Starting /dee2/code/volunteer_pipeline.sh SRR7166176 current disk space = 3109053009920 free memory = 1576335152 SRR7166176 SRAfilesize 581e89f07d870120ef01f92ba3e6a607 SRR7166176.sra SRR7166176.sra file validated SRR7166176 is paired end SRR7166176 is conventional basespace SRR7166176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.043 33.0 32.0 34.0 31.0 34.0 2 32.0995 33.0 33.0 34.0 29.0 34.0 3 32.37875 33.0 33.0 34.0 29.0 34.0 4 32.19225 33.0 33.0 34.0 29.0 34.0 5 32.3115 33.0 33.0 34.0 31.0 34.0 6 36.56275 38.0 37.0 38.0 34.0 38.0 7 36.8475 38.0 38.0 38.0 35.0 38.0 8 37.05475 38.0 38.0 38.0 36.0 38.0 9 36.738 38.0 38.0 38.0 34.0 38.0 10-14 37.115750000000006 38.0 38.0 38.0 35.8 38.0 15-19 37.12179999999999 38.0 38.0 38.0 36.0 38.0 20-24 37.071600000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.83665 38.0 38.0 38.0 35.0 38.0 30-34 36.3275 38.0 37.4 38.0 33.2 38.0 35-39 36.3284 38.0 37.2 38.0 33.4 38.0 40-44 36.199 38.0 37.0 38.0 32.8 38.0 45-49 36.03304999999999 38.0 37.0 38.0 31.8 38.0 50-54 35.776599999999995 38.0 36.6 38.0 30.2 38.0 55-59 35.6411 38.0 36.0 38.0 29.6 38.0 60-64 35.463499999999996 38.0 36.0 38.0 29.0 38.0 65-69 35.58825 38.0 36.0 38.0 29.4 38.0 70-74 35.4186 38.0 36.2 38.0 29.8 38.0 75-79 35.02545 38.0 36.0 38.0 28.6 38.0 80-84 34.76495 38.0 35.6 38.0 27.4 38.0 85-89 34.39065000000001 38.0 34.4 38.0 25.2 38.0 90-94 34.690200000000004 38.0 35.0 38.0 26.2 38.0 95-99 34.3957 38.0 34.4 38.0 24.8 38.0 100-104 33.92785 38.0 34.0 38.0 23.2 38.0 105-109 33.31340000000001 37.4 32.8 38.0 16.6 38.0 110-114 32.63785 37.0 31.0 38.0 15.0 38.0 115-119 32.2729 37.0 30.6 38.0 15.0 38.0 120-124 31.583299999999998 36.2 29.2 38.0 15.0 38.0 125-129 30.57375 35.2 27.0 38.0 14.2 38.0 130-134 29.305349999999997 34.2 23.4 38.0 13.0 38.0 135-139 28.173750000000002 33.0 21.2 38.0 8.2 38.0 140-144 26.5627 33.0 14.0 38.0 2.0 38.0 145-149 24.470699999999997 32.2 8.2 38.0 2.0 38.0 150-151 18.380375 16.5 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 0.0 13 3.0 14 0.0 15 3.0 16 3.0 17 2.0 18 3.0 19 17.0 20 12.0 21 22.0 22 22.0 23 39.0 24 51.0 25 56.0 26 62.0 27 90.0 28 120.0 29 122.0 30 158.0 31 189.0 32 235.0 33 354.0 34 494.0 35 586.0 36 828.0 37 526.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3904282115869 19.798488664987403 10.906801007556675 33.904282115869016 2 19.575 27.200000000000003 36.425000000000004 16.8 3 16.975 33.6 26.025 23.400000000000002 4 19.85 37.025000000000006 22.425 20.7 5 20.474999999999998 38.425 23.1 18.0 6 16.7 38.025 24.55 20.724999999999998 7 12.825000000000001 20.424999999999997 46.575 20.175 8 17.724999999999998 22.45 28.349999999999998 31.474999999999998 9 18.975 21.5 31.175000000000004 28.349999999999998 10-14 19.45 30.819999999999997 26.8 22.93 15-19 19.955000000000002 29.225 27.689999999999998 23.13 20-24 19.705000000000002 29.959999999999997 27.61 22.725 25-29 19.939999999999998 29.959999999999997 27.52 22.58 30-34 19.535 30.055 27.529999999999998 22.88 35-39 20.19 29.54 27.27 23.0 40-44 19.445 29.78 27.345000000000002 23.43 45-49 19.915 29.604999999999997 26.884999999999998 23.595 50-54 19.775000000000002 29.035 27.79 23.400000000000002 55-59 20.075000000000003 29.125 27.73 23.07 