Starting /dee2/code/volunteer_pipeline.sh SRR7166180 current disk space = 3109684887552 free memory = 1363047124 SRR7166180 SRAfilesize be5b17c1bc253cfc13793fecbf908d13 SRR7166180.sra SRR7166180.sra file validated SRR7166180 is paired end SRR7166180 is conventional basespace SRR7166180 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166180_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.35875 33.0 25.0 33.0 18.0 33.0 2 27.819 29.0 27.0 31.0 18.0 33.0 3 29.386 31.0 29.0 33.0 25.0 33.0 4 31.8085 33.0 31.0 33.0 29.0 33.0 5 32.3645 33.0 33.0 33.0 32.0 34.0 6 36.832 38.0 37.0 38.0 34.0 38.0 7 37.2965 38.0 38.0 38.0 36.0 38.0 8 37.468 38.0 38.0 38.0 37.0 38.0 9 37.6255 38.0 38.0 38.0 38.0 38.0 10-14 37.612350000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.5975 38.0 38.0 38.0 38.0 38.0 20-24 37.6297 38.0 38.0 38.0 38.0 38.0 25-29 37.589650000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.534800000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5357 38.0 38.0 38.0 38.0 38.0 40-44 37.49589999999999 38.0 38.0 38.0 37.8 38.0 45-49 37.481700000000004 38.0 38.0 38.0 37.4 38.0 50-54 37.15065 38.0 38.0 38.0 37.2 38.0 55-59 36.84635 38.0 38.0 38.0 36.6 38.0 60-64 36.971399999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.20275 38.0 38.0 38.0 36.4 38.0 70-74 37.0981 38.0 38.0 38.0 36.4 38.0 75-79 37.068549999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.045 38.0 38.0 38.0 36.0 38.0 85-89 36.8823 38.0 38.0 38.0 35.8 38.0 90-94 36.77565 38.0 38.0 38.0 35.2 38.0 95-99 36.67719999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.4792 38.0 38.0 38.0 34.6 38.0 105-109 36.1942 38.0 38.0 38.0 34.0 38.0 110-114 36.327099999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.20074999999999 38.0 38.0 38.0 33.8 38.0 120-124 36.03995 38.0 37.0 38.0 33.2 38.0 125-129 35.7889 38.0 37.2 38.0 31.8 38.0 130-134 35.7411 38.0 36.8 38.0 32.2 38.0 135-139 35.4696 38.0 36.0 38.0 31.0 38.0 140-144 35.267100000000006 38.0 36.0 38.0 31.0 38.0 145-149 34.8351 38.0 35.8 38.0 30.0 38.0 150-151 31.394750000000002 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 1.0 16 2.0 17 3.0 18 5.0 19 2.0 20 1.0 21 4.0 22 5.0 23 3.0 24 7.0 25 6.0 26 7.0 27 19.0 28 20.0 29 24.0 30 37.0 31 61.0 32 52.0 33 92.0 34 133.0 35 239.0 36 682.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.10939478348949 19.32134717650038 14.180805267156243 34.38845277285389 2 21.675 27.175 34.975 16.175 3 16.725 35.675000000000004 22.775000000000002 24.825 4 20.025000000000002 39.875 19.2 20.9 5 20.175438596491226 40.17543859649123 22.18045112781955 17.468671679197996 6 15.8 39.725 24.875 19.6 7 11.825 22.825 44.9 20.45 8 17.5 22.6 28.849999999999998 31.05 9 17.8 23.05 32.574999999999996 26.575 10-14 18.825 32.53 25.72 22.925 15-19 19.17 30.56 27.42 22.85 20-24 19.145 31.324999999999996 26.8 22.73 25-29 19.17 31.405 27.105 22.32 30-34 18.845 30.79 27.529999999999998 22.835 35-39 19.56 30.855 27.185 22.400000000000002 40-44 19.45 30.955 27.279999999999998 22.314999999999998 45-49 19.220000000000002 30.485 26.875 23.419999999999998 50-54 19.05433304798832 31.255350219044264 27.020494486127195 22.669822246840223 55-59 19.265078560567662 30.734921439432338 27.22250380131779 22.777496198682208 60-64 18.492598932635183 30.470244688349613 27.9125969187393 23.124559460275904 65-69 19.38081424427328 