Starting /dee2/code/volunteer_pipeline.sh SRR7166184 current disk space = 3107476639744 free memory = 1578748296 SRR7166184 SRAfilesize dcae2ac6596610b626d62651ff668286 SRR7166184.sra SRR7166184.sra file validated SRR7166184 is paired end SRR7166184 is conventional basespace SRR7166184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.862 18.0 18.0 25.0 18.0 32.0 2 23.0625 18.0 18.0 30.0 18.0 32.0 3 26.63575 27.0 25.0 30.0 18.0 33.0 4 28.1325 29.0 27.0 31.0 15.0 33.0 5 31.74875 33.0 32.0 33.0 30.0 33.0 6 35.832 37.0 36.0 38.0 33.0 38.0 7 36.377 38.0 36.0 38.0 33.0 38.0 8 36.8205 38.0 37.0 38.0 34.0 38.0 9 37.087 38.0 38.0 38.0 35.0 38.0 10-14 37.27875 38.0 38.0 38.0 36.6 38.0 15-19 37.44125 38.0 38.0 38.0 37.0 38.0 20-24 37.5056 38.0 38.0 38.0 37.2 38.0 25-29 37.49405 38.0 38.0 38.0 37.2 38.0 30-34 37.4639 38.0 38.0 38.0 37.4 38.0 35-39 37.40655 38.0 38.0 38.0 37.0 38.0 40-44 37.42785 38.0 38.0 38.0 37.0 38.0 45-49 37.46125 38.0 38.0 38.0 37.0 38.0 50-54 37.22175 38.0 38.0 38.0 37.0 38.0 55-59 36.83025 38.0 38.0 38.0 36.2 38.0 60-64 37.039199999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.19445 38.0 38.0 38.0 36.2 38.0 70-74 37.1811 38.0 38.0 38.0 36.2 38.0 75-79 37.076 38.0 38.0 38.0 36.0 38.0 80-84 37.04805 38.0 38.0 38.0 36.0 38.0 85-89 36.948699999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.8793 38.0 38.0 38.0 35.2 38.0 95-99 36.848 38.0 38.0 38.0 35.0 38.0 100-104 36.8005 38.0 38.0 38.0 35.0 38.0 105-109 36.52589999999999 38.0 38.0 38.0 34.2 38.0 110-114 36.482749999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.27505 38.0 37.8 38.0 34.0 38.0 120-124 36.197500000000005 38.0 37.2 38.0 33.6 38.0 125-129 36.02475 38.0 37.0 38.0 33.2 38.0 130-134 35.821799999999996 38.0 37.0 38.0 32.0 38.0 135-139 35.6002 38.0 36.0 38.0 31.0 38.0 140-144 35.32185 38.0 36.0 38.0 30.6 38.0 145-149 34.873650000000005 38.0 35.6 38.0 29.2 38.0 150-151 31.61875 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 3.0 20 1.0 21 0.0 22 2.0 23 6.0 24 6.0 25 9.0 26 3.0 27 9.0 28 20.0 29 39.0 30 40.0 31 38.0 32 85.0 33 95.0 34 183.0 35 297.0 36 846.0 37 2311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.754475703324808 26.547314578005114 9.514066496163682 38.18414322250639 2 16.900000000000002 32.925 30.075000000000003 20.1 3 17.424999999999997 33.425 24.9 24.25 4 20.25 36.825 20.599999999999998 22.325 5 20.16008004002001 38.64432216108054 22.536268134067033 18.659329664832416 6 17.05 37.3 24.525 21.125 7 12.2 20.599999999999998 44.800000000000004 22.400000000000002 8 17.9 21.65 27.0 33.45 9 18.475 22.0 30.775000000000002 28.749999999999996 10-14 19.595000000000002 30.245 26.38 23.78 15-19 19.515 28.785 27.495000000000005 24.205 20-24 19.439999999999998 29.425 27.46 23.674999999999997 25-29 19.355 29.7 27.560000000000002 23.385 30-34 19.885 29.015 27.57 23.53 35-39 19.650000000000002 29.53 27.305 23.515 40-44 19.335 29.705 26.865 24.095 45-49 19.470000000000002 29.12 27.634999999999998 23.775 50-54 19.66867469879518 29.116465863453815 27.429718875502008 23.785140562248998 55-59 19.76284584980237 28.848687544339718 27.759197324414714 23.629269281443193 60-64 19.398413176659638 28.69840313347394 28.000401727427942 23.902781962438485 65-69 19.801881128677206 28.572143285971585 27.98178907344407 23.644186511907144 70-74 19.759999999999998 28.804999999999996 27.810000000000002 23.625 75-79 19.5 29.080000000000002 27.639999999999997 23.78 80-84 