60-64 19.84 29.299999999999997 27.91 22.95 65-69 20.064999999999998 28.754999999999995 27.775 23.405 70-74 20.851490107688456 29.511645379413977 27.147508139243676 22.489356373653894 75-79 19.92726170631914 29.938879628226502 27.08491185533162 23.048946810122743 80-84 20.285381774022163 29.443910337499368 27.490765572028536 22.77994231644993 85-89 20.606181854556365 29.278783635090527 27.11813544063219 22.996899069720918 90-94 20.383057458618794 29.61444216632495 26.949042356353452 23.053458018702806 95-99 20.235 29.345 27.389999999999997 23.03 100-104 20.71 29.5 27.04 22.75 105-109 20.445 29.544999999999998 27.24 22.770000000000003 110-114 21.32 29.265 27.415 22.0 115-119 20.865000000000002 28.945 27.544999999999998 22.645 120-124 21.207267631012563 29.440912958606535 26.652985634916664 22.698833775464237 125-129 21.695560677422588 29.40174366168955 26.099809600160334 22.802886060727527 130-134 21.08850406421972 29.47947695259252 26.57141414651386 22.860604836673904 135-139 21.187035922135262 29.21934577563717 27.428256070640177 22.165362231587395 140-144 21.7 30.245 26.205000000000002 21.85 145-149 21.423527037933816 28.92958030669895 26.321630347054075 23.325262308313157 150-151 22.063432368058166 27.81747524131879 26.16271781371443 23.956374576908612 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.5 23 4.0 24 4.0 25 6.0 26 11.5 27 14.0 28 16.0 29 18.5 30 23.5 31 37.0 32 51.0 33 60.5 34 78.0 35 95.0 36 114.0 37 140.5 38 168.0 39 179.0 40 191.5 41 221.0 42 240.0 43 263.5 44 271.0 45 269.5 46 256.0 47 231.5 48 202.0 49 167.0 50 143.0 51 125.5 52 103.0 53 66.0 54 51.0 55 45.0 56 33.0 57 22.5 58 15.5 59 13.0 60 12.5 61 11.0 62 8.5 63 6.5 64 2.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.17500000000000002 75-79 1.015 80-84 1.185 85-89 0.03 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.105 125-129 0.21 130-134 0.9650000000000001 135-139 0.33999999999999997 140-144 0.0 145-149 0.88 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.075 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 5.8 0.0 0.0 0.0 0.0 132-133 6.2375 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 8.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAATA 10 0.006830828 145.0 2 >>END_MODULE SRR7166176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6905 33.0 33.0 34.0 32.0 34.0 2 32.75825 34.0 33.0 34.0 32.0 34.0 3 32.62875 33.0 33.0 34.0 31.0 34.0 4 32.5705 33.0 33.0 34.0 32.0 34.0 5 32.73725 34.0 33.0 34.0 32.0 34.0 6 36.7655 38.0 38.0 38.0 35.0 38.0 7 36.874 38.0 38.0 38.0 36.0 38.0 8 36.8405 38.0 38.0 38.0 36.0 38.0 9 36.7625 38.0 38.0 38.0 35.0 38.0 10-14 36.715250000000005 38.0 38.0 38.0 34.8 38.0 15-19 36.42745 38.0 38.0 38.0 34.0 38.0 20-24 36.384750000000004 38.0 38.0 38.0 33.8 38.0 25-29 36.51755 38.0 38.0 38.0 34.2 38.0 30-34 36.508849999999995 38.0 38.0 38.0 34.2 38.0 35-39 36.0997 38.0 38.0 38.0 33.0 38.0 40-44 36.239050000000006 38.0 38.0 38.0 33.6 38.0 45-49 35.91335 38.0 37.6 38.0 31.6 38.0 50-54 35.91585 38.0 37.6 38.0 31.6 38.0 55-59 35.89315 38.0 37.4 38.0 31.4 38.0 60-64 35.837300000000006 38.0 37.2 38.0 31.0 38.0 65-69 35.521950000000004 38.0 37.0 38.0 29.4 38.0 70-74 35.675799999999995 38.0 37.0 38.0 30.2 