Starting /dee2/code/volunteer_pipeline.sh SRR7166178 current disk space = 3109753847808 free memory = 1448705272 SRR7166178 SRAfilesize aa3d4a69d8729b1787ab74163cf31070 SRR7166178.sra SRR7166178.sra file validated SRR7166178 is paired end SRR7166178 is conventional basespace SRR7166178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.5505 32.0 30.0 33.0 18.0 33.0 2 32.31375 33.0 33.0 33.0 32.0 34.0 3 31.94275 33.0 31.0 33.0 29.0 34.0 4 32.52275 33.0 33.0 33.0 31.0 34.0 5 32.70325 33.0 33.0 34.0 32.0 34.0 6 36.93075 38.0 37.0 38.0 35.0 38.0 7 37.41275 38.0 38.0 38.0 37.0 38.0 8 37.52375 38.0 38.0 38.0 37.0 38.0 9 37.54625 38.0 38.0 38.0 37.0 38.0 10-14 37.57005 38.0 38.0 38.0 37.8 38.0 15-19 37.54115 38.0 38.0 38.0 37.8 38.0 20-24 37.54084999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.4771 38.0 38.0 38.0 37.2 38.0 30-34 37.424249999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.44235 38.0 38.0 38.0 37.0 38.0 40-44 37.39 38.0 38.0 38.0 37.0 38.0 45-49 37.4002 38.0 38.0 38.0 37.0 38.0 50-54 37.1813 38.0 38.0 38.0 36.6 38.0 55-59 36.6065 38.0 38.0 38.0 36.0 38.0 60-64 36.9181 38.0 38.0 38.0 36.0 38.0 65-69 37.14789999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.0997 38.0 38.0 38.0 36.0 38.0 75-79 37.004949999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.94795 38.0 38.0 38.0 35.8 38.0 85-89 36.801249999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.6539 38.0 38.0 38.0 34.6 38.0 95-99 36.616550000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.60255 38.0 38.0 38.0 34.6 38.0 105-109 36.30749999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.2592 38.0 38.0 38.0 34.0 38.0 115-119 36.087849999999996 38.0 37.4 38.0 33.2 38.0 120-124 35.94195 38.0 37.0 38.0 33.0 38.0 125-129 35.7579 38.0 37.0 38.0 32.0 38.0 130-134 35.58895 38.0 36.4 38.0 31.0 38.0 135-139 35.32845 38.0 36.0 38.0 31.0 38.0 140-144 35.00165 38.0 35.8 38.0 28.6 38.0 145-149 34.6894 38.0 35.6 38.0 28.0 38.0 150-151 31.493625 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 6.0 20 5.0 21 2.0 22 8.0 23 6.0 24 4.0 25 16.0 26 12.0 27 17.0 28 18.0 29 28.0 30 35.0 31 49.0 32 63.0 33 115.0 34 137.0 35 253.0 36 609.0 37 2608.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.82419855222337 18.09720785935884 11.944157187176836 35.134436401240954 2 18.85 26.200000000000003 38.35 16.6 3 17.025000000000002 30.875000000000004 26.974999999999998 25.124999999999996 4 19.55 37.85 22.1 20.5 5 19.844844844844843 37.66266266266266 24.724724724724727 17.76776776776777 6 17.0 36.475 24.825 21.7 7 13.05 17.925 46.975 22.05 8 16.55 21.099999999999998 29.025000000000002 33.324999999999996 9 17.575 22.025 30.099999999999998 30.3 10-14 19.06 30.65 26.384999999999998 23.905 15-19 19.265 29.104999999999997 28.000000000000004 23.630000000000003 20-24 19.725 29.404999999999998 27.43 23.44 25-29 19.925 28.735 27.694999999999997 23.645 30-34 20.080000000000002 29.825000000000003 26.83 23.265 35-39 19.39 29.5 27.67 23.44 40-44 19.470000000000002 29.235 27.810000000000002 23.485 45-49 19.515 29.385 27.650000000000002 23.45 50-54 19.715834923185056 28.52193995381062 28.210663721257156 23.551561401747165 55-59 20.308522553711434 28.65797780266775 27.86376132776703 23.169738315853785 60-64 20.03919401035124 28.89302045123361 27.44585699211095 23.621928546304204 65-69 