Starting /dee2/code/volunteer_pipeline.sh SRR7166181 current disk space = 3108260839424 free memory = 1574548904 SRR7166181 SRAfilesize 8c94830dc0d86a0158058c658b02bb46 SRR7166181.sra SRR7166181.sra file validated SRR7166181 is paired end SRR7166181 is conventional basespace SRR7166181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.23 32.0 30.0 33.0 18.0 33.0 2 32.228 33.0 32.0 33.0 31.0 34.0 3 31.5425 33.0 31.0 33.0 29.0 33.0 4 31.30875 33.0 31.0 33.0 29.0 33.0 5 32.499 33.0 33.0 33.0 32.0 33.0 6 36.85575 38.0 37.0 38.0 35.0 38.0 7 37.20125 38.0 38.0 38.0 36.0 38.0 8 37.32825 38.0 38.0 38.0 36.0 38.0 9 37.425 38.0 38.0 38.0 37.0 38.0 10-14 37.51225000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.50605 38.0 38.0 38.0 37.0 38.0 20-24 37.50165 38.0 38.0 38.0 37.2 38.0 25-29 37.46495 38.0 38.0 38.0 37.0 38.0 30-34 37.45905 38.0 38.0 38.0 37.0 38.0 35-39 37.42005 38.0 38.0 38.0 37.0 38.0 40-44 37.393899999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.39705 38.0 38.0 38.0 37.0 38.0 50-54 37.16029999999999 38.0 38.0 38.0 36.6 38.0 55-59 36.64515 38.0 38.0 38.0 36.0 38.0 60-64 36.9382 38.0 38.0 38.0 35.8 38.0 65-69 37.0848 38.0 38.0 38.0 36.0 38.0 70-74 37.1033 38.0 38.0 38.0 36.0 38.0 75-79 37.0251 38.0 38.0 38.0 36.0 38.0 80-84 36.9319 38.0 38.0 38.0 35.6 38.0 85-89 36.799099999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.6793 38.0 38.0 38.0 34.6 38.0 95-99 36.637299999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.5424 38.0 38.0 38.0 34.0 38.0 105-109 36.2964 38.0 38.0 38.0 34.0 38.0 110-114 36.2755 38.0 38.0 38.0 34.0 38.0 115-119 36.1058 38.0 37.4 38.0 33.4 38.0 120-124 35.96825 38.0 37.0 38.0 32.6 38.0 125-129 35.863800000000005 38.0 37.0 38.0 32.4 38.0 130-134 35.5775 38.0 36.0 38.0 31.0 38.0 135-139 35.3529 38.0 36.0 38.0 30.6 38.0 140-144 35.0445 38.0 36.0 38.0 28.4 38.0 145-149 34.7154 38.0 35.4 38.0 28.4 38.0 150-151 31.610500000000002 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 3.0 21 2.0 22 3.0 23 3.0 24 7.0 25 25.0 26 17.0 27 13.0 28 31.0 29 29.0 30 39.0 31 42.0 32 61.0 33 104.0 34 150.0 35 270.0 36 632.0 37 2559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.20990201134605 16.91593604951006 10.39195461578133 35.48220732336256 2 18.925 26.375 39.15 15.55 3 18.2 30.099999999999998 26.525 25.174999999999997 4 21.85 36.75 22.0 19.400000000000002 5 20.730182545636406 38.284571142785694 23.280820205051263 17.704426106526633 6 16.25 35.699999999999996 25.825 22.225 7 12.825000000000001 19.525000000000002 45.725 21.925 8 17.4 20.974999999999998 29.2 32.425 9 17.675 20.4 32.175 29.75 10-14 19.46 29.475 26.634999999999998 24.43 15-19 19.89 28.57 27.525 24.015 20-24 19.555 28.935 27.485 24.025 25-29 19.455 28.744999999999997 28.335 23.465 30-34 20.131006550327516 28.816440822041102 27.891394569728483 23.161158057902895 35-39 19.82599129956498 28.506425321266065 27.68638431921596 23.981199059953 40-44 20.265 28.335 27.825 23.575 45-49 20.09 28.99 27.650000000000002 23.27 50-54 20.308341284587957 28.22779089037312 28.222769045347263 23.241098779691658 55-59 20.22974484090678 28.458879739758057 27.940428992579037 23.370946426756127 60-64 20.19090680733484 28.636021100226074 27.992966591308715 23.18010550113037 65-69 19.791770948042846 28.87175893482831 27.525277805586146 23.811192311542698 70-74 20.23 28.4 27.66 23.71 75-79 20.150000000000002 28.349999999999998 27.87 23.630000000000003 80-84 19.939999999999998 28.515 28.24 23.305 85-89 20.025000000000002 28.599999999999998 28.050000000000004 