Starting /dee2/code/volunteer_pipeline.sh SRR7166179 current disk space = 3108255891456 free memory = 1574712604 SRR7166179 SRAfilesize 33e83f300e373768c4e2f6598682c9a3 SRR7166179.sra SRR7166179.sra file validated SRR7166179 is paired end SRR7166179 is conventional basespace SRR7166179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9845 32.0 18.0 33.0 18.0 33.0 2 28.0715 29.0 27.0 31.0 18.0 33.0 3 29.5215 31.0 29.0 33.0 25.0 33.0 4 31.8875 33.0 31.0 33.0 29.0 33.0 5 32.2365 33.0 32.0 33.0 32.0 33.0 6 35.88575 37.0 36.0 38.0 33.0 38.0 7 37.307 38.0 38.0 38.0 36.0 38.0 8 37.5085 38.0 38.0 38.0 37.0 38.0 9 37.61475 38.0 38.0 38.0 38.0 38.0 10-14 37.5954 38.0 38.0 38.0 38.0 38.0 15-19 37.6169 38.0 38.0 38.0 38.0 38.0 20-24 37.61364999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.589600000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.55745 38.0 38.0 38.0 38.0 38.0 35-39 37.563599999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.54775 38.0 38.0 38.0 38.0 38.0 45-49 37.49315 38.0 38.0 38.0 37.6 38.0 50-54 37.18995 38.0 38.0 38.0 37.4 38.0 55-59 36.763999999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0019 38.0 38.0 38.0 36.4 38.0 65-69 37.22065 38.0 38.0 38.0 36.6 38.0 70-74 37.100049999999996 38.0 38.0 38.0 36.2 38.0 75-79 37.0949 38.0 38.0 38.0 36.0 38.0 80-84 37.0072 38.0 38.0 38.0 36.0 38.0 85-89 36.945 38.0 38.0 38.0 36.0 38.0 90-94 36.89525 38.0 38.0 38.0 35.4 38.0 95-99 36.752500000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.60865 38.0 38.0 38.0 34.6 38.0 105-109 36.1991 38.0 38.0 38.0 33.8 38.0 110-114 36.42805 38.0 38.0 38.0 34.0 38.0 115-119 36.29265 38.0 37.8 38.0 34.0 38.0 120-124 36.17545 38.0 37.2 38.0 33.4 38.0 125-129 35.892 38.0 37.0 38.0 32.6 38.0 130-134 35.80565 38.0 36.6 38.0 32.6 38.0 135-139 35.4796 38.0 36.0 38.0 31.0 38.0 140-144 35.27445 38.0 36.0 38.0 30.4 38.0 145-149 34.78465 38.0 35.6 38.0 28.8 38.0 150-151 31.69375 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 4.0 22 2.0 23 6.0 24 4.0 25 6.0 26 14.0 27 15.0 28 30.0 29 33.0 30 23.0 31 43.0 32 72.0 33 87.0 34 138.0 35 252.0 36 705.0 37 2555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.97158802638255 20.573313039066463 11.161846778285135 32.29325215626586 2 20.075000000000003 28.675 33.25 18.0 3 16.45 34.925 25.124999999999996 23.5 4 20.125 39.125 21.65 19.1 5 19.41941941941942 37.712712712712715 24.14914914914915 18.71871871871872 6 14.725 38.25 24.349999999999998 22.675 7 12.1 19.725 46.150000000000006 22.025 8 17.05 21.325 28.975 32.65 9 17.025000000000002 23.3 30.15 29.525000000000002 10-14 19.545 30.669999999999998 25.955000000000002 23.830000000000002 15-19 19.23 30.3 27.12 23.35 20-24 19.665 29.770000000000003 27.744999999999997 22.82 25-29 19.415 29.955 27.725 22.905 30-34 19.645000000000003 30.225 27.38 22.75 35-39 19.79 29.375 27.515 23.32 40-44 19.63 29.805 27.355 23.21 45-49 19.689999999999998 30.04 27.029999999999998 23.24 50-54 20.04632660254796 29.301576111586687 27.569364016315024 23.082733269550328 55-59 19.598295800365186 30.087238790829783 27.08967336173666 23.22479204706837 60-64 19.4575827714602 29.566267485156484 27.12086142699004 23.855288316393278 65-69 19.541954195419542 29.227922792279227 28.18781878187819 23.042304230423042 70-74 20.120060030015008 29.839919959979987 27.063531765882942 22.976488244122063 75-79 19.376937693769378 29.102910291029104 