Starting /dee2/code/volunteer_pipeline.sh SRR7166185 current disk space = 3108914601984 free memory = 1448604108 SRR7166185 SRAfilesize b251f13e61aca5c0bcb5750e9559a3bf SRR7166185.sra SRR7166185.sra file validated SRR7166185 is paired end SRR7166185 is conventional basespace SRR7166185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.24475 18.0 18.0 18.0 18.0 30.0 2 28.25575 27.0 27.0 32.0 27.0 32.0 3 30.24825 32.0 30.0 32.0 25.0 33.0 4 30.49825 32.0 31.0 33.0 27.0 33.0 5 32.25425 33.0 32.0 33.0 32.0 33.0 6 36.08475 38.0 36.0 38.0 33.0 38.0 7 37.07775 38.0 38.0 38.0 35.0 38.0 8 37.2315 38.0 38.0 38.0 36.0 38.0 9 37.338 38.0 38.0 38.0 37.0 38.0 10-14 37.3859 38.0 38.0 38.0 37.0 38.0 15-19 37.473200000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.4497 38.0 38.0 38.0 37.0 38.0 25-29 37.461800000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.4106 38.0 38.0 38.0 37.0 38.0 35-39 37.37185 38.0 38.0 38.0 37.0 38.0 40-44 37.37 38.0 38.0 38.0 37.0 38.0 45-49 37.29774999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.1258 38.0 38.0 38.0 36.6 38.0 55-59 36.59375 38.0 38.0 38.0 35.8 38.0 60-64 36.8645 38.0 38.0 38.0 35.8 38.0 65-69 37.020849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.96515 38.0 38.0 38.0 35.6 38.0 75-79 36.882 38.0 38.0 38.0 35.6 38.0 80-84 36.72295 38.0 38.0 38.0 34.8 38.0 85-89 36.76625 38.0 38.0 38.0 35.2 38.0 90-94 36.6029 38.0 38.0 38.0 34.4 38.0 95-99 36.462900000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.401450000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.173199999999994 38.0 37.8 38.0 33.4 38.0 110-114 36.20735 38.0 37.4 38.0 33.6 38.0 115-119 36.1271 38.0 37.0 38.0 33.4 38.0 120-124 35.81035 38.0 37.0 38.0 31.4 38.0 125-129 35.67190000000001 38.0 36.6 38.0 31.2 38.0 130-134 35.5443 38.0 36.0 38.0 31.0 38.0 135-139 35.290350000000004 38.0 36.0 38.0 30.0 38.0 140-144 34.892399999999995 38.0 35.6 38.0 28.0 38.0 145-149 34.239799999999995 38.0 35.0 38.0 25.2 38.0 150-151 31.375999999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 1.0 17 2.0 18 2.0 19 4.0 20 0.0 21 1.0 22 3.0 23 5.0 24 12.0 25 12.0 26 19.0 27 12.0 28 32.0 29 35.0 30 49.0 31 54.0 32 70.0 33 121.0 34 178.0 35 319.0 36 743.0 37 2320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.781386955400878 19.412219644238206 34.544985821087906 34.261407579273005 2 20.275000000000002 24.55 37.95 17.224999999999998 3 16.879219804951237 30.057514378594647 28.707176794198553 24.356089022255563 4 20.25 35.025 23.95 20.775 5 20.65 37.25 24.2 17.9 6 15.4 37.675 24.85 22.075 7 12.1 19.575 46.675 21.65 8 17.8 20.8 28.975 32.425 9 18.125 21.7 31.15 29.025000000000002 10-14 19.595000000000002 29.815 26.185000000000002 24.404999999999998 15-19 19.12 29.175 27.634999999999998 24.07 20-24 19.86 28.865000000000002 27.38 23.895 25-29 19.830000000000002 29.165000000000003 27.42 23.585 30-34 19.55 28.95 27.47 24.03 35-39 19.445 28.51 28.015 24.03 40-44 20.445 29.134999999999998 27.575 22.845 45-49 19.470000000000002 28.875 27.584999999999997 24.07 50-54 19.507423756019264 28.81219903691814 27.447833065810595 24.232544141252006 55-59 19.60286425270428 28.596820882636738 27.916306942257883 23.884007922401096 60-64 20.14753111200321 29.280409474106783 26.671015656362908 23.901043757527095 65-69 20.0 28.77 27.794999999999998 23.435 70-74 20.285 28.384999999999998 27.775 23.555 75-79 19.82 28.585 27.224999999999998 24.37 80-84 19.56 28.744999999999997 28.24 23.455000000000002 85-89 19.46 28.835 28.310000000000002 23.395 90-94 20.455000000000002 29.060000000000002 27.07 23.415 95-99 20.085 28.285 28.075 23.555 100-104 20.119999999999997 28.585 27.685 23.61 105-109 19.718591958339594 28.66155926092835 27.8754193580692 23.74442942266286 110-114 20.385 28.335 27.744999999999997 23.535 115-119 20.79 28.225 27.655 23.330000000000002 120-124 20.169999999999998 28.655 27.79 23.385 