23.325000000000003 90-94 20.49 28.439999999999998 27.415 23.655 95-99 20.1 28.74 27.500000000000004 23.66 100-104 20.123080002001302 28.763696402661733 27.968179316555762 23.145044278781207 105-109 19.892554099512978 28.39785108199026 27.62966310187277 24.07993171662399 110-114 20.810405202601302 28.499249624812407 27.613806903451728 23.076538269134566 115-119 20.94012815378454 28.454144973968766 27.432919503404086 23.17280736884261 120-124 20.376112833850154 28.948684605381615 27.163148944683407 23.512053616084824 125-129 20.405 28.1 27.99 23.505000000000003 130-134 20.48 28.544999999999998 27.345000000000002 23.630000000000003 135-139 20.294999999999998 28.499999999999996 26.85 24.355 140-144 20.995 28.375 26.534999999999997 24.095 145-149 20.94 28.725 26.965 23.369999999999997 150-151 20.966328701965203 28.12617348854675 27.47527850794843 23.432219301539618 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 2.0 26 6.5 27 10.0 28 10.0 29 13.5 30 25.5 31 29.5 32 40.0 33 49.5 34 61.5 35 75.0 36 92.5 37 118.0 38 136.0 39 173.0 40 221.5 41 249.0 42 232.5 43 245.0 44 281.0 45 280.0 46 263.0 47 245.5 48 232.0 49 210.5 50 164.5 51 125.0 52 100.5 53 79.0 54 58.5 55 38.5 56 32.0 57 24.0 58 14.5 59 12.5 60 11.0 61 6.5 62 8.0 63 8.0 64 4.5 65 2.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.43499999999999994 55-59 1.63 60-64 0.475 65-69 0.11 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.415 110-114 0.05 115-119 0.12 120-124 0.03 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.800000000000001 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCAC 10 0.0069178343 144.3875 5 >>END_MODULE SRR7166181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.979 33.0 33.0 34.0 32.0 34.0 2 33.0525 33.0 33.0 34.0 32.0 34.0 3 33.063 34.0 33.0 34.0 32.0 34.0 4 33.1 34.0 33.0 34.0 32.0 34.0 5 33.04625 34.0 33.0 34.0 32.0 34.0 6 37.2675 38.0 38.0 38.0 37.0 38.0 7 37.25825 38.0 38.0 38.0 37.0 38.0 8 37.25825 38.0 38.0 38.0 37.0 38.0 9 37.26875 38.0 38.0 38.0 37.0 38.0 10-14 37.2921 38.0 38.0 38.0 37.0 38.0 15-19 37.22905 38.0 38.0 38.0 37.0 38.0 20-24 37.23774999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.17035 38.0 38.0 38.0 36.6 38.0 30-34 37.161950000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.082800000000006 38.0 38.0 38.0 36.0 38.0 40-44 37.02239999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.93589999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.83265 38.0 38.0 38.0 35.6 38.0 55-59 36.7387 38.0 38.0 38.0 35.0 38.0 60-64 36.79365 38.0 38.0 38.0 35.0 38.0 65-69 36.75275 38.0 38.0 38.0 35.0 38.0 70-74 36.62585 38.0 38.0 38.0 34.4 38.0 75-79 36.4839 38.0 38.0 38.0 34.0 38.0 80-84 36.3602 38.0 38.0 38.0 34.0 38.0 85-89 36.28825 38.0 38.0 38.0 33.8 38.0 90-94 36.17025 38.0 37.6 38.0 33.6 38.0 95-99 35.910000000000004 38.0 37.2 38.0 32.0 38.0 100-104 35.8071 38.0 37.0 38.0 31.2 38.0 105-109 35.78805 38.0 37.0 38.0 31.6 38.0 110-114 35.4911 38.0 36.8 38.0 30.2 38.0 115-119 35.1542 38.0 36.0 38.0 28.4 38.0 120-124 34.89575 38.0 36.0 38.0 27.6 38.0 125-129 34.70085 38.0 35.4 38.0 27.0 38.0 130-134 34.28365 38.0 35.0 38.0 24.4 38.0 135-139 33.9243 38.0 34.8 38.0 22.6 38.0 140-144 33.429950000000005 38.0 34.2 38.0 18.6 38.0 145-149 32.4803 38.0 33.8 38.0 11.4 38.0 150-151 28.469875000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 2.