30.62918875662699 26.76803040912274 23.221966589976994 70-74 19.002101891702534 30.807726954258836 27.519767791011912 22.670403363026725 75-79 19.36080824247274 30.374112233670104 26.928078423527058 23.3370011003301 80-84 19.310965548277416 29.94149707485374 27.641382069103454 23.106155307765388 85-89 19.415970798539927 30.106505325266262 27.426371318565927 23.051152557627884 90-94 20.05 29.360000000000003 27.91 22.68 95-99 19.825947784335302 30.544163248974694 27.193157947384215 22.436731019305793 100-104 19.80942828485456 29.96990972918756 27.246740220661987 22.973921765295888 105-109 19.63286096121842 30.611730294013817 27.031116042160473 22.724292702607293 110-114 19.918963533590116 29.128107648441798 27.85753589115102 23.09539292681707 115-119 20.353006067291783 29.70465827608685 26.691069548212404 23.251266108408966 120-124 20.118047218887554 29.566826730692274 27.355942376950782 22.95918367346939 125-129 20.252530313658685 29.637238200220462 27.22717707185089 22.883054414269967 130-134 20.777272045215824 28.87510628720052 26.829390286600308 23.518231380983345 135-139 20.673100965144773 29.00435065259789 26.53898084712707 23.78356753513027 140-144 20.29905981196239 28.700740148029606 27.145429085817163 23.854770954190837 145-149 20.409184132859785 29.658346255815115 26.36686508929018 23.565604522034917 150-151 21.18516662490604 28.877474317213732 26.534703081934353 23.402655975945876 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.5 21 2.0 22 3.5 23 5.5 24 5.0 25 7.0 26 11.5 27 13.5 28 22.0 29 35.0 30 39.5 31 49.0 32 65.0 33 80.5 34 103.0 35 122.5 36 135.5 37 159.0 38 189.0 39 201.5 40 220.0 41 231.0 42 236.0 43 248.5 44 238.5 45 228.5 46 226.5 47 205.0 48 175.5 49 154.5 50 139.0 51 114.0 52 82.5 53 64.0 54 49.0 55 35.0 56 24.0 57 15.0 58 11.0 59 11.5 60 10.5 61 6.5 62 3.0 63 4.0 64 4.0 65 2.0 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.705 55-59 1.35 60-64 0.69 65-69 0.03 70-74 0.09 75-79 0.03 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.03 100-104 0.3 105-109 0.855 110-114 0.045 115-119 0.28500000000000003 120-124 0.04 125-129 0.21 130-134 0.034999999999999996 135-139 0.015 140-144 0.02 145-149 0.045 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.5806614491290077 1.15 3 0.12623074981065388 0.375 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.47500000000000003 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.8375000000000004 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.262499999999999 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.25 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.4125 0.0 0.0 0.0 0.0 132-133 8.149999999999999 0.0 0.0 0.0 0.0 134-135 8.6125 0.0 0.0 0.0 0.0 136-137 9.125 0.0 0.0 0.0 0.0 138-139 9.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACAC 10 0.0069483654 144.175 3 >>END_MODULE SRR7166180 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166180_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79675 33.0 33.0 34.0 32.0 34.0 2 32.90375 33.0 33.0 34.0 32.0 34.0 3 33.0025 34.0 33.0 34.0 32.0 34.0 4 32.97875 33.0 33.0 34.0 32.0 34.0 5 32.99675 34.0 33.0 34.0 32.0 34.0 6 37.3125 38.0 38.0 38.0 37.0 38.0 7 37.27075 38.0 38.0 38.0 37.0 38.0 8 37.29175 38.0 38.0 38.0 37.0 38.0 9 37.16 38.0 38.0 38.0 37.0 38.0 10-14 37.18814999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.1641 38.0 