125-129 20.29 28.63 27.315 23.765 130-134 20.845 28.615000000000002 26.955000000000002 23.585 135-139 20.82 28.815 26.595000000000002 23.77 140-144 20.68 28.77 26.924999999999997 23.625 145-149 21.23 28.32 27.095000000000002 23.355 150-151 20.81091227631085 28.381929670879742 26.52984607683644 24.27731197597297 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 1.5 20 1.0 21 1.5 22 2.5 23 1.5 24 1.5 25 6.0 26 8.0 27 9.0 28 10.5 29 14.5 30 19.5 31 23.0 32 31.5 33 48.0 34 79.5 35 91.5 36 104.0 37 129.5 38 150.0 39 169.0 40 203.0 41 250.0 42 259.0 43 268.0 44 272.5 45 261.0 46 254.5 47 243.0 48 230.5 49 195.0 50 145.5 51 125.5 52 106.5 53 71.0 54 57.5 55 46.0 56 28.0 57 21.0 58 15.0 59 5.5 60 3.5 61 6.5 62 6.0 63 5.5 64 5.5 65 4.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.32 55-59 1.545 60-64 0.36 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.145 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.55 0.0 0.0 0.0 0.0 134-135 5.987500000000001 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACT 10 0.0069627957 144.075 8 >>END_MODULE SRR7166185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93975 33.0 33.0 34.0 32.0 34.0 2 33.00375 33.0 33.0 34.0 32.0 34.0 3 33.06825 34.0 33.0 34.0 32.0 34.0 4 33.04125 34.0 33.0 34.0 32.0 34.0 5 33.0095 34.0 33.0 34.0 32.0 34.0 6 37.23175 38.0 38.0 38.0 37.0 38.0 7 37.2905 38.0 38.0 38.0 37.0 38.0 8 37.27275 38.0 38.0 38.0 37.0 38.0 9 37.268 38.0 38.0 38.0 37.0 38.0 10-14 37.258300000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.23685 38.0 38.0 38.0 37.0 38.0 20-24 37.207750000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.14815 38.0 38.0 38.0 36.6 38.0 30-34 37.1095 38.0 38.0 38.0 36.0 38.0 35-39 37.053650000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.02 38.0 38.0 38.0 36.0 38.0 45-49 36.8613 38.0 38.0 38.0 36.0 38.0 50-54 36.81465 38.0 38.0 38.0 35.8 38.0 55-59 36.763149999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.7611 38.0 38.0 38.0 35.2 38.0 65-69 36.69225 38.0 38.0 38.0 35.0 38.0 70-74 36.61875 38.0 38.0 38.0 34.8 38.0 75-79 36.442699999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.41785 38.0 38.0 38.0 34.0 38.0 85-89 36.3727 38.0 38.0 38.0 34.0 38.0 90-94 36.13805 38.0 37.6 38.0 33.2 38.0 95-99 35.9743 38.0 37.0 38.0 33.0 38.0 100-104 35.888149999999996 38.0 37.0 38.0 32.8 38.0 105-109 35.734700000000004 38.0 37.0 38.0 31.2 38.0 110-114 35.52305 38.0 36.8 38.0 30.6 38.0 115-119 35.2284 38.0 36.0 38.0 28.6 38.0 120-124 35.0523 38.0 36.0 38.0 28.0 38.0 125-129 34.8534 38.0 35.8 38.0 27.4 38.0 130-134 34.56914999999999 38.0 35.0 38.0 26.2 38.0 135-139 34.2466 38.0 35.0 38.0 24.4 38.0 140-144 33.671299999999995 38.0 34.0 38.0 21.4 38.0 145-149 32.699650000000005 38.0 33.6 38.0 15.0 38.0 150-151 28.638624999999998 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 0.0 6 0.0 7 3.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 1.0 15 6.0 16 4.0 17 5.0 18 4.0 19 5.0 20 10.0 21 3.0 22 10.0 23 12.0 24 10.0 25 26.0 26 27.0 27 21.0 28 31.0 29 45.0 30 43.0 31 55.0 32 93.0 33 118.0 34 203.0 35 320.0 36 676.0 37 2255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75 15.85 14.7 29.7 2 22.775000000000002 24.8 36.025 16.400000000000002 3 20.150000000000002 27.525 31.974999999999998 20.349999999999998 4 23.1807951987997 35.533883470867714 21.73043260815204 19.554888722180543 5 23.53088272068017 38.234558639659916 21.405351337834457 16.829207301825456 6 16.325 39.25 25.174999999999997 19.25 7 16.375 15.775 46.075 21.775 8 20.775 21.25 27.125 30.85 9 21.8 23.625 28.725 25.85 10-14 22.805 29.189999999999998 26.979999999999997 21.025 15-19 23.04 28.249999999999996 28.060000000000002 20.65 20-24 22.865 28.225 28.249999999999996 20.66 25-29 22.58 27.884999999999998 29.195 20.34 30-34 23.155 28.470000000000002 27.875 20.5 35-39 23.175 27.605 28.549999999999997 20.669999999999998 40-44 