19.53 28.610000000000003 27.965 23.895 85-89 19.84 29.020000000000003 27.644999999999996 23.494999999999997 90-94 20.064999999999998 28.38 27.91 23.645 95-99 19.900000000000002 28.439999999999998 27.62 24.04 100-104 19.78593578073422 28.78363509052716 28.00340102030609 23.42702810843253 105-109 19.893579639576327 28.768636112644945 27.824908388133125 23.5128758596456 110-114 20.159071582211997 28.943024360962433 27.177229753389025 23.720674303436546 115-119 20.253291284977724 28.157380988136353 27.721880162186512 23.867447564699404 120-124 20.687068706870686 28.702870287028702 27.35273527352735 23.257325732573257 125-129 20.49 28.095 27.705000000000002 23.71 130-134 20.369999999999997 28.99 27.095000000000002 23.544999999999998 135-139 20.57 28.63 27.375 23.425 140-144 20.845 28.815 26.490000000000002 23.849999999999998 145-149 20.755000000000003 28.415000000000003 27.055 23.775 150-151 20.930814462654823 28.725134492681097 26.460653071437505 23.88339797322657 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.5 18 1.5 19 0.5 20 1.5 21 1.5 22 2.5 23 2.5 24 2.0 25 2.5 26 5.5 27 9.0 28 11.0 29 14.0 30 20.5 31 31.0 32 36.5 33 49.0 34 58.5 35 80.5 36 108.5 37 125.5 38 159.0 39 183.5 40 205.5 41 231.5 42 251.5 43 274.5 44 272.0 45 261.0 46 252.5 47 241.0 48 223.5 49 198.5 50 169.5 51 128.5 52 97.5 53 75.0 54 54.5 55 43.0 56 30.5 57 23.5 58 21.0 59 11.0 60 6.0 61 4.0 62 3.5 63 3.0 64 2.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.4 55-59 1.3299999999999998 60-64 0.43 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.395 110-114 0.045 115-119 0.11499999999999999 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.25113008538422904 0.5 3 0.10045203415369162 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.699999999999999 0.0 0.0 0.0 0.0 136-137 7.325 0.0 0.0 0.0 0.0 138-139 7.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATACA 10 0.0069339755 144.27501 8 >>END_MODULE SRR7166184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96775 33.0 33.0 34.0 32.0 34.0 2 33.05075 34.0 33.0 34.0 32.0 34.0 3 33.122 34.0 33.0 34.0 32.0 34.0 4 33.09775 34.0 33.0 34.0 32.0 34.0 5 33.03525 34.0 33.0 34.0 33.0 34.0 6 37.27225 38.0 38.0 38.0 37.0 38.0 7 37.31425 38.0 38.0 38.0 37.0 38.0 8 37.25425 38.0 38.0 38.0 37.0 38.0 9 37.26175 38.0 38.0 38.0 37.0 38.0 10-14 37.24735 38.0 38.0 38.0 37.0 38.0 15-19 37.22955 38.0 38.0 38.0 37.0 38.0 20-24 37.26275 38.0 38.0 38.0 37.0 38.0 25-29 37.15205 38.0 38.0 38.0 36.8 38.0 30-34 37.1862 38.0 38.0 38.0 37.0 38.0 35-39 37.11595 38.0 38.0 38.0 37.0 38.0 40-44 37.0763 38.0 38.0 38.0 36.6 38.0 45-49 37.0381 38.0 38.0 38.0 36.2 38.0 50-54 36.86625 38.0 38.0 38.0 36.0 38.0 55-59 36.8772 38.0 38.0 38.0 36.0 38.0 60-64 36.880100000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.828450000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.7241 38.0 38.0 38.0 35.2 38.0 75-79 36.676750000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.58595 38.0 38.0 38.0 34.6 38.0 85-89 36.470749999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.437149999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.2159 38.0 38.0 38.0 33.6 38.0 100-104 36.08945 38.0 37.8 38.0 33.4 38.0 105-109 36.088049999999996 38.0 37.6 38.0 33.4 38.0 110-114 35.8519 38.0 37.0 38.0 32.6 38.0 115-119 35.62625 38.0 37.0 38.0 31.4 38.0 120-124 35.3289 38.0 36.2 38.0 30.0 38.0 125-129 35.11835000000001 38.0 36.0 38.0 28.0 38.0 130-134 34.7512 38.0 35.0 38.0 27.4 38.0 135-139 34.5911 38.0 35.0 38.0 27.2 38.0 140-144 34.07235 38.0 35.0 38.0 24.0 38.0 145-149 33.3006 38.0 34.2 38.0 18.2 38.0 150-151 29.09325 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 0.0 6 2.0 7 2.0 8 0.0 9 3.0 10 2.0 11 1.0 12 0.0 13 0.0 14 5.0 15 3.0 16 1.0 17 3.0 18 6.0 19 6.0 20 7.0 21 8.0 22 8.0 23 8.0 24 11.0 25 13.0 26 16.0 27 20.0 28 29.0 29 36.0 30 49.0 31 56.0 32 72.0 33 96.0 34 167.0 35 280.0 36 685.