Starting /dee2/code/volunteer_pipeline.sh SRR7166183 current disk space = 3108203433984 free memory = 1477850596 SRR7166183 SRAfilesize 14104fa03d6b2c3bf10db5ccf19644c4 SRR7166183.sra SRR7166183.sra file validated SRR7166183 is paired end SRR7166183 is conventional basespace SRR7166183 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.978 33.0 32.0 34.0 30.0 34.0 2 32.166 33.0 33.0 34.0 29.0 34.0 3 32.37625 33.0 33.0 34.0 29.0 34.0 4 32.22725 33.0 33.0 34.0 29.0 34.0 5 32.23975 33.0 33.0 34.0 31.0 34.0 6 36.598 38.0 37.0 38.0 34.0 38.0 7 36.75 38.0 37.0 38.0 35.0 38.0 8 37.06 38.0 38.0 38.0 36.0 38.0 9 36.6885 38.0 38.0 38.0 34.0 38.0 10-14 36.9996 38.0 38.0 38.0 35.6 38.0 15-19 36.965650000000004 38.0 38.0 38.0 35.4 38.0 20-24 36.99865 38.0 38.0 38.0 35.4 38.0 25-29 36.7369 38.0 38.0 38.0 34.4 38.0 30-34 36.1853 38.0 37.2 38.0 33.0 38.0 35-39 36.1527 38.0 37.0 38.0 32.4 38.0 40-44 36.09575 38.0 37.0 38.0 32.2 38.0 45-49 35.847449999999995 38.0 36.6 38.0 31.0 38.0 50-54 35.6563 38.0 36.6 38.0 30.2 38.0 55-59 35.566599999999994 38.0 36.0 38.0 29.0 38.0 60-64 35.3459 38.0 36.0 38.0 28.8 38.0 65-69 35.399649999999994 38.0 36.0 38.0 28.8 38.0 70-74 35.22945 38.0 36.0 38.0 28.4 38.0 75-79 34.7177 38.0 35.4 38.0 26.8 38.0 80-84 34.500249999999994 38.0 35.2 38.0 26.0 38.0 85-89 34.19945 38.0 34.2 38.0 23.0 38.0 90-94 34.51315 38.0 34.2 38.0 25.4 38.0 95-99 34.22585 38.0 34.4 38.0 24.2 38.0 100-104 33.6309 37.6 33.6 38.0 18.2 38.0 105-109 33.238600000000005 37.2 32.6 38.0 15.0 38.0 110-114 32.46485 37.0 31.4 38.0 15.0 38.0 115-119 32.21355 37.0 30.8 38.0 15.0 38.0 120-124 31.5591 36.2 29.0 38.0 15.0 38.0 125-129 30.6824 35.6 26.6 38.0 14.8 38.0 130-134 29.12375 34.2 23.4 38.0 13.0 38.0 135-139 27.95795 33.0 21.0 38.0 6.4 38.0 140-144 26.5871 33.0 14.8 38.0 2.0 38.0 145-149 24.574450000000002 32.2 8.2 38.0 2.0 38.0 150-151 18.2575 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 1.0 14 3.0 15 1.0 16 3.0 17 5.0 18 6.0 19 9.0 20 24.0 21 32.0 22 28.0 23 33.0 24 48.0 25 59.0 26 72.0 27 105.0 28 111.0 29 135.0 30 165.0 31 193.0 32 241.0 33 309.0 34 449.0 35 591.0 36 836.0 37 535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.97319170460293 18.791097622660597 9.812847749114821 32.42286292362165 2 19.75 25.074999999999996 36.8 18.375 3 17.05 32.975 27.325 22.650000000000002 4 21.325 37.0 22.825 18.85 5 19.0 37.974999999999994 24.75 18.275 6 16.5 38.25 24.5 20.75 7 13.925 19.2 47.349999999999994 19.525000000000002 8 18.375 20.5 28.050000000000004 33.074999999999996 9 17.5 22.8 30.85 28.849999999999998 10-14 18.815 30.75 27.12 23.315 15-19 20.035 29.28 27.63 23.055 20-24 19.5 31.03 26.974999999999998 22.495 25-29 19.905 29.849999999999998 28.055000000000003 22.189999999999998 30-34 19.585 30.035 27.474999999999998 22.905 35-39 19.615 30.385 27.185 22.814999999999998 40-44 20.365 29.95 27.115000000000002 22.57 45-49 20.22 29.395 27.46 22.925 50-54 20.1 29.735 27.525 22.64 55-59 19.7 30.03 27.200000000000003 23.07 60-64 19.48 29.86 27.33 23.330000000000002 65-69 20.3 29.154999999999998 27.474999999999998 23.07 70-74 20.16928778924171 29.269758589602326 28.13783431834118 22.423119302814783 75-79 20.31860382527523 30.079650956318805 27.284257521181065 22.317487697224898 80-84 19.878997407087297 29.701560831765722 27.15948955208704 23.259952209059943 