38.0 38.0 36.2 38.0 20-24 37.1528 38.0 38.0 38.0 36.0 38.0 25-29 37.0702 38.0 38.0 38.0 36.0 38.0 30-34 36.98765 38.0 38.0 38.0 36.0 38.0 35-39 36.97115 38.0 38.0 38.0 36.0 38.0 40-44 36.9266 38.0 38.0 38.0 35.8 38.0 45-49 36.77455 38.0 38.0 38.0 35.0 38.0 50-54 36.532799999999995 38.0 38.0 38.0 34.2 38.0 55-59 36.4535 38.0 38.0 38.0 34.0 38.0 60-64 36.4377 38.0 37.8 38.0 34.0 38.0 65-69 36.4315 38.0 37.6 38.0 34.0 38.0 70-74 36.225049999999996 38.0 37.0 38.0 33.4 38.0 75-79 36.0289 38.0 37.0 38.0 32.2 38.0 80-84 35.90645 38.0 37.0 38.0 32.0 38.0 85-89 35.791399999999996 38.0 37.0 38.0 30.8 38.0 90-94 35.51745 38.0 36.2 38.0 29.0 38.0 95-99 35.29885 38.0 36.0 38.0 28.8 38.0 100-104 34.9787 38.0 35.8 38.0 28.0 38.0 105-109 34.6736 38.0 35.0 38.0 26.2 38.0 110-114 34.2933 38.0 34.4 38.0 23.8 38.0 115-119 33.90105 38.0 34.0 38.0 23.0 38.0 120-124 33.583749999999995 38.0 34.0 38.0 20.2 38.0 125-129 33.12155 37.8 33.6 38.0 16.2 38.0 130-134 32.25235 37.0 31.8 38.0 14.8 38.0 135-139 31.7584 36.2 31.0 38.0 14.0 38.0 140-144 30.354750000000003 35.6 27.2 38.0 13.0 38.0 145-149 28.819049999999997 34.6 23.2 38.0 2.0 38.0 150-151 24.12925 31.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 4.0 15 4.0 16 9.0 17 5.0 18 5.0 19 6.0 20 9.0 21 16.0 22 14.0 23 16.0 24 15.0 25 28.0 26 35.0 27 42.0 28 55.0 29 47.0 30 93.0 31 104.0 32 141.0 33 234.0 34 307.0 35 538.0 36 1050.0 37 1212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.8 15.75 16.575 30.875000000000004 2 24.9 23.35 35.65 16.1 3 21.825 26.3 31.55 20.325 4 24.975 34.875 22.125 18.025 5 25.174999999999997 35.949999999999996 21.4 17.474999999999998 6 18.175 37.875 23.974999999999998 19.975 7 15.975 15.2 45.550000000000004 23.275000000000002 8 21.349999999999998 21.9 27.875 28.875 9 24.15 23.75 28.325 23.775 10-14 23.075000000000003 29.255 26.795 20.875 15-19 23.415 27.54 28.725 20.32 20-24 23.645 28.310000000000002 27.860000000000003 20.185 25-29 23.16 28.705000000000002 28.13 20.005 30-34 22.759999999999998 28.025 29.025000000000002 20.19 35-39 23.11 28.185 28.599999999999998 20.105 40-44 22.81 27.675 29.304999999999996 20.21 45-49 22.56 28.000000000000004 28.994999999999997 20.445 50-54 22.81 27.105 29.89 20.195 55-59 22.869999999999997 27.255000000000003 29.270000000000003 20.605 60-64 22.88 27.900000000000002 29.145 20.075000000000003 65-69 23.225 27.83 29.28 19.665 70-74 23.244999999999997 27.425 29.195 20.135 75-79 22.62 28.395 28.71 20.275000000000002 80-84 23.805 27.875 28.360000000000003 19.96 85-89 23.765 27.395000000000003 29.32 19.52 90-94 23.93 27.389999999999997 28.835 19.845 95-99 23.745 27.67 28.825 19.759999999999998 100-104 23.51 27.6 28.965000000000003 19.925 105-109 23.75 27.815 28.73 19.705000000000002 110-114 24.055 28.244999999999997 28.765 18.935 115-119 23.52 27.584999999999997 29.134999999999998 19.759999999999998 120-124 23.599999999999998 27.794999999999998 28.754999999999995 19.85 125-129 24.03 27.400000000000002 29.299999999999997 19.27 130-134 24.58 27.450000000000003 28.78 19.189999999999998 135-139 24.545 27.375 28.965000000000003 19.115 140-144 25.055 27.665 28.310000000000002 18.970000000000002 145-149 25.405 27.474999999999998 28.360000000000003 18.759999999999998 150-151 26.032540675844807 26.933667083854818 27.684605757196497 19.349186483103882 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 3.5 27 6.5 28 9.5 29 16.5 30 22.5 31 28.5 32 36.5 33 50.5 34 68.0 35 81.5 36 98.5 37 122.5 38 151.5 39 184.5 40 203.5 41 226.5 42 247.5 43 265.5 44 281.0 45 267.0 46 248.0 47 242.5 48 222.5 49 177.0 50 159.0 51 141.5 52 111.0 53 88.0 54 63.5 55 41.5 56 30.5 57 28.5 58 19.0 59 12.0 60 8.5 61 6.0 62 5.0 63 3.0 64 1.5 65 2.0 66 1.5 67 0.5 68 1.5 69 1.