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 16.675 13.65 29.25 2 21.6 24.5 36.925000000000004 16.975 3 20.025000000000002 25.874999999999996 33.625 20.474999999999998 4 24.5 35.425000000000004 21.5 18.575 5 22.7 38.574999999999996 21.125 17.599999999999998 6 18.3295823955989 39.109777444361086 23.53088272068017 19.02975743935984 7 17.5293823455864 15.95398849712428 45.16129032258064 21.355338834708675 8 21.15 20.875 28.725 29.25 9 22.475 23.9 29.049999999999997 24.575 10-14 22.87614380719036 28.826441322066103 26.926346317315865 21.371068553427673 15-19 22.172217221722175 28.12281228122812 27.93779377937794 21.76717671767177 20-24 22.73841076161424 28.569285392808926 27.919187878181727 20.77311596739511 25-29 22.53013856235306 28.697914061327594 28.242709219148615 20.529238157170727 30-34 22.930732683170792 27.731932983245812 28.422105526381596 20.9152288072018 35-39 23.280820205051263 27.721930482620653 28.342085521380344 20.655163790947736 40-44 22.76455291058212 27.955591118223644 28.715743148629723 20.56411282256451 45-49 23.38818586505277 27.859750912819486 28.214875206322215 20.537188015805533 50-54 23.605343473257616 27.607945164356835 28.46850452794316 20.318206834442385 55-59 24.090840878395277 27.39732879795908 28.197688960032014 20.314141363613626 60-64 22.91572893223306 28.272068017004255 28.127031757939484 20.685171292823206 65-69 23.78475695139028 27.670534106821364 28.005601120224043 20.53910782156431 70-74 23.687765824368277 27.830873154866147 28.526394796097073 19.954966224668503 75-79 23.817863397548162 27.88591443582687 28.316237177883412 19.979984988741556 80-84 23.81285964473355 27.500625469101823 28.136102076557417 20.550412809607206 85-89 23.80595148787197 28.02200550137534 28.037009252313077 20.13503375843961 90-94 24.0132072639952 28.58572214718095 27.640202111161138 19.760868477662715 95-99 23.17237928446335 28.55641731298474 28.521391043282463 19.749812359269452 100-104 23.925766594967733 27.762493121904857 28.352758741433643 19.958981541693763 105-109 23.518231380983345 28.069824438553493 28.08482969039164 20.327114490071523 110-114 24.140691449442137 28.47851103217091 27.577925651673592 19.802871866713364 115-119 24.008006004503375 28.04603452589442 28.2661996497373 19.6797598198649 120-124 23.64773580185139 27.975981986489867 28.20615461596197 20.170127595696773 125-129 24.13309982486865 27.790843132349263 28.236177132849637 19.83987990993245 130-134 25.010004001600638 27.686074429771907 27.40096038415366 19.90296118447379 135-139 24.848697043965387 27.59965988095833 27.644675636472765 19.906967438603512 140-144 24.88497699539908 28.360672134426885 27.61052210442088 19.143828765753153 145-149 25.391347836959238 28.33708427106777 27.116779194798703 19.154788697174293 150-151 25.390673834229275 27.053381672709087 27.678459807475935 19.877484685585696 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 2.0 22 0.5 23 3.5 24 3.5 25 3.0 26 3.5 27 4.0 28 5.5 29 8.5 