85-89 20.289057811562312 28.980796159231847 27.490498099619927 23.239647929585917 90-94 20.224044808961793 29.13582716543309 27.545509101820365 23.094618923784758 95-99 20.45 29.04 27.944999999999997 22.564999999999998 100-104 20.4 29.785 26.995 22.82 105-109 20.43 29.65 27.250000000000004 22.67 110-114 20.65 29.925 27.025 22.400000000000002 115-119 21.11 28.985 27.189999999999998 22.715 120-124 20.698803624167795 29.283676227661807 27.47659808780097 22.540922060369425 125-129 20.76275433497043 29.64819083892954 26.926931943469977 22.662122882630047 130-134 21.386580174336103 29.87026150415569 26.211230488546523 22.53192783296169 135-139 21.290905440674564 29.446898213210197 26.75667536639229 22.50552097972295 140-144 21.445 30.43 26.235000000000003 21.89 145-149 21.331851253031527 29.21382376717866 25.722514147130155 23.73181083265966 150-151 20.807219854600152 28.11481574329406 26.92404111306092 24.153923289044872 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 2.0 21 2.0 22 1.0 23 1.0 24 2.0 25 6.5 26 10.5 27 9.5 28 14.0 29 24.0 30 28.5 31 41.0 32 49.5 33 52.0 34 69.5 35 97.5 36 127.5 37 150.0 38 169.5 39 199.0 40 216.5 41 225.5 42 249.0 43 262.5 44 251.5 45 244.0 46 252.5 47 231.0 48 198.5 49 184.0 50 154.0 51 117.0 52 83.5 53 71.0 54 55.5 55 34.5 56 33.5 57 26.5 58 15.0 59 9.0 60 7.5 61 5.5 62 3.0 63 0.5 64 0.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.16999999999999998 75-79 1.4449999999999998 80-84 1.6549999999999998 85-89 0.02 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.11499999999999999 125-129 0.22999999999999998 130-134 1.34 135-139 0.38 140-144 0.0 145-149 1.04 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.5040322580645161 1.0 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0125 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.15 0.0 0.0 0.025 0.0 88-89 0.2 0.0 0.0 0.025 0.0 90-91 0.2625 0.0 0.0 0.025 0.0 92-93 0.375 0.0 0.0 0.025 0.0 94-95 0.45 0.0 0.0 0.025 0.0 96-97 0.55 0.0 0.0 0.025 0.0 98-99 0.625 0.0 0.0 0.025 0.0 100-101 0.75 0.0 0.0 0.025 0.0 102-103 0.825 0.0 0.0 0.025 0.0 104-105 0.8875 0.0 0.0 0.025 0.0 106-107 1.075 0.0 0.0 0.025 0.0 108-109 1.3125 0.0 0.0 0.025 0.0 110-111 1.525 0.0 0.0 0.025 0.0 112-113 1.8375 0.0 0.0 0.025 0.0 114-115 2.1625 0.0 0.0 0.025 0.0 116-117 2.4625 0.0 0.0 0.025 0.0 118-119 2.9 0.0 0.0 0.025 0.0 120-121 3.1625 0.0 0.0 0.025 0.0 122-123 3.5 0.0 0.0 0.025 0.0 124-125 3.8125 0.0 0.0 0.025 0.0 126-127 4.137499999999999 0.0 0.0 0.025 0.0 128-129 4.6125 0.0 0.0 0.025 0.0 130-131 5.237500000000001 0.0 0.0 0.025 0.0 132-133 6.0375 0.0 0.0 0.025 0.0 134-135 6.675000000000001 0.0 0.0 0.025 0.0 136-137 7.300000000000001 0.0 0.0 0.025 0.0 138-139 7.9 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166183 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6555 33.0 33.0 34.0 32.0 34.0 2 32.77375 33.0 33.0 34.0 32.0 34.0 3 32.62925 34.0 33.0 34.0 32.0 34.0 4 32.48475 34.0 33.0 34.0 31.0 34.0 5 32.71025 34.0 33.0 34.0 32.0 34.0 6 36.777 38.0 38.0 38.0 35.0 38.0 7 36.751 38.0 38.0 38.0 35.0 38.0 8 36.72475 38.0 38.0 38.0 35.0 38.0 9 36.768 38.0 38.0 38.0 35.0 38.0 10-14 36.6779 38.0 38.0 38.0 34.8 38.0 15-19 36.4041 38.0 38.0 38.0 34.0 38.0 20-24 36.3386 38.0 38.0 38.0 33.8 38.0 25-29 36.4576 38.0 38.0 38.0 34.2 38.0 30-34 36.40835 38.0 38.0 38.0 34.2 