20.194087339302687 28.75293882247011 27.47736481416638 23.575609024060828 70-74 19.66 29.125 27.74 23.474999999999998 75-79 19.805 28.634999999999998 28.044999999999998 23.515 80-84 19.845 29.825000000000003 27.47 22.86 85-89 19.975 28.975 27.950000000000003 23.1 90-94 19.91 28.939999999999998 27.88 23.27 95-99 20.18 29.110000000000003 27.744999999999997 22.965 100-104 20.320080020005 29.057264316079017 27.336834208552137 23.28582145536384 105-109 20.566236634707096 28.924250790622963 27.448421263992774 23.061091310677178 110-114 20.25708998149352 28.735057270044518 27.609663382183765 23.398189366278196 115-119 20.88088088088088 28.95895895895896 27.36736736736737 22.792792792792792 120-124 20.687068706870686 29.05290529052905 27.29272927292729 22.967296729672967 125-129 20.465 29.15 27.435 22.95 130-134 20.28 28.985 27.42 23.315 135-139 20.365 28.425 27.275 23.935000000000002 140-144 20.41 28.725 27.175 23.69 145-149 20.580000000000002 28.810000000000002 27.125 23.485 150-151 21.156011510071313 28.462404604028524 26.886025272113102 23.49555861378706 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.5 23 2.5 24 3.0 25 4.0 26 7.0 27 12.0 28 18.5 29 22.5 30 24.0 31 31.0 32 43.5 33 60.0 34 74.0 35 90.0 36 113.0 37 127.5 38 163.5 39 198.5 40 195.0 41 214.5 42 240.5 43 256.0 44 273.5 45 265.5 46 252.0 47 233.0 48 200.0 49 177.5 50 156.5 51 123.5 52 102.0 53 76.0 54 54.0 55 48.0 56 33.0 57 23.0 58 20.0 59 12.0 60 8.0 61 10.0 62 7.0 63 5.0 64 3.5 65 2.0 66 3.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.41000000000000003 55-59 1.79 60-64 0.49500000000000005 65-69 0.045 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.395 110-114 0.034999999999999996 115-119 0.1 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9749999999999999 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.125 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05775 33.0 33.0 34.0 32.0 34.0 2 33.09775 34.0 33.0 34.0 32.0 34.0 3 33.04875 34.0 33.0 34.0 32.0 34.0 4 33.14 34.0 33.0 34.0 32.0 34.0 5 33.1175 34.0 33.0 34.0 33.0 34.0 6 37.25175 38.0 38.0 38.0 37.0 38.0 7 37.3135 38.0 38.0 38.0 37.0 38.0 8 37.338 38.0 38.0 38.0 37.0 38.0 9 37.325 38.0 38.0 38.0 37.0 38.0 10-14 37.2984 38.0 38.0 38.0 37.0 38.0 15-19 37.252750000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.2524 38.0 38.0 38.0 37.0 38.0 25-29 37.1917 38.0 38.0 38.0 37.0 38.0 30-34 37.12095 38.0 38.0 38.0 37.0 38.0 35-39 37.071 38.0 38.0 38.0 36.4 38.0 40-44 37.006299999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.9345 38.0 38.0 38.0 36.0 38.0 50-54 36.808499999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.74035 38.0 38.0 38.0 35.2 38.0 60-64 36.8356 38.0 38.0 38.0 36.0 38.0 65-69 36.765750000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.689 38.0 38.0 38.0 35.0 38.0 75-79 36.57430000000001 38.0 38.0 38.0 34.8 38.0 80-84 36.55195 38.0 38.0 38.0 34.0 38.0 85-89 36.4361 38.0 38.0 38.0 34.0 38.0 90-94 36.2714 38.0 38.0 38.0 33.8 38.0 95-99 36.08855 38.0 37.2 38.0 33.2 38.0 100-104 35.92115 38.0 37.0 38.0 33.0 38.0 105-109 35.83015 38.0 37.0 38.0 32.2 38.0 110-114 35.58945 38.0 37.0 38.0 31.0 38.0 115-119 35.3376 38.0 36.4 38.0 29.2 38.0 120-124 35.1243 38.0 36.0 38.0 28.0 38.0 125-129 34.8002 38.0 35.6 38.0 27.8 38.0 130-134 34.3326 38.0 35.0 38.0 24.6 38.0 135-139 34.1644 38.0 