Starting /dee2/code/volunteer_pipeline.sh SRR7166186 current disk space = 3107087380480 free memory = 1569432036 SRR7166186 SRAfilesize 369a91e79c71f871b4e5931e79f7c666 SRR7166186.sra SRR7166186.sra file validated SRR7166186 is paired end SRR7166186 is conventional basespace SRR7166186 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166186_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9975 33.0 32.0 34.0 31.0 34.0 2 32.06475 33.0 33.0 34.0 29.0 34.0 3 32.24475 33.0 33.0 34.0 29.0 34.0 4 32.114 33.0 33.0 34.0 29.0 34.0 5 32.0975 33.0 33.0 34.0 30.0 34.0 6 36.47775 38.0 37.0 38.0 34.0 38.0 7 36.7245 38.0 38.0 38.0 34.0 38.0 8 36.941 38.0 38.0 38.0 35.0 38.0 9 36.685 38.0 38.0 38.0 34.0 38.0 10-14 37.015499999999996 38.0 38.0 38.0 35.8 38.0 15-19 36.9913 38.0 38.0 38.0 35.6 38.0 20-24 36.99014999999999 38.0 38.0 38.0 35.6 38.0 25-29 36.70085 38.0 38.0 38.0 34.6 38.0 30-34 36.12955000000001 38.0 37.2 38.0 32.4 38.0 35-39 36.107600000000005 38.0 37.0 38.0 32.6 38.0 40-44 36.056850000000004 38.0 37.0 38.0 32.0 38.0 45-49 35.760450000000006 38.0 36.6 38.0 30.2 38.0 50-54 35.5449 38.0 36.4 38.0 29.6 38.0 55-59 35.37795 38.0 36.0 38.0 29.0 38.0 60-64 35.2373 38.0 35.8 38.0 28.6 38.0 65-69 35.31785 38.0 35.8 38.0 28.6 38.0 70-74 35.1408 38.0 35.8 38.0 28.4 38.0 75-79 34.58895 38.0 35.2 38.0 26.2 38.0 80-84 34.2962 38.0 34.6 38.0 25.2 38.0 85-89 34.16985 38.0 34.2 38.0 23.2 38.0 90-94 34.3952 38.0 34.2 38.0 24.8 38.0 95-99 34.06224999999999 38.0 34.0 38.0 20.6 38.0 100-104 33.53385000000001 37.2 33.4 38.0 16.6 38.0 105-109 33.032650000000004 37.2 32.4 38.0 15.0 38.0 110-114 32.24065 37.0 30.2 38.0 15.0 38.0 115-119 31.9658 36.8 29.0 38.0 15.0 38.0 120-124 31.33925 36.2 28.6 38.0 15.0 38.0 125-129 30.2836 35.2 25.2 38.0 14.4 38.0 130-134 28.6923 34.0 22.4 38.0 13.0 38.0 135-139 27.3435 33.0 17.2 38.0 2.0 38.0 140-144 25.999899999999997 33.0 13.4 38.0 2.0 38.0 145-149 23.84405 31.4 6.4 38.0 2.0 38.0 150-151 17.889125 16.5 2.0 33.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 1.0 14 0.0 15 5.0 16 5.0 17 5.0 18 7.0 19 15.0 20 17.0 21 29.0 22 43.0 23 37.0 24 49.0 25 67.0 26 79.0 27 102.0 28 125.0 29 128.0 30 161.0 31 188.0 32 271.0 33 338.0 34 435.0 35 607.0 36 815.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.3134328358209 17.91044776119403 10.270680495825955 34.50543890715912 2 19.05 25.924999999999997 36.85 18.175 3 17.849999999999998 31.75 25.974999999999998 24.425 4 21.15 37.2 22.25 19.400000000000002 5 19.975 38.05 23.9 18.075 6 15.775 38.0 25.674999999999997 20.549999999999997 7 12.0 19.35 46.2 22.45 8 17.424999999999997 21.325 28.625 32.625 9 16.8 22.825 31.65 28.725 10-14 19.54 30.505 26.41 23.544999999999998 15-19 19.605 28.904999999999998 27.994999999999997 23.494999999999997 20-24 19.48 29.270000000000003 28.139999999999997 23.11 25-29 19.08 29.995 28.09 22.835 30-34 19.62 29.965000000000003 27.725 22.689999999999998 35-39 19.39 29.565 27.925 23.119999999999997 40-44 19.29 29.785 27.700000000000003 23.225 45-49 20.355 29.24 27.54 22.865 50-54 19.975 29.48 27.115000000000002 23.43 55-59 19.64 29.13 27.83 23.400000000000002 60-64 19.57 29.685 27.965 22.78 65-69 20.205000000000002 29.299999999999997 28.084999999999997 22.41 70-74 19.874749498997996 29.36372745490982 27.77555110220441 22.985971943887776 75-79 19.70836297124276 28.7572401178742 28.294888730820038 23.239508180063 80-84 19.69249567253844 29.014356990123208 27.955401690255577 23.33774564708278 85-89 20.281084325297588 29.59887966389917 27.513253976192857 22.606782034610383 90-94 20.05200520052005 28.682868286828683 28.467846784678468 22.797279727972796 95-99 20.505000000000003 28.799999999999997 28.01 22.685 100-104 20.18 29.235 27.55 23.035 105-109 