27.87778777877788 23.642364236423642 80-84 19.830000000000002 28.655 27.900000000000002 23.615 85-89 20.135 29.310000000000002 27.74 22.814999999999998 90-94 20.09 29.535 27.115000000000002 23.26 95-99 20.028004200630097 29.6894534180127 27.269090363554533 23.01345201780267 100-104 19.971941076260148 30.14330093195711 26.635935464475395 23.248822527307343 105-109 20.875522643695533 29.94811344516649 26.431917787517 22.744446123620975 110-114 20.672067206720673 29.907990799079908 26.34263426342634 23.07730773077308 115-119 20.80473016986521 29.603647842862152 26.196322092498875 23.395299894773764 120-124 20.668100215032254 28.95934390158524 27.284092613892085 23.088463269490422 125-129 20.349594310327557 28.793949714514678 27.321446458980265 23.535009516177503 130-134 20.87208720872087 29.05290529052905 26.632663266326634 23.442344234423445 135-139 20.977097709770977 28.28782878287829 26.647664766476648 24.087408740874086 140-144 21.007100710071008 28.83288328832883 26.472647264726472 23.687368736873687 145-149 20.80312046807021 29.024353653047957 26.50397559633945 23.66855028254238 150-151 20.826032540675847 29.39924906132666 26.44555694618273 23.329161451814766 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 1.5 21 1.0 22 1.5 23 2.5 24 6.0 25 8.5 26 10.5 27 16.5 28 20.0 29 22.5 30 31.0 31 33.5 32 48.0 33 61.5 34 81.0 35 102.5 36 113.5 37 145.0 38 157.0 39 168.5 40 205.0 41 215.5 42 236.5 43 268.5 44 264.0 45 252.0 46 240.0 47 236.5 48 214.0 49 175.5 50 145.0 51 118.5 52 91.5 53 70.5 54 69.0 55 48.0 56 29.0 57 26.5 58 16.5 59 13.5 60 11.0 61 5.0 62 2.0 63 3.0 64 3.0 65 1.0 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.705 55-59 1.4200000000000002 60-64 0.63 65-69 0.01 70-74 0.05 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.21 105-109 0.745 110-114 0.01 115-119 0.215 120-124 0.015 125-129 0.16999999999999998 130-134 0.01 135-139 0.01 140-144 0.01 145-149 0.015 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.5 0.0 0.0 0.0 0.0 96-97 1.7000000000000002 0.0 0.0 0.0 0.0 98-99 2.0 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.45 0.0 0.0 0.0 0.0 108-109 3.9499999999999997 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 5.0875 0.0 0.0 0.0 0.0 114-115 5.550000000000001 0.0 0.0 0.0 0.0 116-117 6.0125 0.0 0.0 0.0 0.0 118-119 6.75 0.0 0.0 0.0 0.0 120-121 7.3625 0.0 0.0 0.0 0.0 122-123 8.1 0.0 0.0 0.0 0.0 124-125 8.787500000000001 0.0 0.0 0.0 0.0 126-127 9.337499999999999 0.0 0.0 0.0 0.0 128-129 9.899999999999999 0.0 0.0 0.0 0.0 130-131 10.725 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.0 0.0 0.0 0.0 0.0 136-137 12.725 0.0 0.0 0.0 0.0 138-139 13.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7795 33.0 33.0 34.0 32.0 34.0 2 32.896 33.0 33.0 34.0 32.0 34.0 3 32.9865 33.0 33.0 34.0 32.0 34.0 4 32.93975 33.0 33.0 34.0 32.0 34.0 5 33.002 33.0 33.0 34.0 32.0 34.0 6 37.29875 38.0 38.0 38.0 37.0 38.0 7 37.20975 38.0 38.0 38.0 37.0 38.0 8 37.1965 38.0 38.0 38.0 37.0 38.0 9 37.20675 38.0 38.0 38.0 37.0 38.0 10-14 37.165000000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.14295 38.0 38.0 38.0 36.0 38.0 20-24 37.09205 38.0 38.0 38.0 36.0 38.0 25-29 37.00915 38.0 38.0 38.0 36.0 38.0 30-34 36.9591 38.0 38.0 38.0 36.0 38.0 35-39 36.8236 38.0 38.0 38.0 35.4 38.0 40-44 36.74565 38.0 38.0 38.0 35.0 38.0 45-49 36.63465 38.0 38.0 38.0 34.6 38.0 50-54 36.428700000000006 