23.195 28.115000000000002 28.285 20.405 45-49 22.900000000000002 28.235 28.615000000000002 20.25 50-54 23.05 28.32 27.87 20.76 55-59 23.57 27.85 27.575 21.005 60-64 23.03 28.51 28.13 20.330000000000002 65-69 23.06 27.57 28.845 20.525 70-74 23.724999999999998 27.584999999999997 28.605000000000004 20.085 75-79 23.549999999999997 27.435 28.51 20.505000000000003 80-84 23.305 27.83 28.435 20.43 85-89 23.78 26.99 28.660000000000004 20.57 90-94 23.965 27.905 28.075 20.055 95-99 23.89 28.15 27.855 20.105 100-104 24.39 27.83 27.939999999999998 19.84 105-109 23.54 27.915 28.12 20.424999999999997 110-114 23.54 28.845 27.689999999999998 19.925 115-119 24.22 28.055000000000003 28.275 19.45 120-124 24.505 28.134999999999998 27.894999999999996 19.465 125-129 23.985 28.425 27.694999999999997 19.895 130-134 24.64 27.76 27.705000000000002 19.895 135-139 24.69 27.87 27.52 19.919999999999998 140-144 24.635 28.205000000000002 27.200000000000003 19.96 145-149 25.485000000000003 28.54 26.71 19.265 150-151 24.88122030507627 28.557139284821204 26.556639159789945 20.005001250312578 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 1.5 23 0.5 24 2.0 25 4.0 26 7.0 27 8.5 28 8.5 29 7.0 30 12.5 31 23.5 32 30.0 33 39.5 34 49.5 35 62.0 36 80.0 37 100.0 38 141.0 39 182.0 40 205.5 41 219.5 42 269.5 43 293.0 44 285.5 45 299.5 46 270.5 47 250.0 48 223.0 49 182.5 50 168.0 51 138.5 52 105.5 53 83.0 54 63.0 55 43.0 56 28.0 57 22.0 58 20.5 59 21.5 60 15.0 61 8.5 62 5.0 63 4.0 64 3.0 65 2.0 66 2.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57189624779652 98.85000000000001 2 0.35255603122639134 0.7000000000000001 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02518257365902795 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 9 0.22499999999999998 No Hit GCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.175000000000001 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGGT 10 0.006830828 145.0 145 AAAAAAA 40 0.0076550315 18.125 75-79 >>END_MODULE Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865699 spots for SRR7166185.sra Written 865699 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra Read 865691 spots for SRR7166185.sra Written 865691 spots for SRR7166185.sra SRR ids: ['SRR7166185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5hnfn88j SRR7166185.sra spots: 17313828 blocks: [[1, 865691], [865692, 1731382], [1731383, 2597073], [2597074, 3462764], [3462765, 4328455], [4328456, 5194146], [5194147, 6059837], [6059838, 6925528], [6925529, 7791219], [7791220, 8656910], [8656911, 9522601], [9522602, 10388292], [10388293, 11253983], [11253984, 12119674], [12119675, 12985365], [12985366, 13851056], [13851057, 14716747], [14716748, 15582438], [15582439, 16448129], [16448130, 17313828]] SRR7166185 file size 5845387 SRR7166185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166185 SRR7166185_1.fastq SRR7166185_2.fastq Input file: SRR7166185_1.fastq Paired file: SRR7166185_2.fastq trimmed: SRR7166185-trimmed-pair1.fastq, SRR7166185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:30:42 2025 >> started Fri Feb 14 21:31:14 2025 >> done (32.308s) 17313828 read pairs processed; of these: 9066 ( 0.05%) short read pairs filtered out after trimming by size control 9028 ( 0.05%) empty read pairs filtered out after trimming by size control 17295734 (99.90%) read pairs available; of these: 7728056 (44.68%) trimmed read pairs available after processing 9567678 (55.