Starting /dee2/code/volunteer_pipeline.sh SRR7166177 current disk space = 3110110490624 free memory = 1279682284 SRR7166177 SRAfilesize a3543c6477addcfc9346699a5696f8d9 SRR7166177.sra SRR7166177.sra file validated SRR7166177 is paired end SRR7166177 is conventional basespace SRR7166177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07325 33.0 33.0 34.0 32.0 34.0 2 33.01 34.0 33.0 34.0 32.0 34.0 3 32.93375 33.0 33.0 34.0 32.0 34.0 4 33.30675 34.0 33.0 34.0 33.0 34.0 5 33.17525 34.0 33.0 34.0 33.0 34.0 6 36.88525 38.0 37.0 38.0 35.0 38.0 7 37.3915 38.0 38.0 38.0 37.0 38.0 8 37.4385 38.0 38.0 38.0 37.0 38.0 9 37.57075 38.0 38.0 38.0 38.0 38.0 10-14 37.51505000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.585449999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.57645 38.0 38.0 38.0 38.0 38.0 25-29 37.567 38.0 38.0 38.0 38.0 38.0 30-34 37.506299999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.4707 38.0 38.0 38.0 37.4 38.0 40-44 37.44315 38.0 38.0 38.0 37.2 38.0 45-49 37.4079 38.0 38.0 38.0 37.0 38.0 50-54 37.2689 38.0 38.0 38.0 37.0 38.0 55-59 36.7491 38.0 38.0 38.0 36.0 38.0 60-64 37.059749999999994 38.0 38.0 38.0 36.2 38.0 65-69 37.19565 38.0 38.0 38.0 36.2 38.0 70-74 37.1154 38.0 38.0 38.0 36.0 38.0 75-79 37.09765 38.0 38.0 38.0 36.0 38.0 80-84 36.97455000000001 38.0 38.0 38.0 35.8 38.0 85-89 36.920700000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.7073 38.0 38.0 38.0 34.8 38.0 95-99 36.68055 38.0 38.0 38.0 34.8 38.0 100-104 36.58775 38.0 38.0 38.0 34.4 38.0 105-109 36.42355 38.0 38.0 38.0 34.0 38.0 110-114 36.38055 38.0 38.0 38.0 34.0 38.0 115-119 36.27855000000001 38.0 38.0 38.0 33.8 38.0 120-124 36.0168 38.0 37.2 38.0 33.0 38.0 125-129 35.8918 38.0 37.0 38.0 32.6 38.0 130-134 35.77845 38.0 37.0 38.0 32.4 38.0 135-139 35.53965000000001 38.0 36.0 38.0 31.0 38.0 140-144 35.30045 38.0 36.0 38.0 30.6 38.0 145-149 34.86155000000001 38.0 36.0 38.0 29.2 38.0 150-151 31.7285 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 3.0 21 1.0 22 3.0 23 5.0 24 11.0 25 7.0 26 8.0 27 16.0 28 23.0 29 30.0 30 38.0 31 50.0 32 69.0 33 84.0 34 133.0 35 218.0 36 577.0 37 2714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.67437676689797 18.247237214083782 11.95065535851966 33.127730660498585 2 19.7 25.624999999999996 37.125 17.549999999999997 3 17.375 30.85 28.299999999999997 23.474999999999998 4 19.775000000000002 37.65 22.900000000000002 19.675 5 18.86745176647457 38.56176396893009 23.95389626659985 18.61688799799549 6 15.4 36.3 26.650000000000002 21.65 7 11.975 20.025000000000002 45.975 22.025 8 17.974999999999998 20.724999999999998 27.750000000000004 33.550000000000004 9 17.299999999999997 22.025 31.424999999999997 29.25 10-14 19.27 30.125 26.595000000000002 24.01 15-19 19.265 29.615000000000002 27.365000000000002 23.755000000000003 20-24 18.970000000000002 30.17 27.725 23.135 25-29 19.189999999999998 29.48 28.075 23.255 30-34 19.785 29.29 27.825 23.1 35-39 19.57 29.005 28.110000000000003 23.315 40-44 19.71 28.84 28.549999999999997 22.900000000000002 45-49 19.67 29.315 27.415 23.599999999999998 50-54 19.431350917661216 