38.0 38.0 38.0 34.0 38.0 55-59 36.30555 38.0 37.4 38.0 33.4 38.0 60-64 36.3555 38.0 37.8 38.0 34.0 38.0 65-69 36.272149999999996 38.0 37.2 38.0 33.2 38.0 70-74 36.1027 38.0 37.0 38.0 33.0 38.0 75-79 35.902649999999994 38.0 37.0 38.0 31.0 38.0 80-84 35.787099999999995 38.0 37.0 38.0 31.0 38.0 85-89 35.611749999999994 38.0 36.8 38.0 29.6 38.0 90-94 35.3053 38.0 36.0 38.0 29.0 38.0 95-99 35.03595 38.0 36.0 38.0 27.8 38.0 100-104 34.802949999999996 38.0 35.2 38.0 26.2 38.0 105-109 34.51129999999999 38.0 35.0 38.0 25.8 38.0 110-114 34.03815 38.0 34.0 38.0 22.6 38.0 115-119 33.54495 38.0 34.0 38.0 17.4 38.0 120-124 33.2432 38.0 33.8 38.0 15.0 38.0 125-129 32.710350000000005 37.4 32.6 38.0 15.0 38.0 130-134 31.89115 36.4 31.0 38.0 14.4 38.0 135-139 31.11625 36.0 29.2 38.0 13.6 38.0 140-144 30.022700000000004 35.4 26.2 38.0 8.6 38.0 145-149 28.16635 34.6 20.6 38.0 2.0 38.0 150-151 23.125625 30.5 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 5.0 8 0.0 9 3.0 10 0.0 11 0.0 12 2.0 13 3.0 14 4.0 15 2.0 16 6.0 17 4.0 18 4.0 19 6.0 20 9.0 21 20.0 22 17.0 23 23.0 24 27.0 25 24.0 26 49.0 27 39.0 28 72.0 29 52.0 30 102.0 31 123.0 32 156.0 33 233.0 34 354.0 35 495.0 36 947.0 37 1216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 16.025 13.925 28.749999999999996 2 23.0 23.775 35.3 17.925 3 19.675 26.05 33.15 21.125 4 24.75 36.075 20.200000000000003 18.975 5 23.125 37.375 21.625 17.875 6 18.575 36.85 24.575 20.0 7 15.5 16.3 46.7 21.5 8 20.625 22.0 28.725 28.65 9 21.875 23.375 29.275000000000002 25.474999999999998 10-14 23.005 28.499999999999996 26.68 21.815 15-19 22.735 27.36 29.035 20.87 20-24 22.88 27.860000000000003 28.395 20.865000000000002 25-29 22.445 27.705000000000002 29.154999999999998 20.695 30-34 23.14 27.82 28.815 20.225 35-39 22.915 27.66 28.694999999999997 20.73 40-44 22.68 27.38 29.054999999999996 20.885 45-49 23.0 27.965 28.544999999999998 20.49 50-54 23.135 27.500000000000004 29.13 20.235 55-59 23.125 27.134999999999998 29.065 20.674999999999997 60-64 22.31 27.705000000000002 29.73 20.255000000000003 65-69 22.48 27.615000000000002 29.294999999999998 20.61 70-74 23.244999999999997 28.235 28.139999999999997 20.380000000000003 75-79 23.525 27.224999999999998 29.244999999999997 20.005 80-84 23.015 27.975 29.265 19.744999999999997 85-89 23.085 27.455000000000002 28.884999999999998 20.575 90-94 23.115 27.67 28.9 20.315 95-99 23.39 27.785 28.634999999999998 20.19 100-104 23.43 27.815 28.77 19.985 105-109 24.0 28.084999999999997 28.115000000000002 19.8 110-114 24.165 27.85 28.395 19.59 115-119 24.015 27.694999999999997 28.48 19.81 120-124 24.095 27.950000000000003 28.285 19.67 125-129 24.18 28.155 28.575 19.09 130-134 25.47 27.200000000000003 28.285 19.045 135-139 25.19 27.58 28.060000000000002 19.17 140-144 25.535000000000004 27.82 27.615000000000002 19.03 145-149 25.885 27.6 27.13 19.384999999999998 150-151 26.550775387693847 26.588294147073537 27.63881940970485 19.222111055527762 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 3.5 26 5.0 27 8.0 28 10.0 29 8.0 30 12.5 31 25.0 32 32.0 33 40.5 34 59.0 35 80.0 36 102.5 37 118.0 38 142.5 39 176.5 40 210.5 41 235.5 42 256.5 43 269.0 44 274.0 45 284.5 46 281.5 47 255.0 48 224.0 49 183.0 50 150.0 51 138.0 52 106.0 53 74.5 54 57.0 55 43.0 56 36.0 57 27.5 58 16.0 59 12.0 60 9.0 61 6.5 62 3.0 63 2.5 64 3.0 65 1.5 66 2.