35.0 38.0 23.0 38.0 140-144 33.597049999999996 38.0 34.2 38.0 21.4 38.0 145-149 32.756350000000005 38.0 33.8 38.0 14.0 38.0 150-151 28.509125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 1.0 14 3.0 15 7.0 16 3.0 17 1.0 18 3.0 19 6.0 20 11.0 21 10.0 22 7.0 23 18.0 24 22.0 25 24.0 26 29.0 27 24.0 28 26.0 29 42.0 30 31.0 31 49.0 32 81.0 33 119.0 34 159.0 35 307.0 36 680.0 37 2324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.625 15.25 14.95 32.175 2 23.25 24.2 37.1 15.45 3 19.525000000000002 26.825 31.6 22.05 4 23.275000000000002 35.949999999999996 20.95 19.825 5 22.15 39.574999999999996 21.25 17.025000000000002 6 17.34234234234234 38.86386386386386 24.324324324324326 19.46946946946947 7 16.208104052026012 15.332666333166584 47.1735867933967 21.285642821410704 8 21.135567783891947 20.885442721360683 27.763881940970485 30.21510755377689 9 22.71135567783892 23.81190595297649 28.46423211605803 25.012506253126567 10-14 22.436218109054526 29.67983991995998 26.753376688344172 21.13056528264132 15-19 22.72136068034017 28.509254627313656 27.99899949974988 20.770385192596297 20-24 23.165057287236703 27.858107770050534 28.16830940111072 20.80852554160204 25-29 22.52527274547092 28.820938844960466 28.385546992293065 20.268241417275547 30-34 22.004804323891502 28.08527674907417 29.00610549494545 20.90381343208888 35-39 23.07961767502377 28.48921583345844 28.00880748636341 20.42235900515438 40-44 22.625838086660664 28.354848393875713 28.514960472330632 20.50435304713299 45-49 23.436092483234912 28.05524972475228 28.300470423381043 20.20818736863177 50-54 22.909054507232593 28.32474097802693 28.10450973522198 20.661694779518495 55-59 23.11580422380142 28.11029926934241 28.380542488239414 20.393354018616755 60-64 23.010709638674808 28.931037934140726 28.145330797717943 19.91292162946652 65-69 23.453763010408327 27.34187349879904 28.56785428342674 20.636509207365894 70-74 22.952543051661994 28.193832599118945 28.66439727673208 20.189227072486986 75-79 23.052663195835002 27.973568281938327 28.439126952342814 20.53464156988386 80-84 22.254479927920713 27.835619181099208 28.956852537791573 20.953048353188507 85-89 23.70870870870871 27.312312312312315 28.598598598598603 20.38038038038038 90-94 22.887887887887885 28.128128128128125 28.453453453453452 20.53053053053053 95-99 23.71490064567796 28.094499224185395 27.78917863756945 20.401421492567195 100-104 23.579758746684018 28.660093097752643 27.929325792081688 19.830822363481655 105-109 23.707522146038738 28.09168710274761 28.492067464090887 19.70872328712277 110-114 23.369538014915662 28.214625356624456 28.359777766654986 20.056058861804896 115-119 24.227397946406214 28.329576759328823 27.417981467568243 20.02504382669672 120-124 24.250012520659087 27.66064005609255 28.261631692292283 19.82771573095608 125-129 23.60951188986233 28.47058823529412 28.315394242803503 19.604505632040052 130-134 24.58089375969574 28.464194565380573 27.96877345743882 18.986138217484864 135-139 24.723542656992745 28.57142857142857 27.860895671753816 18.84413309982487 140-144 24.936208535548108 27.798068744684045 27.948166308100262 19.31755641166758 145-149 25.135108086469177 28.032425940752603 27.456965572457964 19.375500400320256 150-151 25.63461297986745 27.072652244591723 28.160560210078778 19.132174565462048 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 1.5 26 4.0 27 6.5 28 10.5 29 11.5 30 15.5 31 22.0 32 33.5 33 45.5 34 63.0 35 73.5 36 84.5 37 111.5 38 150.0 39 179.5 40 208.0 41 245.5 42 266.5 43 280.5 44 299.5 45 289.0 46 254.0 47 239.0 48 227.5 49 192.0 50 153.5 51 128.5 52 97.0 53 76.0 54 59.0 55 44.0 56 33.0 57 22.0 58 15.5 59 14.5 60 10.0 61 6.0 62 6.0 63 3.0 64 1.0 65 2.0 66 3.