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 7.0 15 1.0 16 6.0 17 2.0 18 8.0 19 8.0 20 8.0 21 9.0 22 14.0 23 16.0 24 14.0 25 23.0 26 15.0 27 22.0 28 31.0 29 29.0 30 61.0 31 77.0 32 76.0 33 130.0 34 191.0 35 326.0 36 737.0 37 2179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 15.425 13.350000000000001 33.025 2 21.8 23.799999999999997 37.675 16.725 3 20.549999999999997 26.125 31.474999999999998 21.85 4 23.775 35.9 21.625 18.7 5 23.775 37.025000000000006 21.5 17.7 6 18.404601150287572 37.70942735683921 24.031007751937985 19.854963740935233 7 17.27931982995749 14.678669667416855 45.96149037259315 22.080520130032507 8 20.230057514378593 19.80495123780945 28.632158039509875 31.332833208302073 9 21.555388847211805 23.48087021755439 29.08227056764191 25.881470367591895 10-14 22.56064016004001 28.602150537634408 26.796699174793698 22.040510127531885 15-19 22.780695173793447 27.6419104776194 28.247061765441362 21.330332583145786 20-24 22.835708927231806 28.52213053263316 28.057014253563388 20.585146286571643 25-29 23.015356910609775 27.7124706117753 28.232704717122704 21.039467760492222 30-34 22.740685171292824 28.33708427106777 28.307076769192296 20.615153788447113 35-39 23.295823955988997 27.51187796949237 28.62215553888472 20.57014253563391 40-44 22.96574143535884 27.826956739184794 28.537134283570893 20.67016754188547 45-49 23.190435696063226 27.682457105697566 28.367765494472515 20.759341703766694 50-54 22.680876613629543 27.73941759231462 29.035324727309114 20.544381066746723 55-59 23.16658329164582 28.179089544772385 27.79889944972486 20.855427713856926 60-64 23.115778944736185 28.52213053263316 28.057014253563388 20.305076269067268 65-69 22.56064016004001 27.976994248562143 28.557139284821204 20.905226306576644 70-74 22.942206654991242 28.331248436327243 28.29622216662497 20.430322742056543 75-79 23.637728296222164 28.111083312484364 28.241180885664246 20.010007505629222 80-84 23.212409306980238 27.60570427820866 28.681511133350014 20.500375281461096 85-89 23.350507728477815 27.692461607723473 28.913010854884696 20.044019808914012 90-94 23.779267560536322 27.631578947368425 28.64218531118671 19.946968180908545 95-99 23.217413059794847 28.181135851888918 28.081060795596695 20.52039029271954 100-104 23.327830306668666 28.060433238281057 27.710240632347794 20.901495822702486 105-109 22.888010803781324 28.38993647776722 28.444955734507076 20.277096983944382 110-114 24.297007905533874 27.809466626638645 27.629340538376862 20.264184929450614 115-119 24.296867180462417 28.440596536883195 27.729956961265138 19.53257932138925 120-124 23.55855855855856 28.453453453453452 27.942942942942945 20.045045045045047 125-129 23.94915932746197 27.95736589271417 27.797237790232188 20.296236989591673 130-134 24.10084538042119 28.387774498524337 27.292281526687006 20.219098594367466 135-139 24.399759903961584 28.026210484193676 27.40596238495398 20.168067226890756 140-144 24.891222805701425 28.482120530132534 26.976744186046513 19.64991247811953 145-149 24.831207801950487 28.70217554388597 26.42160540135034 20.045011252813204 150-151 25.440680085010626 27.778472309038634 26.903362920365048 19.877484685585696 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.0 26 2.0 27 5.5 28 8.5 29 11.0 30 13.0 31 19.0 32 25.0 33 37.5 34 51.0 35 59.5 36 81.5 37 113.0 38 156.0 39 188.5 40 201.0 41 228.5 42 257.5 43 269.0 44 287.5 45 292.5 46 277.5 47 260.0 48 236.0 49 206.0 50 170.5 51 129.0 52 90.5 53 77.0 54 67.5 55 40.5 56 26.0 57 26.0 58 21.5 59 17.0 60 10.0 61 6.0 62 4.0 63 2.5 64 4.5 65 4.0 66 2.5 67 2.