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.2007024586051179 0.4 3 0.0 0.0 4 0.050175614651279475 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.325 0.0 0.0 0.0 0.0 94-95 1.4874999999999998 0.0 0.0 0.0 0.0 96-97 1.7000000000000002 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.25 0.0 0.0 0.0 0.0 102-103 2.6 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.3499999999999996 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.4 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.324999999999999 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.425000000000001 0.0 0.0 0.0 0.0 120-121 7.012499999999999 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.3 0.0 0.0 0.0 0.0 126-127 8.837499999999999 0.0 0.0 0.0 0.0 128-129 9.325 0.0 0.0 0.0 0.0 130-131 10.0125 0.0 0.0 0.0 0.0 132-133 10.625 0.0 0.0 0.0 0.0 134-135 11.1625 0.0 0.0 0.0 0.0 136-137 11.7625 0.0 0.0 0.0 0.0 138-139 12.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATCCG 10 0.006830828 145.0 145 >>END_MODULE Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725460 spots for SRR7166179.sra Written 725460 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra Read 725450 spots for SRR7166179.sra Written 725450 spots for SRR7166179.sra SRR ids: ['SRR7166179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_phf5yhut SRR7166179.sra spots: 14509010 blocks: [[1, 725450], [725451, 1450900], [1450901, 2176350], [2176351, 2901800], [2901801, 3627250], [3627251, 4352700], [4352701, 5078150], [5078151, 5803600], [5803601, 6529050], [6529051, 7254500], [7254501, 7979950], [7979951, 8705400], [8705401, 9430850], [9430851, 10156300], [10156301, 10881750], [10881751, 11607200], [11607201, 12332650], [12332651, 13058100], [13058101, 13783550], [13783551, 14509010]] SRR7166179 file size 4894927 SRR7166179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166179 SRR7166179_1.fastq SRR7166179_2.fastq Input file: SRR7166179_1.fastq Paired file: SRR7166179_2.fastq trimmed: SRR7166179-trimmed-pair1.fastq, SRR7166179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:54:45 2025 >> started Fri Feb 14 21:55:02 2025 >> done (16.787s) 14509010 read pairs processed; of these: 7863 ( 0.05%) short read pairs filtered out after trimming by size control 7790 ( 0.05%) empty read pairs filtered out after trimming by size control 14493357 (99.89%) read pairs available; of these: 7064527 (48.74%) trimmed read pairs available after processing 7428830 (51.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 5 0.00% 21 8 0.00% 22 6 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 4 0.00% 31 8 0.00% 32 13 0.00% 33 5 0.00% 34 8 0.00% 35 8 0.00% 36 14 0.00% 37 8 0.00% 38 20 0.00% 39 21 0.00% 40 25 0.00% 41 25 0.00% 42 22 0.00% 43 34 0.00% 44 39 0.00% 45 64 0.00% 46 67 0.00% 47 76 0.00% 48 70 0.00% 49 110 0.00% 50 126 0.00% 51 119 0.00% 52 160 0.00% 53 165 0.00% 54 182 0.00% 55 192 0.00% 56 230 0.00% 57 269 0.00% 58 328 0.00% 59 385 0.00% 60 407 0.00% 61 517 0.00% 62 526 0.00% 63 615 0.00% 64 688 0.00% 65 760 0.01% 66 856 0.01% 67 1021 0.01% 68 1201 0.01% 69 1399 0.01% 70 1544 0.01% 71 1929 0.01% 72 2194 0.02% 73 2441 0.02% 74 2817 0.02% 75 3036 0.02% 76 3407 0.02% 77 3727 0.03% 78 4233 0.03% 79 4541 0.03% 80 5207 0.04% 81 5971 0.04% 82 6943 0.05% 83 7891 0.05% 84 8863 0.06% 85 9765 0.07% 86 10369 0.07% 87 11160 0.08% 88 12147 0.08% 89 12895 0.09% 90 13994 0.10% 91 