29.074315514993483 28.01123257446595 23.48310099287935 55-59 19.44472642371333 29.712719520860826 27.276418637701756 23.566135417724087 60-64 19.33978829077409 29.318216023679327 27.727888426227864 23.61410725931872 65-69 20.07 28.83 28.09 23.01 70-74 19.64 28.994999999999997 28.134999999999998 23.23 75-79 19.77 29.595 27.544999999999998 23.09 80-84 19.365 28.765 28.08 23.79 85-89 19.335 28.67 28.01 23.985 90-94 20.19 28.360000000000003 27.91 23.54 95-99 20.29 28.865000000000002 27.800000000000004 23.044999999999998 100-104 19.775000000000002 28.575 27.595 24.055 105-109 19.97997496871089 28.846057571964955 27.759699624530665 23.414267834793492 110-114 20.235 29.065 27.534999999999997 23.165 115-119 20.599999999999998 28.860000000000003 27.345000000000002 23.195 120-124 20.5 28.68 27.685 23.135 125-129 20.705000000000002 29.104999999999997 26.935 23.255 130-134 20.044999999999998 28.810000000000002 27.785 23.36 135-139 20.305 28.98 27.275 23.44 140-144 20.555 28.51 27.27 23.665 145-149 20.515 29.349999999999998 26.665 23.47 150-151 20.21570102834211 29.207424128417358 26.36067218459995 24.216202658640583 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 2.0 18 1.5 19 2.0 20 1.5 21 1.5 22 2.0 23 3.5 24 6.0 25 4.0 26 4.5 27 12.5 28 21.5 29 21.5 30 24.5 31 34.5 32 46.0 33 60.5 34 67.5 35 85.0 36 117.0 37 134.5 38 152.0 39 181.5 40 211.5 41 229.5 42 254.5 43 265.0 44 254.5 45 265.0 46 258.0 47 244.5 48 222.0 49 175.0 50 132.5 51 113.0 52 99.5 53 76.0 54 61.0 55 39.5 56 24.5 57 23.5 58 15.0 59 7.5 60 7.0 61 5.5 62 4.5 63 4.0 64 4.0 65 5.0 66 2.5 67 0.5 68 0.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.29 55-59 1.49 60-64 0.335 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.125 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.15037593984962408 0.3 3 0.05012531328320802 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.449999999999999 0.0 0.0 0.0 0.0 126-127 4.824999999999999 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 5.825 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.925 0.0 0.0 0.0 0.0 136-137 7.425 0.0 0.0 0.0 0.0 138-139 8.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAGGC 10 0.0068537686 144.8375 2 >>END_MODULE SRR7166177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06275 33.0 33.0 34.0 32.0 34.0 2 33.082 34.0 33.0 34.0 32.0 34.0 3 33.1775 34.0 33.0 34.0 33.0 34.0 4 33.07325 34.0 33.0 34.0 33.0 34.0 5 33.076 34.0 33.0 34.0 33.0 34.0 6 37.33325 38.0 38.0 38.0 37.0 38.0 7 37.3935 38.0 38.0 38.0 37.0 38.0 8 37.313 38.0 38.0 38.0 37.0 38.0 9 37.2945 38.0 38.0 38.0 37.0 38.0 10-14 37.3078 38.0 38.0 38.0 37.0 38.0 15-19 37.3095 38.0 38.0 38.0 37.0 38.0 20-24 37.2298 38.0 38.0 38.0 37.0 38.0 25-29 37.18135 38.0 38.0 38.0 37.0 38.0 30-34 37.14765 38.0 38.0 38.0 37.0 38.0 35-39 37.129149999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.106100000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.012950000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.91975 38.0 38.0 38.0 36.0 38.0 55-59 36.777249999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.7982 38.0 