38.0 75-79 35.418949999999995 38.0 36.6 38.0 29.8 38.0 80-84 35.1035 38.0 36.2 38.0 28.2 38.0 85-89 35.32445 38.0 36.6 38.0 29.4 38.0 90-94 35.2197 38.0 36.2 38.0 28.8 38.0 95-99 34.85195 38.0 36.0 38.0 27.0 38.0 100-104 34.48775 38.0 35.0 38.0 25.0 38.0 105-109 34.397000000000006 38.0 34.8 38.0 24.6 38.0 110-114 33.771249999999995 38.0 34.0 38.0 19.4 38.0 115-119 33.641799999999996 38.0 34.0 38.0 19.0 38.0 120-124 33.01469999999999 38.0 33.0 38.0 15.0 38.0 125-129 31.999000000000002 37.2 31.0 38.0 14.8 38.0 130-134 31.07325 36.2 29.2 38.0 13.4 38.0 135-139 30.338600000000003 36.0 28.2 38.0 13.0 38.0 140-144 29.047950000000004 35.2 24.6 38.0 2.0 38.0 145-149 26.973300000000002 33.4 15.0 38.0 2.0 38.0 150-151 21.046750000000003 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 3.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 5.0 11 6.0 12 6.0 13 0.0 14 3.0 15 4.0 16 7.0 17 9.0 18 10.0 19 12.0 20 13.0 21 31.0 22 23.0 23 30.0 24 32.0 25 42.0 26 57.0 27 62.0 28 73.0 29 77.0 30 115.0 31 148.0 32 152.0 33 211.0 34 287.0 35 458.0 36 839.0 37 1265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.800000000000004 16.2 13.825000000000001 31.175000000000004 2 23.200000000000003 23.400000000000002 36.8 16.6 3 20.575 25.924999999999997 32.875 20.625 4 23.45 35.25 21.475 19.825 5 23.1 38.05 22.35 16.5 6 17.349999999999998 38.875 24.175 19.6 7 15.825 15.299999999999999 47.175 21.7 8 20.200000000000003 21.075 27.750000000000004 30.975 9 21.43035758939735 24.18104526131533 28.032008002000502 26.356589147286826 10-14 22.755 28.15 27.529999999999998 21.565 15-19 22.615 27.939999999999998 28.044999999999998 21.4 20-24 22.7 27.98 28.71 20.61 25-29 21.95 28.375 28.23 21.445 30-34 22.6 27.42 28.89 21.09 35-39 22.759999999999998 27.439999999999998 28.705000000000002 21.095 40-44 22.911145557277866 27.466373318665934 28.68143407170359 20.94104705235262 45-49 22.63 28.53 28.685 20.155 50-54 22.650000000000002 27.515 29.104999999999997 20.73 55-59 22.994999999999997 28.28 28.12 20.605 60-64 22.6 28.294999999999998 28.58 20.525 65-69 23.03 28.115000000000002 28.744999999999997 20.11 70-74 22.795 27.765 28.84 20.599999999999998 75-79 22.595000000000002 27.525 28.845 21.035 80-84 22.295 27.88 28.685 21.14 85-89 23.03615180759038 27.901395069753487 28.42642132106605 20.63603180159008 90-94 22.61 27.675 29.515 20.200000000000003 95-99 23.005 28.105000000000004 28.215 20.674999999999997 100-104 23.524704940988197 28.185637127425483 28.330666133226647 19.95899179835967 105-109 23.24010606894481 27.53289638264872 29.128933806974533 20.098063741431933 110-114 23.71711513454036 28.06842052615785 27.838351505451637 20.376112833850154 115-119 24.165 27.3 28.884999999999998 19.650000000000002 120-124 24.016200810040502 27.966398319915996 28.111405570278514 19.90599529976499 125-129 23.805 27.08 28.78 20.335 130-134 24.29 27.955000000000002 27.900000000000002 19.855 135-139 24.385 28.15 27.955000000000002 19.509999999999998 140-144 24.615000000000002 27.834999999999997 28.275 19.275000000000002 145-149 25.729999999999997 27.655 27.634999999999998 18.98 150-151 26.787499999999998 25.2375 28.3875 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.5 22 2.0 23 1.0 24 2.5 25 4.5 26 5.0 27 7.0 28 9.0 29 14.0 30 19.5 31 21.0 32 25.0 33 43.0 34 62.5 35 84.0 36 103.5 37 117.5 38 141.0 39 165.5 40 209.0 41 236.5 42 232.5 43 270.0 44 293.5 45 274.5 46 285.5 47 268.5 48 216.0 49 181.0 50 152.5 51 131.0 52 104.0 53 74.0 54 60.5 55 46.5 56 34.5 57 26.5 58 18.0 59 14.0 60 10.0 61 6.5 62 4.0 63 4.0 64 3.5 65 2.5 66 3.0 67 2.