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 4 0.00% 23 6 0.00% 24 10 0.00% 25 6 0.00% 26 7 0.00% 27 10 0.00% 28 6 0.00% 29 6 0.00% 30 8 0.00% 31 5 0.00% 32 7 0.00% 33 7 0.00% 34 8 0.00% 35 15 0.00% 36 13 0.00% 37 10 0.00% 38 4 0.00% 39 10 0.00% 40 18 0.00% 41 14 0.00% 42 19 0.00% 43 12 0.00% 44 25 0.00% 45 25 0.00% 46 29 0.00% 47 21 0.00% 48 39 0.00% 49 42 0.00% 50 38 0.00% 51 54 0.00% 52 71 0.00% 53 58 0.00% 54 76 0.00% 55 76 0.00% 56 102 0.00% 57 115 0.00% 58 158 0.00% 59 150 0.00% 60 174 0.00% 61 198 0.00% 62 250 0.00% 63 250 0.00% 64 294 0.00% 65 321 0.00% 66 362 0.00% 67 494 0.00% 68 482 0.00% 69 545 0.00% 70 645 0.00% 71 769 0.00% 72 894 0.01% 73 1072 0.01% 74 1149 0.01% 75 1269 0.01% 76 1406 0.01% 77 1604 0.01% 78 1796 0.01% 79 2074 0.01% 80 2368 0.01% 81 2768 0.02% 82 3206 0.02% 83 3560 0.02% 84 4248 0.02% 85 5005 0.03% 86 5446 0.03% 87 5793 0.03% 88 6299 0.04% 89 6601 0.04% 90 7343 0.04% 91 8092 0.05% 92 8911 0.05% 93 9685 0.06% 94 10484 0.06% 95 11085 0.06% 96 11790 0.07% 97 12456 0.07% 98 13185 0.08% 99 14853 0.09% 100 14573 0.08% 101 16047 0.09% 102 16835 0.10% 103 18198 0.11% 104 19312 0.11% 105 20663 0.12% 106 21227 0.12% 107 22088 0.13% 108 22601 0.13% 109 24170 0.14% 110 25041 0.14% 111 26253 0.15% 112 27930 0.16% 113 29836 0.17% 114 31559 0.18% 115 32854 0.19% 116 34435 0.20% 117 35522 0.21% 118 36755 0.21% 119 37659 0.22% 120 38348 0.22% 121 40158 0.23% 122 42236 0.24% 123 44127 0.26% 124 47055 0.27% 125 48603 0.28% 126 49630 0.29% 127 51567 0.30% 128 52479 0.30% 129 54601 0.32% 130 56537 0.33% 131 58735 0.34% 132 61479 0.36% 133 64839 0.37% 134 68316 0.39% 135 72317 0.42% 136 75455 0.44% 137 78980 0.46% 138 83504 0.48% 139 87939 0.51% 140 93545 0.54% 141 101537 0.59% 142 110939 0.64% 143 122329 0.71% 144 142085 0.82% 145 167287 0.97% 146 203583 1.18% 147 266275 1.54% 148 391839 2.27% 149 740124 4.28% 150 3527518 20.40% 151 9567678 55.32% 17295734 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=91.35 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=TTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCT criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=30 prefix-density=1.18 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=80.17 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.6 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166185 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:32:33 Started mapping on | Feb 14 21:32:33 Finished on | Feb 14 21:35:51 Mapping speed, Million of reads per hour | 314.47 Number of input reads | 17295734 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16136297 Uniquely mapped reads % | 93.30% Average mapped length | 293.38 Number of splices: Total | 16040139 Number of splices: Annotated (sjdb) | 15745921 Number of splices: GT/AG | 15783833 Number of splices: GC/AG | 203845 Number of splices: AT/AC | 11870 Number of splices: Non-canonical | 40591 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442521 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 35238 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 726541 726541 726541 N_multimapping 442521 442521 442521 N_noFeature 521675 15945624 630965 N_ambiguous 159051 1109 76895 UnstrandedReadsAssigned:15455571 PositiveStrandReadsAssigned:189564 NegativeStrandReadsAssigned:15428437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166185-trimmed-pair1.fastq SRR7166185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,295,734 reads, 15,293,739 reads pseudoaligned [quant] estimated average fragment length: 240.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7166185.ke.tsv 34699 SRR7166185.se.tsv 87100 total ==> SRR7166185.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.06 1751 58.9719 Potri.005G024800.1.v4.1 1035 795.065 222 16.7208 Potri.004G059700.1.v4.1 961 721.13 20 1.66082 Potri.007G009000.2.v4.1 1416 1176.06 0 0 Potri.003G141000.2.v4.1 2943 2703.06 808.73 17.9165 Potri.016G087400.1.v4.1 270 85.1063 999 702.928 Potri.015G069301.1.v4.1 564 331.988 0 0 Potri.010G195200.1.v4.1 1773 1533.06 736.919 28.785 Potri.012G127500.1.v4.1 977 737.1 3165 257.131 ==> SRR7166185.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 490 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 577 SRR7166185 completed mapping pipeline successfully