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.045 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.045 50-54 0.06999999999999999 55-59 0.05 60-64 0.025 65-69 0.025 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.045 90-94 0.06 95-99 0.075 100-104 0.055 105-109 0.034999999999999996 110-114 0.06999999999999999 115-119 0.09 120-124 0.1 125-129 0.08 130-134 0.045 135-139 0.04 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0125 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.1875 0.0 0.0 0.025 0.0 88-89 0.225 0.0 0.0 0.025 0.0 90-91 0.275 0.0 0.0 0.025 0.0 92-93 0.3 0.0 0.0 0.025 0.0 94-95 0.3375 0.0 0.0 0.025 0.0 96-97 0.375 0.0 0.0 0.025 0.0 98-99 0.475 0.0 0.0 0.025 0.0 100-101 0.575 0.0 0.0 0.025 0.0 102-103 0.675 0.0 0.0 0.025 0.0 104-105 0.7875 0.0 0.0 0.025 0.0 106-107 0.925 0.0 0.0 0.025 0.0 108-109 1.0375 0.0 0.0 0.025 0.0 110-111 1.325 0.0 0.0 0.025 0.0 112-113 1.65 0.0 0.0 0.025 0.0 114-115 1.95 0.0 0.0 0.025 0.0 116-117 2.175 0.0 0.0 0.025 0.0 118-119 2.425 0.0 0.0 0.025 0.0 120-121 2.8625 0.0 0.0 0.025 0.0 122-123 3.225 0.0 0.0 0.025 0.0 124-125 3.6 0.0 0.0 0.025 0.0 126-127 3.9375 0.0 0.0 0.025 0.0 128-129 4.45 0.0 0.0 0.025 0.0 130-131 4.824999999999999 0.0 0.0 0.025 0.0 132-133 5.3125 0.0 0.0 0.025 0.0 134-135 5.8625 0.0 0.0 0.025 0.0 136-137 6.3875 0.0 0.0 0.025 0.0 138-139 6.8 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAC 10 0.006830828 145.0 145 CCTTGGC 10 0.006830828 145.0 1 >>END_MODULE Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815655 spots for SRR7166181.sra Written 815655 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra Read 815649 spots for SRR7166181.sra Written 815649 spots for SRR7166181.sra SRR ids: ['SRR7166181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wy2o95w4 SRR7166181.sra spots: 16312986 blocks: [[1, 815649], [815650, 1631298], [1631299, 2446947], [2446948, 3262596], [3262597, 4078245], [4078246, 4893894], [4893895, 5709543], [5709544, 6525192], [6525193, 7340841], [7340842, 8156490], [8156491, 8972139], [8972140, 9787788], [9787789, 10603437], [10603438, 11419086], [11419087, 12234735], [12234736, 13050384], [13050385, 13866033], [13866034, 14681682], [14681683, 15497331], [15497332, 16312986]] SRR7166181 file size 5506235 SRR7166181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166181 SRR7166181_1.fastq SRR7166181_2.fastq Input file: SRR7166181_1.fastq Paired file: SRR7166181_2.fastq trimmed: SRR7166181-trimmed-pair1.fastq, SRR7166181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:54:46 2025 >> started Fri Feb 14 21:55:07 2025 >> done (20.812s) 16312986 read pairs processed; of these: 10419 ( 0.06%) short read pairs filtered out after trimming by size control 6479 ( 0.04%) empty read pairs filtered out after trimming by size control 16296088 (99.90%) read pairs available; of these: 7317587 (44.90%) trimmed read pairs available after processing 8978501 (55.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 8 0.00% 21 3 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 8 0.00% 29 7 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 14 0.00% 34 7 0.00% 35 12 0.00% 36 5 0.00% 37 5 0.00% 38 13 0.00% 39 10 0.00% 40 11 0.00% 41 17 0.00% 42 11 0.00% 43 14 0.00% 44 24 0.00% 45 22 0.00% 46 31 0.00% 47 33 0.00% 48 40 0.00% 49 43 0.00% 50 50 0.00% 51 46 0.00% 52 59 0.00% 53 65 0.00% 54 78 0.00% 55 77 0.00% 56 99 0.00% 57 124 0.00% 58 118 0.00% 59 142 0.00% 60 169 0.00% 61 199 0.00% 62 197 0.00% 63 258 0.00% 64 268 0.00% 65 298 0.00% 66 301 0.00% 67 391 0.00% 68 393 0.00% 69 485 0.00% 70 566 0.00% 71 647 0.00% 72 723 0.00% 73 896 0.01% 74 965 0.01% 75 995 0.01% 76 1180 