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.065 110-114 0.03 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.8375000000000004 0.0 0.0 0.0 0.0 122-123 4.3 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.800000000000001 0.0 0.0 0.0 0.0 138-139 8.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAT 10 0.006830828 145.0 1 >>END_MODULE Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548690 spots for SRR7166176.sra Written 548690 spots for SRR7166176.sra Read 548707 spots for SRR7166176.sra Written 548707 spots for SRR7166176.sra SRR ids: ['SRR7166176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_afkkz5km SRR7166176.sra spots: 10973817 blocks: [[1, 548690], [548691, 1097380], [1097381, 1646070], [1646071, 2194760], [2194761, 2743450], [2743451, 3292140], [3292141, 3840830], [3840831, 4389520], [4389521, 4938210], [4938211, 5486900], [5486901, 6035590], [6035591, 6584280], [6584281, 7132970], [7132971, 7681660], [7681661, 8230350], [8230351, 8779040], [8779041, 9327730], [9327731, 9876420], [9876421, 10425110], [10425111, 10973817]] SRR7166176 file size 3696966 SRR7166176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166176 SRR7166176_1.fastq SRR7166176_2.fastq Input file: SRR7166176_1.fastq Paired file: SRR7166176_2.fastq trimmed: SRR7166176-trimmed-pair1.fastq, SRR7166176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:25:24 2025 >> started Fri Feb 14 21:25:40 2025 >> done (15.941s) 10973817 read pairs processed; of these: 9012 ( 0.08%) short read pairs filtered out after trimming by size control 7600 ( 0.07%) empty read pairs filtered out after trimming by size control 10957205 (99.85%) read pairs available; of these: 7070668 (64.53%) trimmed read pairs available after processing 3886537 (35.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 10 0.00% 27 3 0.00% 28 7 0.00% 29 5 0.00% 30 8 0.00% 31 4 0.00% 32 7 0.00% 33 13 0.00% 34 7 0.00% 35 6 0.00% 36 7 0.00% 37 8 0.00% 38 14 0.00% 39 15 0.00% 40 12 0.00% 41 20 0.00% 42 14 0.00% 43 24 0.00% 44 23 0.00% 45 25 0.00% 46 29 0.00% 47 39 0.00% 48 38 0.00% 49 50 0.00% 50 54 0.00% 51 56 0.00% 52 69 0.00% 53 83 0.00% 54 91 0.00% 55 101 0.00% 56 107 0.00% 57 121 0.00% 58 152 0.00% 59 151 0.00% 60 226 0.00% 61 237 0.00% 62 257 0.00% 63 309 0.00% 64 368 0.00% 65 424 0.00% 66 472 0.00% 67 508 0.00% 68 574 0.01% 69 613 0.01% 70 829 0.01% 71 874 0.01% 72 1030 0.01% 73 1195 0.01% 74 1191 0.01% 75 1260 0.01% 76 1379 0.01% 77 1441 0.01% 78 1505 0.01% 79 1716 0.02% 80 1901 0.02% 81 2222 0.02% 82 2481 0.02% 83 2951 0.03% 84 3644 0.03% 85 4031 0.04% 86 4227 0.04% 87 4583 0.04% 88 4904 0.04% 89 5207 0.05% 90 6100 0.06% 91 7254 0.07% 92 7933 0.07% 93 8636 0.08% 94 8782 0.08% 95 9197 0.08% 96 9519 0.09% 97 10332 0.09% 98 10905 0.10% 99 12151 0.11% 100 13054 0.12% 101 13348 0.12% 102 14072 0.13% 103 14916 0.14% 104 