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.065 25-29 0.09 30-34 0.09 35-39 0.08499999999999999 40-44 0.06999999999999999 45-49 0.09 50-54 0.105 55-59 0.09 60-64 0.09 65-69 0.08 70-74 0.12 75-79 0.12 80-84 0.11 85-89 0.1 90-94 0.1 95-99 0.105 100-104 0.105 105-109 0.095 110-114 0.105 115-119 0.17500000000000002 120-124 0.165 125-129 0.125 130-134 0.08499999999999999 135-139 0.075 140-144 0.065 145-149 0.08 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 7.025 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869580 spots for SRR7166178.sra Written 869580 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra Read 869571 spots for SRR7166178.sra Written 869571 spots for SRR7166178.sra SRR ids: ['SRR7166178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qg4a8m99 SRR7166178.sra spots: 17391429 blocks: [[1, 869571], [869572, 1739142], [1739143, 2608713], [2608714, 3478284], [3478285, 4347855], [4347856, 5217426], [5217427, 6086997], [6086998, 6956568], [6956569, 7826139], [7826140, 8695710], [8695711, 9565281], [9565282, 10434852], [10434853, 11304423], [11304424, 12173994], [12173995, 13043565], [13043566, 13913136], [13913137, 14782707], [14782708, 15652278], [15652279, 16521849], [16521850, 17391429]] SRR7166178 file size 5871684 SRR7166178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166178 SRR7166178_1.fastq SRR7166178_2.fastq Input file: SRR7166178_1.fastq Paired file: SRR7166178_2.fastq trimmed: SRR7166178-trimmed-pair1.fastq, SRR7166178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:29:54 2025 >> started Fri Feb 14 20:30:21 2025 >> done (27.259s) 17391429 read pairs processed; of these: 10406 ( 0.06%) short read pairs filtered out after trimming by size control 8022 ( 0.05%) empty read pairs filtered out after trimming by size control 17373001 (99.89%) read pairs available; of these: 7734406 (44.52%) trimmed read pairs available after processing 9638595 (55.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 3 0.00% 30 7 0.00% 31 2 0.00% 32 2 0.00% 33 7 0.00% 34 5 0.00% 35 12 0.00% 36 15 0.00% 37 5 0.00% 38 8 0.00% 39 9 0.00% 40 8 0.00% 41 10 0.00% 42 14 0.00% 43 13 0.00% 44 22 0.00% 45 26 0.00% 46 23 0.00% 47 26 0.00% 48 40 0.00% 49 29 0.00% 50 45 0.00% 51 51 0.00% 52 45 0.00% 53 56 0.00% 54 85 0.00% 55 77 0.00% 56 95 0.00% 57 101 0.00% 58 110 0.00% 59 122 0.00% 60 127 0.00% 61 166 0.00% 62 185 0.00% 63 208 0.00% 64 251 0.00% 65 284 0.00% 66 309 0.00% 67 371 0.00% 68 459 0.00% 69 443 0.00% 70 544 0.00% 71 632 0.00% 72 700 0.00% 73 827 0.00% 74 901 0.01% 75 1071 0.01% 76 1191 0.01% 77 1358 0.01% 78 1451 0.01% 79 1697 0.01% 80 1874 0.01% 81 2266 0.01% 82 2640 0.02% 83 3143 0.02% 84 4113 0.02% 85 4284 0.02% 86 4502 0.03% 87 4987 0.03% 88 5430 0.03% 89 6012 0.03% 90 6568 0.04% 91 7288 0.04% 92 7807 0.04% 93 8822 0.05% 94 9474 0.05% 95 9928 0.06% 96 10847 0.06% 97 11581 0.07% 98 12599 0.07% 99 13915 0.08% 100 14095 0.08% 101 15164 0.09% 102 16273 