38.0 38.0 35.6 38.0 65-69 36.77185 38.0 38.0 38.0 35.2 38.0 70-74 36.6942 38.0 38.0 38.0 35.2 38.0 75-79 36.587700000000005 38.0 38.0 38.0 34.6 38.0 80-84 36.509049999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.4561 38.0 38.0 38.0 34.0 38.0 90-94 36.32005 38.0 38.0 38.0 34.0 38.0 95-99 36.1788 38.0 37.8 38.0 33.6 38.0 100-104 36.04055 38.0 37.2 38.0 33.0 38.0 105-109 35.936550000000004 38.0 37.0 38.0 32.8 38.0 110-114 35.721500000000006 38.0 37.0 38.0 31.2 38.0 115-119 35.4413 38.0 36.8 38.0 29.8 38.0 120-124 35.2334 38.0 36.0 38.0 29.2 38.0 125-129 34.992599999999996 38.0 36.0 38.0 28.0 38.0 130-134 34.712149999999994 38.0 35.2 38.0 27.8 38.0 135-139 34.36845 38.0 35.2 38.0 25.6 38.0 140-144 33.65995 38.0 34.6 38.0 21.8 38.0 145-149 32.73945 38.0 33.8 38.0 15.0 38.0 150-151 28.70475 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 6.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 4.0 12 0.0 13 2.0 14 1.0 15 1.0 16 3.0 17 5.0 18 5.0 19 4.0 20 7.0 21 3.0 22 14.0 23 17.0 24 12.0 25 13.0 26 18.0 27 22.0 28 33.0 29 45.0 30 58.0 31 54.0 32 66.0 33 99.0 34 165.0 35 271.0 36 687.0 37 2377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.375 16.875 15.950000000000001 30.8 2 23.35 22.975 36.199999999999996 17.474999999999998 3 20.4 26.424999999999997 33.175 20.0 4 23.0 35.55 21.349999999999998 20.1 5 23.225 38.85 21.725 16.2 6 19.3 37.95 23.549999999999997 19.2 7 16.950000000000003 15.55 46.7 20.8 8 20.349999999999998 20.599999999999998 28.000000000000004 31.05 9 22.85 23.875 26.924999999999997 26.35 10-14 22.564999999999998 28.585 27.565 21.285 15-19 23.095 27.805000000000003 28.71 20.39 20-24 22.720000000000002 28.084999999999997 28.449999999999996 20.745 25-29 22.375 28.299999999999997 28.615000000000002 20.71 30-34 23.165 28.21 28.395 20.23 35-39 22.61 28.000000000000004 28.849999999999998 20.54 40-44 22.335 28.455000000000002 28.4 20.810000000000002 45-49 23.13 28.32 28.775000000000002 19.775000000000002 50-54 22.68 28.185 28.625 20.51 55-59 23.32 27.555000000000003 28.605000000000004 20.52 60-64 22.939999999999998 28.64 27.884999999999998 20.535 65-69 23.3 27.46 28.64 20.599999999999998 70-74 23.015 28.389999999999997 28.4 20.195 75-79 22.994999999999997 28.58 28.46 19.965 80-84 23.46 27.91 28.525 20.105 85-89 23.43 28.125 28.51 19.935 90-94 23.085 28.494999999999997 28.355000000000004 20.064999999999998 95-99 23.07 28.465 28.305000000000003 20.16 100-104 23.84 27.51 28.925 19.725 105-109 23.86 27.925 28.475 19.74 110-114 23.335 28.62 28.42 19.625 115-119 23.990000000000002 28.49 27.91 19.61 120-124 24.51 28.04 28.03 19.42 125-129 24.47 28.439999999999998 27.62 19.470000000000002 130-134 24.525 28.225 28.15 19.1 135-139 24.65 28.96 27.560000000000002 18.83 140-144 25.224999999999998 27.744999999999997 28.16 18.87 145-149 25.380000000000003 28.415000000000003 27.46 18.745 150-151 27.078117175763644 27.15322984476715 28.054581872809216 17.71407110665999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 2.5 21 3.5 22 4.0 23 5.0 24 5.0 25 4.0 26 6.5 27 9.0 28 11.5 29 18.5 30 24.0 31 26.5 32 34.0 33 51.0 34 59.0 35 69.0 