38.0 35-39 36.05735 38.0 38.0 38.0 32.8 38.0 40-44 36.133050000000004 38.0 38.0 38.0 33.4 38.0 45-49 35.81385 38.0 37.4 38.0 31.0 38.0 50-54 35.92585 38.0 37.4 38.0 32.0 38.0 55-59 35.828950000000006 38.0 37.2 38.0 31.4 38.0 60-64 35.846500000000006 38.0 37.2 38.0 31.6 38.0 65-69 35.49730000000001 38.0 37.0 38.0 29.4 38.0 70-74 35.512100000000004 38.0 37.0 38.0 29.4 38.0 75-79 35.26455 38.0 36.6 38.0 28.8 38.0 80-84 35.11305 38.0 36.2 38.0 28.2 38.0 85-89 35.27125 38.0 36.6 38.0 28.6 38.0 90-94 35.13244999999999 38.0 36.2 38.0 28.6 38.0 95-99 34.83865000000001 38.0 36.0 38.0 26.8 38.0 100-104 34.4039 38.0 35.0 38.0 24.6 38.0 105-109 34.344649999999994 38.0 34.8 38.0 22.8 38.0 110-114 33.89190000000001 38.0 34.0 38.0 18.2 38.0 115-119 33.7235 38.0 34.0 38.0 19.0 38.0 120-124 32.9824 38.0 33.4 38.0 15.0 38.0 125-129 31.91075 37.2 31.0 38.0 14.8 38.0 130-134 31.054250000000003 36.4 30.0 38.0 13.4 38.0 135-139 30.172050000000002 36.0 27.0 38.0 13.0 38.0 140-144 28.90985 35.4 23.6 38.0 2.0 38.0 145-149 26.818450000000002 33.6 13.6 38.0 2.0 38.0 150-151 20.739874999999998 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 6.0 4 2.0 5 3.0 6 3.0 7 1.0 8 3.0 9 3.0 10 4.0 11 1.0 12 3.0 13 4.0 14 6.0 15 6.0 16 5.0 17 6.0 18 7.0 19 17.0 20 20.0 21 21.0 22 28.0 23 27.0 24 34.0 25 51.0 26 48.0 27 63.0 28 78.0 29 85.0 30 85.0 31 138.0 32 162.0 33 219.0 34 298.0 35 444.0 36 824.0 37 1282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 17.8 13.900000000000002 28.275 2 23.400000000000002 23.525 35.625 17.45 3 20.75 27.025 32.175 20.05 4 23.575 35.075 22.400000000000002 18.95 5 21.95 37.824999999999996 22.5 17.724999999999998 6 17.925 37.45 24.875 19.75 7 16.175 16.225 46.35 21.25 8 20.25 21.65 28.175 29.925 9 22.175 24.125 27.925 25.775 10-14 22.14 28.455000000000002 27.615000000000002 21.790000000000003 15-19 22.645 27.634999999999998 28.57 21.15 20-24 22.53 28.835 28.084999999999997 20.549999999999997 25-29 22.115000000000002 28.24 28.71 20.935000000000002 30-34 22.86 27.355 28.985 20.8 35-39 22.725 27.985 28.749999999999996 20.54 40-44 22.29 27.725 29.049999999999997 20.935000000000002 45-49 22.125 28.24 29.29 20.345 50-54 22.81 27.845 28.74 20.605 55-59 22.650000000000002 27.785 29.330000000000002 20.235 60-64 22.065 27.834999999999997 29.520000000000003 20.580000000000002 65-69 22.52 27.310000000000002 29.915000000000003 20.255000000000003 70-74 22.55 27.395000000000003 29.325000000000003 20.73 75-79 22.535 27.725 29.335 20.405 80-84 22.86 27.900000000000002 28.910000000000004 20.330000000000002 85-89 22.805 27.565 28.985 20.645 90-94 22.919999999999998 28.03 28.355000000000004 20.695 95-99 23.015 27.150000000000002 29.37 20.465 100-104 22.593389008351252 27.639145871880782 29.364404660699105 20.40306045906886 105-109 22.645190335651044 28.107648441798812 28.903006352858785 20.344154869691362 110-114 22.704540908181635 27.950590118023605 29.040808161632327 20.304060812162433 115-119 23.645 28.01 28.875 19.470000000000002 120-124 23.405 27.034999999999997 29.04 20.52 125-129 23.41 27.575 29.349999999999998 19.665 130-134 23.150000000000002 27.29 29.285 20.275000000000002 135-139 23.77 28.325 28.265 19.64 140-144 24.23 27.615000000000002 28.105000000000004 20.05 145-149 24.73 27.26 28.595 19.415 150-151 25.2125 25.8625 28.9 