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19110212335693 98.1 2 0.6572295247724975 1.3 3 0.05055611729019212 0.15 4 0.07583417593528817 0.3 5 0.0 0.0 6 0.02527805864509606 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.0375 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.775 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756390 spots for SRR7166180.sra Written 756390 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra Read 756385 spots for SRR7166180.sra Written 756385 spots for SRR7166180.sra SRR ids: ['SRR7166180.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ymbw329q SRR7166180.sra spots: 15127705 blocks: [[1, 756385], [756386, 1512770], [1512771, 2269155], [2269156, 3025540], [3025541, 3781925], [3781926, 4538310], [4538311, 5294695], [5294696, 6051080], [6051081, 6807465], [6807466, 7563850], [7563851, 8320235], [8320236, 9076620], [9076621, 9833005], [9833006, 10589390], [10589391, 11345775], [11345776, 12102160], [12102161, 12858545], [12858546, 13614930], [13614931, 14371315], [14371316, 15127705]] SRR7166180 file size 5104582 SRR7166180 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166180 SRR7166180_1.fastq SRR7166180_2.fastq Input file: SRR7166180_1.fastq Paired file: SRR7166180_2.fastq trimmed: SRR7166180-trimmed-pair1.fastq, SRR7166180-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:34:29 2025 >> started Fri Feb 14 20:35:13 2025 >> done (43.626s) 15127705 read pairs processed; of these: 5099 ( 0.03%) short read pairs filtered out after trimming by size control 4924 ( 0.03%) empty read pairs filtered out after trimming by size control 15117682 (99.93%) read pairs available; of these: 6856137 (45.35%) trimmed read pairs available after processing 8261545 (54.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 10 0.00% 31 4 0.00% 32 4 0.00% 33 7 0.00% 34 9 0.00% 35 8 0.00% 36 9 0.00% 37 8 0.00% 38 11 0.00% 39 5 0.00% 40 14 0.00% 41 11 0.00% 42 18 0.00% 43 7 0.00% 44 17 0.00% 45 18 0.00% 46 23 0.00% 47 32 0.00% 48 26 0.00% 49 27 0.00% 50 47 0.00% 51 56 0.00% 52 57 0.00% 53 67 0.00% 54 74 0.00% 55 95 0.00% 56 86 0.00% 57 123 0.00% 58 166 0.00% 59 152 0.00% 60 214 0.00% 61 256 0.00% 62 267 0.00% 63 311 0.00% 64 348 0.00% 65 390 0.00% 66 431 0.00% 67 533 0.00% 68 568 0.00% 69 761 0.01% 70 825 0.01% 71 935 0.01% 72 1016 0.01% 73 1261 0.01% 74 1410 0.01% 75 1629 0.01% 76 1867 0.01% 77 2026 0.01% 78 2270 0.02% 79 2703 0.02% 80 3007 0.02% 81 3342 0.02% 82 3832 0.03% 83 4302 0.03% 84 5019 0.03% 85 5664 0.04% 86 6269 0.04% 87 7119 0.05% 88 7659 0.05% 89 8262 0.05% 90 8983 0.06% 91 9824 0.06% 92 10785 0.07% 93 11580 0.08% 94 12703 0.08% 95 13477 0.09% 96 14480 0.10% 97 15340 0.10% 98 16623 0.11% 99 17746 0.12% 100 17981 0.12% 101 19298 0.13% 102 20664 0.14% 103 21629 0.14% 104 22625 0.15% 105 24197 0.16% 106 25251 0.17% 107 26326 0.17% 108 26815 0.18% 109 28455 0.19% 110 29375 0.19% 111 30839 0.20% 112 32552 0.22% 113 34846 0.23% 114 35602 0.24% 115 37285 0.25% 116 38678 0.26% 