30 14.0 31 17.5 32 24.5 33 38.5 34 46.0 35 56.0 36 86.5 37 120.5 38 136.0 39 169.5 40 209.0 41 232.0 42 257.0 43 275.0 44 285.5 45 294.0 46 299.0 47 273.0 48 229.5 49 195.5 50 161.0 51 116.0 52 94.5 53 92.0 54 72.0 55 44.5 56 29.0 57 27.0 58 21.0 59 13.5 60 9.5 61 5.5 62 4.0 63 3.0 64 3.5 65 3.0 66 1.5 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.015 25-29 0.045 30-34 0.025 35-39 0.025 40-44 0.02 45-49 0.034999999999999996 50-54 0.065 55-59 0.045 60-64 0.025 65-69 0.02 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.025 90-94 0.055 95-99 0.075 100-104 0.045 105-109 0.034999999999999996 110-114 0.065 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.04 135-139 0.034999999999999996 140-144 0.02 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59677419354838 98.8 2 0.25201612903225806 0.5 3 0.05040322580645161 0.15 4 0.05040322580645161 0.2 5 0.0 0.0 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.025201612903225805 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 8 0.2 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.3875 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845379 spots for SRR7166184.sra Written 845379 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra Read 845374 spots for SRR7166184.sra Written 845374 spots for SRR7166184.sra SRR ids: ['SRR7166184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2m3bfci5 SRR7166184.sra spots: 16907485 blocks: [[1, 845374], [845375, 1690748], [1690749, 2536122], [2536123, 3381496], [3381497, 4226870], [4226871, 5072244], [5072245, 5917618], [5917619, 6762992], [6762993, 7608366], [7608367, 8453740], [8453741, 9299114], [9299115, 10144488], [10144489, 10989862], [10989863, 11835236], [11835237, 12680610], [12680611, 13525984], [13525985, 14371358], [14371359, 15216732], [15216733, 16062106], [16062107, 16907485]] SRR7166184 file size 5707691 SRR7166184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166184 SRR7166184_1.fastq SRR7166184_2.fastq Input file: SRR7166184_1.fastq Paired file: SRR7166184_2.fastq trimmed: SRR7166184-trimmed-pair1.fastq, SRR7166184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 22:35:13 2025 >> started Fri Feb 14 22:35:33 2025 >> done (20.575s) 16907485 read pairs processed; of these: 12414 ( 0.07%) short read pairs filtered out after trimming by size control 14250 ( 0.08%) empty read pairs filtered out after trimming by size control 16880821 (99.84%) read pairs available; of these: 7553638 (44.75%) trimmed read pairs available after processing 9327183 (55.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 3 0.00% 26 5 0.00% 27 12 0.00% 28 8 0.00% 29 12 0.00% 30 7 0.00% 31 9 0.00% 32 9 0.00% 33 9 0.00% 34 5 0.00% 35 11 0.00% 36 11 0.00% 37 9 0.00% 38 19 0.00% 39 13 0.00% 40 21 0.00% 41 12 0.00% 42 15 0.00% 43 14 0.00% 44 18 0.00% 45 20 0.00% 46 34 0.00% 47 40 0.00% 48 40 0.00% 49 41 0.00% 50 46 0.00% 51 63 0.00% 52 66 0.00% 53 70 0.00% 54 67 0.00% 55 88 0.00% 56 100 0.00% 57 110 0.00% 58 138 0.00% 59 159 0.00% 60 169 0.00% 61 235 0.00% 62 236 0.00% 63 272 0.00% 64 294 0.00% 65 327 0.00% 66 415 0.00% 67 465 0.00% 68 512 0.00% 69 519 0.00% 70 636 0.00% 71 820 0.00% 72 900 0.01% 73 1089 0.01% 74 1219 0.01% 75 1310 0.01% 76 1482 0.01% 77 1694 0.01% 78 1869 0.01% 79 2083 0.01% 80 2506 0.01% 81 2760 0.02% 82 3191 0.02% 83 3758 0.02% 84 4760 0.03% 85 5085 0.03% 86 5483 0.03% 87 5726 0.03% 88 6292 0.04% 89 6547 0.04% 90 7457 