0.09% 103 17444 0.10% 104 18516 0.11% 105 19792 0.11% 106 20917 0.12% 107 21489 0.12% 108 22674 0.13% 109 24129 0.14% 110 25107 0.14% 111 26684 0.15% 112 28051 0.16% 113 29945 0.17% 114 31479 0.18% 115 33407 0.19% 116 34271 0.20% 117 35568 0.20% 118 36940 0.21% 119 38611 0.22% 120 40050 0.23% 121 41628 0.24% 122 43169 0.25% 123 45107 0.26% 124 47676 0.27% 125 49301 0.28% 126 51567 0.30% 127 53257 0.31% 128 54764 0.32% 129 56829 0.33% 130 59521 0.34% 131 61008 0.35% 132 64103 0.37% 133 68186 0.39% 134 70597 0.41% 135 74286 0.43% 136 78129 0.45% 137 81517 0.47% 138 85958 0.49% 139 91269 0.53% 140 96321 0.55% 141 104214 0.60% 142 114205 0.66% 143 124854 0.72% 144 142172 0.82% 145 167357 0.96% 146 203939 1.17% 147 264809 1.52% 148 390362 2.25% 149 732750 4.22% 150 3512582 20.22% 151 9638595 55.48% 17373001 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=18 prefix-density=0.37 prefix-fanout=3.0 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=25.62 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=ACCACAAGTTACAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=36 prefix-density=0.54 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=122.29 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.9 sequence=AGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAG SRR7166178 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:31:18 Started mapping on | Feb 14 20:31:18 Finished on | Feb 14 20:33:42 Mapping speed, Million of reads per hour | 434.33 Number of input reads | 17373001 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16554378 Uniquely mapped reads % | 95.29% Average mapped length | 293.52 Number of splices: Total | 15579811 Number of splices: Annotated (sjdb) | 15240535 Number of splices: GT/AG | 15317340 Number of splices: GC/AG | 200433 Number of splices: AT/AC | 13305 Number of splices: Non-canonical | 48733 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402343 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 33309 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425052 425052 425052 N_multimapping 402343 402343 402343 N_noFeature 636852 16351628 742398 N_ambiguous 187668 1039 90009 UnstrandedReadsAssigned:15729858 PositiveStrandReadsAssigned:201711 NegativeStrandReadsAssigned:15721971 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166178-trimmed-pair1.fastq SRR7166178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,373,001 reads, 15,594,675 reads pseudoaligned [quant] estimated average fragment length: 238.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7166178.ke.tsv 34699 SRR7166178.se.tsv 87100 total ==> SRR7166178.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.08 1076 37.8418 Potri.005G024800.1.v4.1 1035 797.084 221 17.3576 Potri.004G059700.1.v4.1 961 723.124 35 3.03009 Potri.007G009000.2.v4.1 1416 1178.08 0 0 Potri.003G141000.2.v4.1 2943 2705.08 712.189 16.4822 Potri.016G087400.1.v4.1 270 84.8659 1177 868.248 Potri.015G069301.1.v4.1 564 332.5 0 0 Potri.010G195200.1.v4.1 1773 1535.08 259 10.5625 Potri.012G127500.1.v4.1 977 739.114 12877 1090.7 ==> SRR7166178.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 336 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 552 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 186 SRR7166178 completed mapping pipeline successfully