117 39387 0.26% 118 40536 0.27% 119 41647 0.28% 120 42689 0.28% 121 44342 0.29% 122 46412 0.31% 123 48424 0.32% 124 49190 0.33% 125 51283 0.34% 126 53020 0.35% 127 53745 0.36% 128 55391 0.37% 129 57456 0.38% 130 58932 0.39% 131 60752 0.40% 132 63101 0.42% 133 66274 0.44% 134 68132 0.45% 135 71103 0.47% 136 74133 0.49% 137 77111 0.51% 138 80256 0.53% 139 84874 0.56% 140 89339 0.59% 141 95200 0.63% 142 103178 0.68% 143 112120 0.74% 144 125133 0.83% 145 144974 0.96% 146 174628 1.16% 147 223052 1.48% 148 322401 2.13% 149 589963 3.90% 150 2868262 18.97% 151 8261545 54.65% 15117682 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=19 prefix-density=1.43 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=23 fanout-score=25.57 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=9.3 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTCGACCTCCAGAGTGATGGTCTT criterion=sequence-density sequence-density=1.29 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=24 prefix-density=1.31 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.19 sequence-density-rank=23 fanout-score=18.50 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=2.9 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7166180 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:36:54 Started mapping on | Feb 14 20:36:54 Finished on | Feb 14 20:40:30 Mapping speed, Million of reads per hour | 251.96 Number of input reads | 15117682 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13627958 Uniquely mapped reads % | 90.15% Average mapped length | 291.68 Number of splices: Total | 11764922 Number of splices: Annotated (sjdb) | 11513553 Number of splices: GT/AG | 11560121 Number of splices: GC/AG | 154855 Number of splices: AT/AC | 9510 Number of splices: Non-canonical | 40436 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.42 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408447 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 45129 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.77% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1087646 1087646 1087646 N_multimapping 408447 408447 408447 N_noFeature 436213 13445983 516398 N_ambiguous 173294 914 71075 UnstrandedReadsAssigned:13018451 PositiveStrandReadsAssigned:181061 NegativeStrandReadsAssigned:13040485 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166180 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166180-trimmed-pair1.fastq SRR7166180-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,117,682 reads, 12,928,711 reads pseudoaligned [quant] estimated average fragment length: 222.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7166180.ke.tsv 34699 SRR7166180.se.tsv 87100 total ==> SRR7166180.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.43 1242 41.8427 Potri.005G024800.1.v4.1 1035 813.427 239 17.7823 Potri.004G059700.1.v4.1 961 739.437 26 2.12804 Potri.007G009000.2.v4.1 1416 1194.43 0 0 Potri.003G141000.2.v4.1 2943 2721.43 563.278 12.5266 Potri.016G087400.1.v4.1 270 89.8138 1002 675.2 Potri.015G069301.1.v4.1 564 345.501 0 0 Potri.010G195200.1.v4.1 1773 1551.43 534 20.8314 Potri.012G127500.1.v4.1 977 755.437 3048 244.188 ==> SRR7166180.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 833 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 377 SRR7166180 completed mapping pipeline successfully