15169 0.10% 92 17123 0.12% 93 18313 0.13% 94 19649 0.14% 95 20747 0.14% 96 21593 0.15% 97 22659 0.16% 98 23450 0.16% 99 24817 0.17% 100 25554 0.18% 101 27544 0.19% 102 29398 0.20% 103 31133 0.21% 104 32284 0.22% 105 33735 0.23% 106 34869 0.24% 107 35029 0.24% 108 36056 0.25% 109 36970 0.26% 110 37792 0.26% 111 39862 0.28% 112 41923 0.29% 113 44072 0.30% 114 46159 0.32% 115 47787 0.33% 116 48078 0.33% 117 48836 0.34% 118 49691 0.34% 119 49538 0.34% 120 50478 0.35% 121 52631 0.36% 122 54361 0.38% 123 56334 0.39% 124 59256 0.41% 125 60329 0.42% 126 61982 0.43% 127 61530 0.42% 128 62586 0.43% 129 63939 0.44% 130 64886 0.45% 131 66506 0.46% 132 69307 0.48% 133 72561 0.50% 134 75376 0.52% 135 77999 0.54% 136 80141 0.55% 137 83197 0.57% 138 85695 0.59% 139 88887 0.61% 140 92544 0.64% 141 98215 0.68% 142 106125 0.73% 143 115045 0.79% 144 128142 0.88% 145 147384 1.02% 146 174197 1.20% 147 222031 1.53% 148 314006 2.17% 149 567063 3.91% 150 2646046 18.26% 151 7428830 51.26% 14493357 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=48.72 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=7.2 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=35 prefix-density=0.51 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=62.23 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.8 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166179 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:56:13 Started mapping on | Feb 14 21:56:13 Finished on | Feb 14 21:58:19 Mapping speed, Million of reads per hour | 414.10 Number of input reads | 14493357 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13466355 Uniquely mapped reads % | 92.91% Average mapped length | 288.76 Number of splices: Total | 12450763 Number of splices: Annotated (sjdb) | 12184592 Number of splices: GT/AG | 12243740 Number of splices: GC/AG | 156904 Number of splices: AT/AC | 11146 Number of splices: Non-canonical | 38973 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367051 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 57536 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667805 667805 667805 N_multimapping 367051 367051 367051 N_noFeature 480108 13282418 586813 N_ambiguous 143640 1077 65692 UnstrandedReadsAssigned:12842607 PositiveStrandReadsAssigned:182860 NegativeStrandReadsAssigned:12813850 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7166179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166179-trimmed-pair1.fastq SRR7166179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,493,357 reads, 12,761,622 reads pseudoaligned [quant] estimated average fragment length: 216.011 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7166179.ke.tsv 34699 SRR7166179.se.tsv 87100 total ==> SRR7166179.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.99 943 38.9264 Potri.005G024800.1.v4.1 1035 819.989 275 24.9603 Potri.004G059700.1.v4.1 961 746.032 24 2.39431 Potri.007G009000.2.v4.1 1416 1200.99 0 0 Potri.003G141000.2.v4.1 2943 2727.99 465 12.6863 Potri.016G087400.1.v4.1 270 96.6141 763 587.774 Potri.015G069301.1.v4.1 564 352.949 0 0 Potri.010G195200.1.v4.1 1773 1557.99 360.863 17.2387 Potri.012G127500.1.v4.1 977 762.004 5467 533.971 ==> SRR7166179.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 680 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 322 SRR7166179 completed mapping pipeline successfully