Starting /dee2/code/volunteer_pipeline.sh SRR7166182 current disk space = 3109285498880 free memory = 1463095132 SRR7166182 SRAfilesize d1efc4dda1d1de3b5b55c7d524c087e0 SRR7166182.sra SRR7166182.sra file validated SRR7166182 is paired end SRR7166182 is conventional basespace SRR7166182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.907 33.0 32.0 34.0 31.0 34.0 2 32.096 33.0 33.0 34.0 29.0 34.0 3 32.35725 33.0 33.0 34.0 29.0 34.0 4 32.209 33.0 33.0 34.0 29.0 34.0 5 32.27325 33.0 33.0 34.0 31.0 34.0 6 36.62375 38.0 37.0 38.0 34.0 38.0 7 36.85775 38.0 38.0 38.0 35.0 38.0 8 37.09375 38.0 38.0 38.0 36.0 38.0 9 36.695 38.0 38.0 38.0 34.0 38.0 10-14 37.040099999999995 38.0 38.0 38.0 35.8 38.0 15-19 37.0149 38.0 38.0 38.0 35.8 38.0 20-24 37.04755 38.0 38.0 38.0 36.0 38.0 25-29 36.84439999999999 38.0 38.0 38.0 34.8 38.0 30-34 36.2802 38.0 37.2 38.0 33.2 38.0 35-39 36.22695 38.0 37.0 38.0 32.8 38.0 40-44 36.187149999999995 38.0 37.0 38.0 32.8 38.0 45-49 35.9562 38.0 37.0 38.0 31.4 38.0 50-54 35.758799999999994 38.0 36.6 38.0 30.2 38.0 55-59 35.5165 38.0 36.2 38.0 28.8 38.0 60-64 35.356700000000004 38.0 36.0 38.0 28.6 38.0 65-69 35.47615 38.0 36.0 38.0 29.2 38.0 70-74 35.353500000000004 38.0 36.0 38.0 28.6 38.0 75-79 34.8523 38.0 36.0 38.0 27.6 38.0 80-84 34.53435 38.0 35.6 38.0 25.6 38.0 85-89 34.31855 38.0 34.4 38.0 24.6 38.0 90-94 34.5637 38.0 34.6 38.0 25.8 38.0 95-99 34.289500000000004 38.0 34.2 38.0 24.2 38.0 100-104 33.866499999999995 38.0 34.0 38.0 21.6 38.0 105-109 33.23780000000001 37.6 32.8 38.0 18.2 38.0 110-114 32.5101 37.0 31.2 38.0 15.0 38.0 115-119 32.31845 37.0 31.0 38.0 15.0 38.0 120-124 31.688349999999996 36.6 29.2 38.0 15.0 38.0 125-129 30.704850000000004 35.6 27.6 38.0 14.8 38.0 130-134 29.1141 34.0 23.4 38.0 13.0 38.0 135-139 27.77715 33.0 19.6 38.0 6.4 38.0 140-144 26.534700000000004 33.0 14.0 38.0 2.0 38.0 145-149 24.6626 32.2 8.2 38.0 2.0 38.0 150-151 18.5925 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 3.0 14 1.0 15 3.0 16 1.0 17 7.0 18 8.0 19 10.0 20 20.0 21 27.0 22 29.0 23 35.0 24 54.0 25 68.0 26 63.0 27 68.0 28 100.0 29 144.0 30 157.0 31 204.0 32 239.0 33 310.0 34 424.0 35 634.0 36 892.0 37 492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.46730866700456 18.09427268119615 9.73137354282818 35.70704510897111 2 18.675 28.425 35.699999999999996 17.2 3 16.85 32.425 26.825 23.9 4 20.5 37.65 22.15 19.7 5 19.75 38.775 22.900000000000002 18.575 6 16.475 37.425000000000004 25.55 20.549999999999997 7 11.975 19.925 47.325 20.775 8 18.25 21.525 28.425 31.8 9 17.05 22.7 28.849999999999998 31.4 10-14 19.18 30.495 26.33 23.995 15-19 19.455 29.375 27.87 23.3 20-24 19.400000000000002 30.56 27.02 23.02 25-29 18.985 29.965000000000003 27.939999999999998 23.11 30-34 19.405 29.195 28.13 23.27 35-39 19.465 30.145 27.865000000000002 22.525000000000002 40-44 19.535 30.314999999999998 27.105 23.044999999999998 45-49 19.7 29.509999999999998 27.744999999999997 23.044999999999998 50-54 19.814999999999998 29.825000000000003 27.37 22.99 55-59 19.555 29.970000000000002 27.900000000000002 22.575 60-64 19.6 29.435 27.534999999999997 23.43 65-69 19.8 29.815 27.51 22.875 