16823 0.15% 105 17622 0.16% 106 17845 0.16% 107 17867 0.16% 108 18079 0.16% 109 18414 0.17% 110 19832 0.18% 111 20396 0.19% 112 22971 0.21% 113 23984 0.22% 114 25408 0.23% 115 25644 0.23% 116 27395 0.25% 117 29954 0.27% 118 31746 0.29% 119 34139 0.31% 120 35105 0.32% 121 34986 0.32% 122 35756 0.33% 123 37606 0.34% 124 41823 0.38% 125 44051 0.40% 126 46723 0.43% 127 50257 0.46% 128 51721 0.47% 129 55689 0.51% 130 57852 0.53% 131 62714 0.57% 132 68229 0.62% 133 72814 0.66% 134 77229 0.70% 135 82889 0.76% 136 85101 0.78% 137 87852 0.80% 138 95615 0.87% 139 107795 0.98% 140 125073 1.14% 141 119276 1.09% 142 126990 1.16% 143 140055 1.28% 144 162128 1.48% 145 193453 1.77% 146 243775 2.22% 147 324451 2.96% 148 463012 4.23% 149 789853 7.21% 150 2582530 23.57% 151 3886537 35.47% 10957205 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=4.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=110.77 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=18.0 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.22 fanout-score-rank=15 prefix-density=0.35 prefix-fanout=4.7 sequence=CAGAAAATGTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=110.56 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=21.8 sequence=TGATGAGGATGA SRR7166176 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:27:15 Started mapping on | Feb 14 21:27:15 Finished on | Feb 14 21:29:23 Mapping speed, Million of reads per hour | 308.17 Number of input reads | 10957205 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9937302 Uniquely mapped reads % | 90.69% Average mapped length | 289.74 Number of splices: Total | 9219924 Number of splices: Annotated (sjdb) | 9051712 Number of splices: GT/AG | 9065085 Number of splices: GC/AG | 119021 Number of splices: AT/AC | 6228 Number of splices: Non-canonical | 29590 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285729 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 34253 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.22% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743668 743668 743668 N_multimapping 285729 285729 285729 N_noFeature 339745 9809803 418524 N_ambiguous 104192 832 54838 UnstrandedReadsAssigned:9493365 PositiveStrandReadsAssigned:126667 NegativeStrandReadsAssigned:9463940 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166176-trimmed-pair1.fastq SRR7166176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,957,205 reads, 9,467,234 reads pseudoaligned [quant] estimated average fragment length: 227.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR7166176.ke.tsv 34699 SRR7166176.se.tsv 87100 total ==> SRR7166176.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.05 1040 63.528 Potri.005G024800.1.v4.1 1035 808.047 230 31.1408 Potri.004G059700.1.v4.1 961 734.062 21 3.12987 Potri.007G009000.2.v4.1 1416 1189.05 0 0 Potri.003G141000.2.v4.1 2943 2716.05 322.586 12.9941 Potri.016G087400.1.v4.1 270 87.362 471.516 590.491 Potri.015G069301.1.v4.1 564 340.12 0 0 Potri.010G195200.1.v4.1 1773 1546.05 338 23.9185 Potri.012G127500.1.v4.1 977 750.052 4219 615.399 ==> SRR7166176.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 150 SRR7166176 completed mapping pipeline successfully