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.5 24 4.0 25 4.0 26 5.0 27 7.0 28 6.5 29 10.0 30 19.5 31 22.5 32 35.0 33 56.0 34 63.0 35 81.0 36 102.5 37 111.5 38 151.0 39 190.0 40 205.0 41 224.0 42 262.5 43 292.5 44 301.0 45 295.0 46 279.5 47 252.5 48 217.0 49 180.0 50 142.5 51 114.0 52 84.0 53 69.0 54 56.5 55 45.5 56 33.0 57 18.5 58 13.5 59 10.5 60 7.0 61 5.0 62 2.5 63 2.0 64 3.5 65 3.5 66 3.5 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.045 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54659949622166 98.8 2 0.327455919395466 0.65 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.025188916876574305 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 7 0.17500000000000002 No Hit AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.762499999999999 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 8.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAAAA 10 0.006830828 145.0 8 >>END_MODULE Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615004 spots for SRR7166183.sra Written 615004 spots for SRR7166183.sra Read 615021 spots for SRR7166183.sra Written 615021 spots for SRR7166183.sra SRR ids: ['SRR7166183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x3bxqk2r SRR7166183.sra spots: 12300097 blocks: [[1, 615004], [615005, 1230008], [1230009, 1845012], [1845013, 2460016], [2460017, 3075020], [3075021, 3690024], [3690025, 4305028], [4305029, 4920032], [4920033, 5535036], [5535037, 6150040], [6150041, 6765044], [6765045, 7380048], [7380049, 7995052], [7995053, 8610056], [8610057, 9225060], [9225061, 9840064], [9840065, 10455068], [10455069, 11070072], [11070073, 11685076], [11685077, 12300097]] SRR7166183 file size 4146398 SRR7166183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166183 SRR7166183_1.fastq SRR7166183_2.fastq Input file: SRR7166183_1.fastq Paired file: SRR7166183_2.fastq trimmed: SRR7166183-trimmed-pair1.fastq, SRR7166183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:57:46 2025 >> started Fri Feb 14 21:58:02 2025 >> done (15.983s) 12300097 read pairs processed; of these: 14119 ( 0.11%) short read pairs filtered out after trimming by size control 12483 ( 0.10%) empty read pairs filtered out after trimming by size control 12273495 (99.78%) read pairs available; of these: 7973606 (64.97%) trimmed read pairs available after processing 4299889 (35.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 6 0.00% 22 3 0.00% 23 3 0.00% 24 6 0.00% 25 4 0.00% 26 6 0.00% 27 1 0.00% 28 7 0.00% 29 7 0.00% 30 6 0.00% 31 10 0.00% 32 7 0.00% 33 9 0.00% 34 10 0.00% 35 10 0.00% 36 7 0.00% 37 14 0.00% 38 12 0.00% 39 17 0.00% 40 12 0.00% 41 18 0.00% 42 14 0.00% 43 19 0.00% 44 26 0.00% 45 16 0.00% 46 32 0.00% 47 28 0.00% 48 46 0.00% 49 37 0.00% 50 51 0.00% 51 59 0.00% 52 61 0.00% 53 88 0.00% 54 81 0.00% 55 89 0.00% 56 99 0.00% 57 131 0.00% 58 141 0.00% 59 183 0.00% 60 211 0.00% 61 242 0.00% 62 265 0.00% 63 305 0.00% 64 356 0.00% 65 393 0.00% 66 469 0.00% 67 470 0.00% 68 584 0.00% 69 671 0.01% 70 757 0.01% 71 902 0.01% 72 1058 0.01% 73 1212 0.01% 74 1201 0.01% 75 1258 0.01% 76 1433 0.01% 77 1449 0.01% 78 1586 0.01% 79 1795 0.01% 80 2021 0.02% 81 2388 0.02% 82 2605 0.02% 83 3143 0.03% 84 3984 0.03% 85 4532 0.04% 86 4649 0.04% 87 5126 0.04% 88 5431 0.04% 89 5789 0.05% 90 6509 0.05% 91 7758 0.06% 92 8636 0.07% 93 9287 0.08% 94 