70-74 19.051434867531427 29.563780237391697 27.875995392397456 23.50878950267942 75-79 19.45501598416806 29.380423199878216 28.050946364236058 23.113614451717666 80-84 19.765843726138968 28.984474420972255 28.068210740646478 23.1814711122423 85-89 20.379075815163034 29.495899179835966 27.530506101220244 22.594518903780756 90-94 19.642946441966295 29.61444216632495 28.144221633244985 22.598389758463767 95-99 20.24 28.915000000000003 27.834999999999997 23.01 100-104 19.84 29.765000000000004 27.91 22.485 105-109 19.985 29.770000000000003 27.495000000000005 22.75 110-114 19.85 29.965000000000003 27.255000000000003 22.93 115-119 19.975 28.970000000000002 28.065 22.99 120-124 21.126126126126128 29.139139139139143 27.3973973973974 22.33733733733734 125-129 20.642477698707026 29.74340984263807 27.18753132204069 22.426581136614214 130-134 20.71395973834998 29.9528421479641 26.890117134019576 22.443080979666348 135-139 21.2776634716716 29.507703116374767 26.827921914989712 22.38671149696392 140-144 20.73 29.970000000000002 27.029999999999998 22.27 145-149 20.904268754736044 29.234655215963627 26.627936347562514 23.233139681737814 150-151 20.476190476190474 28.483709273182956 26.704260651629074 24.335839598997495 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 2.0 22 2.0 23 1.5 24 4.5 25 6.0 26 9.0 27 15.5 28 19.5 29 23.5 30 27.0 31 33.0 32 46.5 33 64.5 34 81.0 35 92.5 36 101.5 37 129.5 38 167.5 39 199.5 40 212.5 41 230.0 42 275.0 43 287.0 44 265.5 45 253.5 46 259.5 47 248.0 48 208.5 49 172.5 50 149.5 51 105.0 52 70.0 53 60.0 54 44.5 55 31.5 56 29.0 57 24.5 58 11.5 59 8.0 60 6.0 61 5.5 62 5.0 63 2.0 64 0.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.165 75-79 1.465 80-84 1.775 85-89 0.02 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.1 125-129 0.22999999999999998 130-134 1.395 135-139 0.365 140-144 0.0 145-149 1.0250000000000001 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.6875 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATAAAC 10 0.0066904067 145.98734 1 TAAACAT 10 0.0069501684 144.1625 3 CAAACTC 10 0.0069501684 144.1625 3 CAAGTCC 10 0.0069501684 144.1625 3 AAGTCCA 10 0.0069501684 144.1625 4 >>END_MODULE SRR7166182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67275 33.0 33.0 34.0 32.0 34.0 2 32.76575 34.0 33.0 34.0 32.0 34.0 3 32.7235 34.0 33.0 34.0 32.0 34.0 4 32.599 34.0 33.0 34.0 32.0 34.0 5 32.76775 34.0 33.0 34.0 32.0 34.0 6 36.75175 38.0 38.0 38.0 35.0 38.0 7 36.86575 38.0 38.0 38.0 36.0 38.0 8 36.85875 38.0 38.0 38.0 36.0 38.0 9 36.91275 38.0 38.0 38.0 36.0 38.0 10-14 36.7555 38.0 38.0 38.0 35.2 38.0 15-19 36.531400000000005 38.0 38.0 38.0 34.2 38.0 20-24 36.4721 38.0 38.0 38.0 34.2 38.0 25-29 36.56445 38.0 38.0 38.0 34.4 38.0 30-34 36.60549999999999 38.0 38.0 38.0 34.6 38.0 35-39 36.12995 38.0 38.0 38.0 33.0 38.0 40-44 36.2358 38.0 38.0 38.0 33.6 38.0 45-49 35.981399999999994 38.0 37.4 38.0 32.2 38.0 50-54 36.02745 38.0 37.8 38.0 32.4 38.0 55-59 35.9413 38.0 37.4 38.0 31.6 38.0 60-64 35.9734 38.0 37.6 38.0 32.4 38.0 65-69 35.64655 38.0 37.0 38.0 30.2 38.0 70-74 35.768150000000006 38.0 37.0 38.0 31.0 38.0 75-79 35.458600000000004 