36 95.0 37 131.5 38 155.0 39 173.5 40 190.0 41 212.0 42 249.0 43 275.5 44 276.5 45 260.0 46 267.5 47 245.0 48 212.5 49 196.5 50 157.5 51 127.5 52 117.0 53 96.5 54 66.0 55 39.5 56 26.0 57 24.0 58 21.0 59 16.0 60 8.0 61 5.0 62 3.5 63 2.5 64 2.0 65 2.5 66 3.0 67 2.0 68 0.5 69 0.0 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.7874999999999996 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.9625 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.5375 0.0 0.0 0.0 0.0 134-135 7.075 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834782 spots for SRR7166177.sra Written 834782 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra Read 834770 spots for SRR7166177.sra Written 834770 spots for SRR7166177.sra SRR ids: ['SRR7166177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pmio6pww SRR7166177.sra spots: 16695412 blocks: [[1, 834770], [834771, 1669540], [1669541, 2504310], [2504311, 3339080], [3339081, 4173850], [4173851, 5008620], [5008621, 5843390], [5843391, 6678160], [6678161, 7512930], [7512931, 8347700], [8347701, 9182470], [9182471, 10017240], [10017241, 10852010], [10852011, 11686780], [11686781, 12521550], [12521551, 13356320], [13356321, 14191090], [14191091, 15025860], [15025861, 15860630], [15860631, 16695412]] SRR7166177 file size 5635826 SRR7166177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166177 SRR7166177_1.fastq SRR7166177_2.fastq Input file: SRR7166177_1.fastq Paired file: SRR7166177_2.fastq trimmed: SRR7166177-trimmed-pair1.fastq, SRR7166177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:53:29 2025 >> started Fri Feb 14 19:53:51 2025 >> done (22.457s) 16695412 read pairs processed; of these: 6464 ( 0.04%) short read pairs filtered out after trimming by size control 5158 ( 0.03%) empty read pairs filtered out after trimming by size control 16683790 (99.93%) read pairs available; of these: 7218761 (43.27%) trimmed read pairs available after processing 9465029 (56.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 8 0.00% 22 6 0.00% 23 7 0.00% 24 7 0.00% 25 6 0.00% 26 4 0.00% 27 8 0.00% 28 9 0.00% 29 10 0.00% 30 3 0.00% 31 6 0.00% 32 9 0.00% 33 16 0.00% 34 7 0.00% 35 7 0.00% 36 14 0.00% 37 12 0.00% 38 7 0.00% 39 9 0.00% 40 10 0.00% 41 11 0.00% 42 26 0.00% 43 14 0.00% 44 23 0.00% 45 17 0.00% 46 21 0.00% 47 20 0.00% 48 21 0.00% 49 46 0.00% 50 34 0.00% 51 50 0.00% 52 65 0.00% 53 60 0.00% 54 74 0.00% 55 77 0.00% 56 79 0.00% 57 95 0.00% 58 99 0.00% 59 123 0.00% 60 170 0.00% 61 203 0.00% 62 220 0.00% 63 226 0.00% 64 286 0.00% 65 286 0.00% 66 319 0.00% 67 343 0.00% 68 468 0.00% 69 529 0.00% 70 602 0.00% 71 720 0.00% 72 803 0.00% 73 979 0.01% 74 1138 0.01% 75 1223 0.01% 76 1333 0.01% 77 1416 0.01% 78 1672 0.01% 79 1849 0.01% 80 2107 0.01% 81 2500 0.01% 82 2974 0.02% 83 3414 0.02% 84 4087 0.02% 85 4533 0.03% 86 4961 0.03% 87 5327 0.03% 88 5636 0.03% 89 6027 0.04% 90 6817 0.04% 91 7481 0.04% 92 8439 0.05% 93 9190 0.06% 94 10152 0.06% 95 10515 0.06% 96 11373 0.07% 97 11835 0.07% 98 12425 0.07% 99 13960 0.08% 100 13806 0.08% 101 15052 0.09% 102 16560 0.10% 103 17888 0.11% 104 19073 0.11% 105 20152 