0.01% 77 1412 0.01% 78 1569 0.01% 79 1698 0.01% 80 1928 0.01% 81 2230 0.01% 82 2559 0.02% 83 3087 0.02% 84 4102 0.03% 85 4149 0.03% 86 4418 0.03% 87 4675 0.03% 88 5132 0.03% 89 5580 0.03% 90 6085 0.04% 91 6597 0.04% 92 7168 0.04% 93 7991 0.05% 94 8480 0.05% 95 9029 0.06% 96 9753 0.06% 97 10396 0.06% 98 11083 0.07% 99 12198 0.07% 100 12314 0.08% 101 13350 0.08% 102 14278 0.09% 103 15280 0.09% 104 15843 0.10% 105 17023 0.10% 106 17953 0.11% 107 18538 0.11% 108 19512 0.12% 109 20345 0.12% 110 21285 0.13% 111 22481 0.14% 112 23992 0.15% 113 25049 0.15% 114 26809 0.16% 115 28214 0.17% 116 29211 0.18% 117 30159 0.19% 118 31204 0.19% 119 32489 0.20% 120 33496 0.21% 121 35728 0.22% 122 36812 0.23% 123 39023 0.24% 124 40883 0.25% 125 42531 0.26% 126 43774 0.27% 127 46288 0.28% 128 48235 0.30% 129 49502 0.30% 130 51623 0.32% 131 53847 0.33% 132 56897 0.35% 133 59801 0.37% 134 62518 0.38% 135 66382 0.41% 136 69745 0.43% 137 73469 0.45% 138 77728 0.48% 139 83932 0.52% 140 88973 0.55% 141 97170 0.60% 142 106901 0.66% 143 117803 0.72% 144 134843 0.83% 145 159937 0.98% 146 197709 1.21% 147 258356 1.59% 148 386436 2.37% 149 728898 4.47% 150 3391522 20.81% 151 8978501 55.10% 16296088 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.12 prefix-fanout=2.0 sequence=TGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=434.43 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=35.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=CATCACTTGCTCTCTTTCTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=425.31 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=33.7 sequence=AAGAAGAAGAAA SRR7166181 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:56:26 Started mapping on | Feb 14 21:56:27 Finished on | Feb 14 21:58:20 Mapping speed, Million of reads per hour | 519.17 Number of input reads | 16296088 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15537348 Uniquely mapped reads % | 95.34% Average mapped length | 293.95 Number of splices: Total | 15768281 Number of splices: Annotated (sjdb) | 15519138 Number of splices: GT/AG | 15520146 Number of splices: GC/AG | 197462 Number of splices: AT/AC | 10852 Number of splices: Non-canonical | 39821 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397548 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 32150 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369590 369590 369590 N_multimapping 397548 397548 397548 N_noFeature 395753 15378540 489394 N_ambiguous 136591 1505 70185 UnstrandedReadsAssigned:15005004 PositiveStrandReadsAssigned:157303 NegativeStrandReadsAssigned:14977769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166181-trimmed-pair1.fastq SRR7166181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,296,088 reads, 14,867,417 reads pseudoaligned [quant] estimated average fragment length: 241.016 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR7166181.ke.tsv 34699 SRR7166181.se.tsv 87100 total ==> SRR7166181.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.98 638 25.4399 Potri.005G024800.1.v4.1 1035 794.984 279 24.881 Potri.004G059700.1.v4.1 961 721.021 12 1.17993 Potri.007G009000.2.v4.1 1416 1175.98 0 0 Potri.003G141000.2.v4.1 2943 2702.98 496.109 13.0124 Potri.016G087400.1.v4.1 270 82.8126 1030 881.786 Potri.015G069301.1.v4.1 564 330.993 0 0 Potri.010G195200.1.v4.1 1773 1532.98 96 4.43972 Potri.012G127500.1.v4.1 977 736.995 2783 267.714 ==> SRR7166181.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 51 SRR7166181 completed mapping pipeline successfully