38.0 37.0 38.0 29.2 38.0 80-84 35.34204999999999 38.0 36.8 38.0 29.2 38.0 85-89 35.474000000000004 38.0 36.8 38.0 29.6 38.0 90-94 35.280150000000006 38.0 36.8 38.0 29.2 38.0 95-99 34.9161 38.0 36.0 38.0 27.6 38.0 100-104 34.53365000000001 38.0 35.2 38.0 25.4 38.0 105-109 34.474149999999995 38.0 35.0 38.0 25.0 38.0 110-114 34.029399999999995 38.0 34.4 38.0 23.0 38.0 115-119 33.8706 38.0 34.2 38.0 21.2 38.0 120-124 33.04015 38.0 33.4 38.0 15.0 38.0 125-129 32.0189 37.2 31.0 38.0 15.0 38.0 130-134 31.2329 36.6 30.0 38.0 13.4 38.0 135-139 30.628949999999996 36.0 29.4 38.0 13.0 38.0 140-144 29.317700000000002 35.8 25.4 38.0 3.8 38.0 145-149 27.384499999999996 34.0 17.6 38.0 2.0 38.0 150-151 21.56475 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 3.0 5 1.0 6 1.0 7 2.0 8 2.0 9 4.0 10 3.0 11 2.0 12 3.0 13 6.0 14 6.0 15 7.0 16 8.0 17 7.0 18 10.0 19 13.0 20 23.0 21 20.0 22 21.0 23 28.0 24 26.0 25 34.0 26 46.0 27 59.0 28 77.0 29 65.0 30 108.0 31 130.0 32 163.0 33 195.0 34 291.0 35 462.0 36 830.0 37 1331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.625 17.224999999999998 14.924999999999999 30.225 2 23.05 24.425 35.75 16.775000000000002 3 19.650000000000002 27.1 32.45 20.8 4 22.650000000000002 35.875 22.525000000000002 18.95 5 23.474999999999998 37.95 22.35 16.225 6 18.275 37.5 25.074999999999996 19.15 7 16.375 16.625 46.35 20.65 8 19.775000000000002 22.575 28.725 28.925 9 21.330332583145786 24.081020255063766 28.832208052013 25.756439109777446 10-14 22.34 28.48 27.834999999999997 21.345 15-19 22.365 28.33 28.675 20.630000000000003 20-24 22.41 28.799999999999997 28.505000000000003 20.285 25-29 21.86 27.935 29.604999999999997 20.599999999999998 30-34 22.39 28.28 29.025000000000002 20.305 35-39 22.634999999999998 27.845 29.080000000000002 20.44 40-44 22.48612430621531 28.496424821241064 28.906445322266112 20.111005550277515 45-49 22.78 27.825 29.21 20.185 50-54 22.36 28.12 29.01 20.51 55-59 22.945 27.779999999999998 28.965000000000003 20.31 60-64 22.68 27.83 29.5 19.99 65-69 22.64 28.455000000000002 28.645 20.26 70-74 23.255 28.225 28.645 19.875 75-79 22.55 27.935 29.57 19.945 80-84 22.759999999999998 27.605 29.270000000000003 20.365 85-89 22.556127806390318 27.76138806940347 29.10145507275364 20.581029051452575 90-94 22.965 28.325 29.215000000000003 19.495 95-99 22.865 27.79 29.085 20.26 100-104 23.16963392678536 27.750550110022004 29.370874174834967 19.708941788357674 105-109 23.43054374468511 27.86754039317693 28.822970336651494 19.87894552548647 110-114 23.3631771119892 27.844745660981346 28.710048516980947 20.082028710048515 115-119 23.175 27.839999999999996 29.630000000000003 19.355 120-124 23.936196809840492 27.556377818890944 28.68143407170359 19.82599129956498 125-129 23.705000000000002 28.67 27.810000000000002 19.814999999999998 130-134 24.285 27.544999999999998 28.515 19.655 135-139 24.12 27.92 27.845 20.115 140-144 24.64 27.79 28.15 19.42 145-149 25.009999999999998 27.834999999999997 27.77 19.384999999999998 150-151 25.85 27.0875 28.0875 18.