0.04% 91 8244 0.05% 92 8971 0.05% 93 9900 0.06% 94 10787 0.06% 95 11227 0.07% 96 12028 0.07% 97 12547 0.07% 98 13182 0.08% 99 14469 0.09% 100 14937 0.09% 101 16107 0.10% 102 17382 0.10% 103 18586 0.11% 104 19390 0.11% 105 20645 0.12% 106 21770 0.13% 107 22175 0.13% 108 23142 0.14% 109 23913 0.14% 110 25006 0.15% 111 26189 0.16% 112 28016 0.17% 113 29889 0.18% 114 31850 0.19% 115 33525 0.20% 116 34629 0.21% 117 35763 0.21% 118 36490 0.22% 119 37350 0.22% 120 38373 0.23% 121 40220 0.24% 122 42136 0.25% 123 44391 0.26% 124 46652 0.28% 125 48114 0.29% 126 50188 0.30% 127 51921 0.31% 128 52472 0.31% 129 53665 0.32% 130 55994 0.33% 131 57507 0.34% 132 61058 0.36% 133 64464 0.38% 134 68489 0.41% 135 72432 0.43% 136 74820 0.44% 137 79337 0.47% 138 83330 0.49% 139 87008 0.52% 140 92146 0.55% 141 100418 0.59% 142 109502 0.65% 143 120027 0.71% 144 137884 0.82% 145 161347 0.96% 146 197901 1.17% 147 257174 1.52% 148 381438 2.26% 149 718200 4.25% 150 3415474 20.23% 151 9327183 55.25% 16880821 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=19 prefix-density=0.99 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=299.48 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.8 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTT criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=31 prefix-density=0.98 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=21.79 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCAC SRR7166184 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 22:36:53 Started mapping on | Feb 14 22:36:53 Finished on | Feb 14 22:38:44 Mapping speed, Million of reads per hour | 547.49 Number of input reads | 16880821 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16043284 Uniquely mapped reads % | 95.04% Average mapped length | 293.19 Number of splices: Total | 15564989 Number of splices: Annotated (sjdb) | 15276994 Number of splices: GT/AG | 15314589 Number of splices: GC/AG | 195731 Number of splices: AT/AC | 12854 Number of splices: Non-canonical | 41815 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446321 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 37668 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402034 402034 402034 N_multimapping 446321 446321 446321 N_noFeature 521578 15856185 625119 N_ambiguous 171684 941 87530 UnstrandedReadsAssigned:15350022 PositiveStrandReadsAssigned:186158 NegativeStrandReadsAssigned:15330635 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166184-trimmed-pair1.fastq SRR7166184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,880,821 reads, 15,189,659 reads pseudoaligned [quant] estimated average fragment length: 237.56 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR7166184.ke.tsv 34699 SRR7166184.se.tsv 87100 total ==> SRR7166184.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.44 1171 39.6601 Potri.005G024800.1.v4.1 1035 798.44 259 19.5716 Potri.004G059700.1.v4.1 961 724.47 26 2.16532 Potri.007G009000.2.v4.1 1416 1179.44 0 0 Potri.003G141000.2.v4.1 2943 2706.44 664.207 14.8072 Potri.016G087400.1.v4.1 270 85.4445 1171.38 827.145 Potri.015G069301.1.v4.1 564 334.296 0 0 Potri.010G195200.1.v4.1 1773 1536.44 429.893 16.8816 Potri.012G127500.1.v4.1 977 740.455 2820 229.783 ==> SRR7166184.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 577 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 530 SRR7166184 completed mapping pipeline successfully