0.12% 106 21113 0.13% 107 21445 0.13% 108 22061 0.13% 109 22921 0.14% 110 24372 0.15% 111 25588 0.15% 112 27485 0.16% 113 28900 0.17% 114 31028 0.19% 115 32746 0.20% 116 33707 0.20% 117 34477 0.21% 118 35607 0.21% 119 36031 0.22% 120 37307 0.22% 121 38587 0.23% 122 40712 0.24% 123 43360 0.26% 124 45415 0.27% 125 47885 0.29% 126 49260 0.30% 127 50463 0.30% 128 50723 0.30% 129 52547 0.31% 130 53866 0.32% 131 55825 0.33% 132 59202 0.35% 133 62430 0.37% 134 65663 0.39% 135 69587 0.42% 136 72162 0.43% 137 75415 0.45% 138 79168 0.47% 139 82316 0.49% 140 86556 0.52% 141 92494 0.55% 142 101576 0.61% 143 111772 0.67% 144 128514 0.77% 145 151006 0.91% 146 182683 1.09% 147 235571 1.41% 148 344691 2.07% 149 654901 3.93% 150 3337424 20.00% 151 9465029 56.73% 16683790 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=45.89 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=13.0 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=18 prefix-density=0.61 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=47.76 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166177 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:54:39 Started mapping on | Feb 14 19:54:39 Finished on | Feb 14 19:56:24 Mapping speed, Million of reads per hour | 572.02 Number of input reads | 16683790 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15949167 Uniquely mapped reads % | 95.60% Average mapped length | 293.50 Number of splices: Total | 14751718 Number of splices: Annotated (sjdb) | 14404046 Number of splices: GT/AG | 14506011 Number of splices: GC/AG | 185890 Number of splices: AT/AC | 12037 Number of splices: Non-canonical | 47780 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364993 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 49088 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 377133 377133 377133 N_multimapping 364993 364993 364993 N_noFeature 681284 15727596 817960 N_ambiguous 174898 1399 89124 UnstrandedReadsAssigned:15092985 PositiveStrandReadsAssigned:220172 NegativeStrandReadsAssigned:15042083 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166177-trimmed-pair1.fastq SRR7166177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,683,790 reads, 14,922,111 reads pseudoaligned [quant] estimated average fragment length: 233.301 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR7166177.ke.tsv 34699 SRR7166177.se.tsv 87100 total ==> SRR7166177.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.7 2559 90.3906 Potri.005G024800.1.v4.1 1035 802.699 1908 149.929 Potri.004G059700.1.v4.1 961 728.724 37 3.20258 Potri.007G009000.2.v4.1 1416 1183.7 0 0 Potri.003G141000.2.v4.1 2943 2710.7 907.826 21.1243 Potri.016G087400.1.v4.1 270 84.8118 833 619.512 Potri.015G069301.1.v4.1 564 335.733 0 0 Potri.010G195200.1.v4.1 1773 1540.7 371.9 15.2254 Potri.012G127500.1.v4.1 977 744.714 15549 1316.96 ==> SRR7166177.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 112 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 603 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 358 SRR7166177 completed mapping pipeline successfully