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 2.5 23 4.5 24 4.0 25 3.0 26 3.0 27 6.5 28 12.0 29 17.5 30 20.0 31 25.0 32 33.0 33 51.5 34 67.0 35 66.5 36 92.5 37 134.0 38 170.0 39 194.5 40 220.5 41 249.5 42 279.0 43 292.0 44 291.0 45 289.0 46 273.5 47 251.0 48 213.5 49 177.0 50 144.5 51 107.5 52 78.5 53 63.5 54 47.0 55 30.5 56 26.0 57 19.0 58 10.0 59 7.5 60 4.5 61 4.5 62 4.0 63 3.5 64 2.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.045 110-114 0.034999999999999996 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.15048908954100826 0.3 3 0.05016302984700275 0.15 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.95 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.95 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATGT 10 0.006830828 145.0 3 >>END_MODULE Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740249 spots for SRR7166182.sra Written 740249 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra Read 740234 spots for SRR7166182.sra Written 740234 spots for SRR7166182.sra SRR ids: ['SRR7166182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4x90s_yr SRR7166182.sra spots: 14804695 blocks: [[1, 740234], [740235, 1480468], [1480469, 2220702], [2220703, 2960936], [2960937, 3701170], [3701171, 4441404], [4441405, 5181638], [5181639, 5921872], [5921873, 6662106], [6662107, 7402340], [7402341, 8142574], [8142575, 8882808], [8882809, 9623042], [9623043, 10363276], [10363277, 11103510], [11103511, 11843744], [11843745, 12583978], [12583979, 13324212], [13324213, 14064446], [14064447, 14804695]] SRR7166182 file size 4995124 SRR7166182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166182 SRR7166182_1.fastq SRR7166182_2.fastq Input file: SRR7166182_1.fastq Paired file: SRR7166182_2.fastq trimmed: SRR7166182-trimmed-pair1.fastq, SRR7166182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:19:26 2025 >> started Fri Feb 14 21:19:45 2025 >> done (18.959s) 14804695 read pairs processed; of these: 14305 ( 0.10%) short read pairs filtered out after trimming by size control 12456 ( 0.08%) empty read pairs filtered out after trimming by size control 14777934 (99.82%) read pairs available; of these: 9446260 (63.92%) trimmed read pairs available after processing 5331674 (36.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 9 0.00% 26 10 0.00% 27 6 0.00% 28 5 0.00% 29 1 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 9 0.00% 34 10 0.00% 35 11 0.00% 36 10 0.00% 37 8 0.00% 38 8 0.00% 39 15 0.00% 40 12 0.00% 41 18 0.00% 42 20 0.00% 43 19 0.00% 44 25 0.00% 45 31 0.00% 46 26 0.00% 47 38 0.00% 48 35 0.00% 49 46 0.00% 50 49 0.00% 51 71 0.00% 52 77 0.00% 53 71 0.00% 54 81 0.00% 55 94 0.00% 56 115 0.00% 57 117 0.00% 58 149 0.00% 59 209 0.00% 60 234 0.00% 61 243 0.00% 62 255 0.00% 63 317 0.00% 64 377 0.00% 65 402 0.00% 66 449 0.00% 67 525 0.00% 68 621 0.00% 69 727 0.00% 70 795 0.01% 71 895 0.01% 72 1090 0.01% 73 1183 0.01% 74 1312 0.01% 75 1404 0.01% 76 1470 0.01% 77 1516 0.01% 78 1620 0.01% 79 1745 0.01% 80 2061 0.01% 81 2419 0.02% 82 2868 0.02% 83 3241 0.02% 84 3991 0.03% 85 4627 0.03% 86 4782 0.03% 87 5542 0.04% 88 5764 0.04% 89 6238 0.04% 90 7038 0.05% 91 8220 0.06% 92 9185 0.06% 93 9944 0.07% 94 10336 0.07% 95 10401 0.07% 96 10762 0.07% 97 11936 0.08% 98 13060 0.09% 