9417 0.08% 95 9923 0.08% 96 10256 0.08% 97 10936 0.09% 98 12151 0.10% 99 13282 0.11% 100 14039 0.11% 101 14866 0.12% 102 15181 0.12% 103 15508 0.13% 104 16718 0.14% 105 18184 0.15% 106 17965 0.15% 107 18107 0.15% 108 19580 0.16% 109 20632 0.17% 110 22571 0.18% 111 23336 0.19% 112 25976 0.21% 113 27769 0.23% 114 29337 0.24% 115 28973 0.24% 116 31097 0.25% 117 34522 0.28% 118 36738 0.30% 119 39564 0.32% 120 39933 0.33% 121 40486 0.33% 122 41543 0.34% 123 43811 0.36% 124 48433 0.39% 125 51185 0.42% 126 53731 0.44% 127 57106 0.47% 128 59319 0.48% 129 63905 0.52% 130 66874 0.54% 131 73124 0.60% 132 79130 0.64% 133 83663 0.68% 134 89962 0.73% 135 96176 0.78% 136 98218 0.80% 137 101603 0.83% 138 109906 0.90% 139 124507 1.01% 140 142523 1.16% 141 137316 1.12% 142 146005 1.19% 143 159770 1.30% 144 184652 1.50% 145 220355 1.80% 146 276601 2.25% 147 368751 3.00% 148 524547 4.27% 149 890631 7.26% 150 2873358 23.41% 151 4299889 35.03% 12273495 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=32 prefix-density=0.78 prefix-fanout=2.7 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=113.86 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=12.0 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=24 prefix-density=0.53 prefix-fanout=3.8 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=70.07 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=16.4 sequence=TTGGTGCTGAGA SRR7166183 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:59:03 Started mapping on | Feb 14 21:59:04 Finished on | Feb 14 22:01:13 Mapping speed, Million of reads per hour | 342.52 Number of input reads | 12273495 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11412366 Uniquely mapped reads % | 92.98% Average mapped length | 289.52 Number of splices: Total | 10441671 Number of splices: Annotated (sjdb) | 10247045 Number of splices: GT/AG | 10275135 Number of splices: GC/AG | 130432 Number of splices: AT/AC | 7348 Number of splices: Non-canonical | 28756 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347866 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 22172 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527828 527828 527828 N_multimapping 347866 347866 347866 N_noFeature 373873 11267358 457362 N_ambiguous 122166 576 60357 UnstrandedReadsAssigned:10916327 PositiveStrandReadsAssigned:144432 NegativeStrandReadsAssigned:10894647 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166183-trimmed-pair1.fastq SRR7166183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,273,495 reads, 10,829,616 reads pseudoaligned [quant] estimated average fragment length: 224.782 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR7166183.ke.tsv 34699 SRR7166183.se.tsv 87100 total ==> SRR7166183.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.22 1164 51.8807 Potri.005G024800.1.v4.1 1035 811.218 632 62.3028 Potri.004G059700.1.v4.1 961 737.227 7 0.759319 Potri.007G009000.2.v4.1 1416 1192.22 0 0 Potri.003G141000.2.v4.1 2943 2719.22 458.358 13.48 Potri.016G087400.1.v4.1 270 87.2459 870 797.447 Potri.015G069301.1.v4.1 564 343.05 0 0 Potri.010G195200.1.v4.1 1773 1549.22 527.907 27.2504 Potri.012G127500.1.v4.1 977 753.223 3668 389.434 ==> SRR7166183.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 238 SRR7166183 completed mapping pipeline successfully