2547364, 3396484], [3396485, 4245605], [4245606, 5094726], [5094727, 5943847], [5943848, 6792968], [6792969, 7642089], [7642090, 8491210], [8491211, 9340331], [9340332, 10189452], [10189453, 11038573], [11038574, 11887694], [11887695, 12736815], [12736816, 13585936], [13585937, 14435057], [14435058, 15284178], [15284179, 16133299], [16133300, 16982424]] SRR7166175 file size 5733085 SRR7166175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166175 SRR7166175_1.fastq SRR7166175_2.fastq Input file: SRR7166175_1.fastq Paired file: SRR7166175_2.fastq trimmed: SRR7166175-trimmed-pair1.fastq, SRR7166175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:30:26 2025 >> started Fri Feb 14 21:30:44 2025 >> done (17.427s) 16982424 read pairs processed; of these: 7166 ( 0.04%) short read pairs filtered out after trimming by size control 6355 ( 0.04%) empty read pairs filtered out after trimming by size control 16968903 (99.92%) read pairs available; of these: 8359122 (49.26%) trimmed read pairs available after processing 8609781 (50.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 9 0.00% 24 7 0.00% 25 7 0.00% 26 2 0.00% 27 1 0.00% 28 5 0.00% 29 8 0.00% 30 4 0.00% 31 5 0.00% 32 1 0.00% 33 5 0.00% 34 9 0.00% 35 2 0.00% 36 8 0.00% 37 12 0.00% 38 15 0.00% 39 11 0.00% 40 13 0.00% 41 15 0.00% 42 16 0.00% 43 28 0.00% 44 9 0.00% 45 14 0.00% 46 22 0.00% 47 34 0.00% 48 23 0.00% 49 47 0.00% 50 44 0.00% 51 58 0.00% 52 70 0.00% 53 64 0.00% 54 59 0.00% 55 63 0.00% 56 90 0.00% 57 114 0.00% 58 108 0.00% 59 134 0.00% 60 191 0.00% 61 194 0.00% 62 216 0.00% 63 264 0.00% 64 276 0.00% 65 341 0.00% 66 331 0.00% 67 415 0.00% 68 463 0.00% 69 602 0.00% 70 633 0.00% 71 743 0.00% 72 893 0.01% 73 1074 0.01% 74 1186 0.01% 75 1279 0.01% 76 1412 0.01% 77 1632 0.01% 78 1712 0.01% 79 1989 0.01% 80 2311 0.01% 81 2683 0.02% 82 3142 0.02% 83 3568 0.02% 84 4394 0.03% 85 4861 0.03% 86 5314 0.03% 87 5697 0.03% 88 6206 0.04% 89 6660 0.04% 90 7443 0.04% 91 8186 0.05% 92 9072 0.05% 93 9967 0.06% 94 10788 0.06% 95 11584 0.07% 96 12226 0.07% 97 12670 0.07% 98 13881 0.08% 99 14897 0.09% 100 14912 0.09% 101 16487 0.10% 102 17901 0.11% 103 19400 0.11% 104 20816 0.12% 105 21797 0.13% 106 22588 0.13% 107 23407 0.14% 108 24267 0.14% 109 24841 0.15% 110 26158 0.15% 111 27715 0.16% 112 29896 0.18% 113 31855 0.19% 114 33662 0.20% 115 35937 0.21% 116 36548 0.22% 117 37810 0.22% 118 38892 0.23% 119 39500 0.23% 120 40313 0.24% 121 42312 0.25% 122 44709 0.26% 123 47480 0.28% 124 50552 0.30% 125 52260 0.31% 126 54528 0.32% 127 55837 0.33% 128 57134 0.34% 129 58940 0.35% 130 60625 0.36% 131 62917 0.37% 132 66889 0.39% 133 70988 0.42% 134 75546 0.45% 135 79648 0.47% 136 83887 0.49% 137 87371 0.51% 138 91837 0.54% 139 96751 0.57% 140 103641 0.61% 141 112403 0.66% 142 123951 0.73% 143 137107 0.81% 144 158031 0.93% 145 186771 1.10% 146 227770 1.34% 147 301003 1.77% 148 441259 2.60% 149 828725 4.88% 150 3740995 22.05% 151 8609781 50.74% 16968903 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=21 prefix-density=0.74 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=23.05 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=8.7 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=15 prefix-density=0.71 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=64.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.8 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166175 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:32:29 Started mapping on | Feb 14 21:32:31 Finished on | Feb 14 21:35:21 Mapping speed, Million of reads per hour | 359.34 Number of input reads | 16968903 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14197530 Uniquely mapped reads % | 83.67% Average mapped length | 289.62 Number of splices: Total | 13437648 Number of splices: Annotated (sjdb) | 13163181 Number of splices: GT/AG | 13219855 Number of splices: GC/AG | 167419 Number of splices: AT/AC | 10026 Number of splices: Non-canonical | 40348 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.28 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357439 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 92651 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.54% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2420022 2420022 2420022 N_multimapping 357439 357439 357439 N_noFeature 493173 14031297 578841 N_ambiguous 217842 2210 135599 UnstrandedReadsAssigned:13486515 PositiveStrandReadsAssigned:164023 NegativeStrandReadsAssigned:13483090 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR7166175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166175-trimmed-pair1.fastq SRR7166175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,968,903 reads, 14,693,155 reads pseudoaligned [quant] estimated average fragment length: 225.785 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7166175.ke.tsv 34699 SRR7166175.se.tsv 87100 total ==> SRR7166175.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.21 1805 65.5698 Potri.005G024800.1.v4.1 1035 810.215 492 39.557 Potri.004G059700.1.v4.1 961 736.234 13 1.15023 Potri.007G009000.2.v4.1 1416 1191.21 0 0 Potri.003G141000.2.v4.1 2943 2718.21 819.257 19.6334 Potri.016G087400.1.v4.1 270 88.5541 966.459 710.941 Potri.015G069301.1.v4.1 564 342.75 0 0 Potri.010G195200.1.v4.1 1773 1548.21 336 14.1373 Potri.012G127500.1.v4.1 977 752.234 5627 487.285 ==> SRR7166175.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 635 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 392 SRR7166175 completed mapping pipeline successfully