99 13993 0.09% 100 15130 0.10% 101 15690 0.11% 102 16085 0.11% 103 17076 0.12% 104 19188 0.13% 105 21228 0.14% 106 22740 0.15% 107 22791 0.15% 108 22159 0.15% 109 22690 0.15% 110 24649 0.17% 111 25640 0.17% 112 27946 0.19% 113 29911 0.20% 114 31222 0.21% 115 31807 0.22% 116 34009 0.23% 117 37497 0.25% 118 39858 0.27% 119 43017 0.29% 120 43874 0.30% 121 44656 0.30% 122 44860 0.30% 123 47849 0.32% 124 52587 0.36% 125 55880 0.38% 126 59216 0.40% 127 63651 0.43% 128 65888 0.45% 129 71280 0.48% 130 74376 0.50% 131 81750 0.55% 132 87792 0.59% 133 94590 0.64% 134 101112 0.68% 135 108863 0.74% 136 112199 0.76% 137 115704 0.78% 138 126481 0.86% 139 142857 0.97% 140 166949 1.13% 141 158639 1.07% 142 169798 1.15% 143 187987 1.27% 144 217757 1.47% 145 260750 1.76% 146 329313 2.23% 147 444083 3.01% 148 631109 4.27% 149 1079530 7.31% 150 3519510 23.82% 151 5331674 36.08% 14777934 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=8.33 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.5 sequence=TCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=40.42 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.4 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7166182 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:21:09 Started mapping on | Feb 14 21:21:09 Finished on | Feb 14 21:23:08 Mapping speed, Million of reads per hour | 447.06 Number of input reads | 14777934 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14056714 Uniquely mapped reads % | 95.12% Average mapped length | 290.35 Number of splices: Total | 13415396 Number of splices: Annotated (sjdb) | 13155789 Number of splices: GT/AG | 13198758 Number of splices: GC/AG | 170590 Number of splices: AT/AC | 9632 Number of splices: Non-canonical | 36416 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366232 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 25722 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370107 370107 370107 N_multimapping 366232 366232 366232 N_noFeature 532714 13883808 631908 N_ambiguous 146367 733 72292 UnstrandedReadsAssigned:13377633 PositiveStrandReadsAssigned:172173 NegativeStrandReadsAssigned:13352514 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166182-trimmed-pair1.fastq SRR7166182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,777,934 reads, 13,288,320 reads pseudoaligned [quant] estimated average fragment length: 229.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7166182.ke.tsv 34699 SRR7166182.se.tsv 87100 total ==> SRR7166182.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.69 1399 56.6628 Potri.005G024800.1.v4.1 1035 806.693 384 34.505 Potri.004G059700.1.v4.1 961 732.709 17 1.68181 Potri.007G009000.2.v4.1 1416 1187.69 0 0 Potri.003G141000.2.v4.1 2943 2714.69 768.527 20.5209 Potri.016G087400.1.v4.1 270 85.6064 1043 883.155 Potri.015G069301.1.v4.1 564 338.753 0 0 Potri.010G195200.1.v4.1 1773 1544.69 564.859 26.5068 Potri.012G127500.1.v4.1 977 748.704 3961 383.49 ==> SRR7166182.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 501 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 509 SRR7166182 completed mapping pipeline successfully