20.02 29.044999999999998 27.794999999999998 23.14 110-114 20.380000000000003 29.115000000000002 27.72 22.785 115-119 20.93 29.17 27.63 22.27 120-124 20.530663329161452 29.682102628285357 27.143929912390487 22.643304130162704 125-129 20.930465734195618 28.806336792500126 27.262244949115157 23.0009525241891 130-134 21.150918501979092 28.98609560539937 27.423119861970974 22.439866030650563 135-139 21.416009245766546 29.852771217526758 26.63685241947641 22.09436711723029 140-144 21.495 30.104999999999997 26.619999999999997 21.78 145-149 21.13075637063681 28.922437813465727 26.88586047925427 23.060945336643194 150-151 21.831869510664994 26.76286072772898 27.37766624843162 24.0276035131744 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 6.0 25 8.5 26 11.0 27 12.5 28 15.0 29 21.0 30 31.5 31 40.5 32 47.0 33 54.0 34 62.0 35 87.0 36 117.5 37 140.5 38 160.0 39 192.0 40 219.5 41 239.5 42 271.0 43 268.0 44 262.5 45 265.5 46 243.5 47 223.5 48 196.0 49 169.5 50 152.5 51 124.5 52 89.5 53 70.5 54 53.5 55 37.0 56 30.0 57 21.5 58 14.0 59 9.0 60 7.0 61 3.5 62 2.0 63 4.0 64 4.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.2 75-79 1.59 80-84 1.79 85-89 0.03 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.125 125-129 0.265 130-134 1.47 135-139 0.49500000000000005 140-144 0.0 145-149 1.3050000000000002 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.449999999999999 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGGA 10 0.0064405166 147.83333 1 >>END_MODULE SRR7166186 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166186_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.527 33.0 33.0 34.0 32.0 34.0 2 32.568 33.0 33.0 34.0 32.0 34.0 3 32.51875 33.0 33.0 34.0 31.0 34.0 4 32.36625 33.0 33.0 34.0 31.0 34.0 5 32.542 33.0 33.0 34.0 32.0 34.0 6 36.501 38.0 38.0 38.0 34.0 38.0 7 36.5875 38.0 38.0 38.0 35.0 38.0 8 36.5455 38.0 38.0 38.0 34.0 38.0 9 36.58575 38.0 38.0 38.0 35.0 38.0 10-14 36.46625 38.0 38.0 38.0 34.2 38.0 15-19 36.089749999999995 38.0 38.0 38.0 33.0 38.0 20-24 36.06965 38.0 38.0 38.0 33.0 38.0 25-29 36.175349999999995 38.0 38.0 38.0 33.6 38.0 30-34 36.24345 38.0 38.0 38.0 34.0 38.0 35-39 35.72895 38.0 37.2 38.0 30.2 38.0 40-44 35.88415 38.0 37.8 38.0 32.2 38.0 45-49 35.504 38.0 36.8 38.0 29.2 38.0 50-54 35.509100000000004 38.0 37.0 38.0 29.0 38.0 55-59 35.517250000000004 38.0 37.0 38.0 29.4 38.0 60-64 35.5445 38.0 37.0 38.0 29.8 38.0 65-69 35.2252 38.0 36.4 38.0 28.2 38.0 70-74 35.3069 38.0 36.6 38.0 28.8 38.0 75-79 35.005700000000004 38.0 36.2 38.0 27.4 38.0 80-84 34.7713 38.0 36.0 38.0 25.8 38.0 85-89 34.94440000000001 38.0 36.2 38.0 27.4 38.0 90-94 34.873850000000004 38.0 36.0 38.0 26.6 38.0 95-99 34.4594 38.0 35.2 38.0 25.0 38.0 100-104 34.16414999999999 38.0 34.8 38.0 23.2 38.0 105-109 34.031400000000005 38.0 34.6 38.0 23.0 38.0 110-114 33.51305 38.0 34.0 38.0 15.0 38.0 115-119 33.2863 38.0 33.8 38.0 16.6 38.0 120-124 32.52205 37.6 32.0 38.0 15.0 38.0 125-129 31.5437 37.0 30.6 38.0 14.8 38.0 130-134 30.621950000000005 36.0 27.6 38.0 13.4 38.0 135-139 29.88685 35.6 25.8 38.0 10.8 38.0 140-144 28.569200000000002 34.6 22.0 38.0 2.0 38.0 145-149 26.617 33.4 13.6 38.0 2.0 38.0 150-151 20.590874999999997 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 7.0 4 4.0 5 2.0 6 3.0 7 4.0 8 1.0 9 3.0 10 6.0 11 1.0 12 5.0 13 6.0 14 5.0 15 9.0 16 6.0 17 12.0 18 10.0 19 7.0 20 23.0 21 29.0 22 22.0 23 37.0 24 39.0 25 46.0 26 58.0 27 69.0 28 69.0 29 99.0 30 123.0 31 149.0 32 168.0 33 219.0 34 270.0 35 467.0 36 821.0 37 1184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 16.125 14.549999999999999 29.549999999999997 2 22.125 25.15 36.65 16.075 3 19.975 25.85 33.2 20.974999999999998 4 23.3 36.1 21.025 19.575 5 22.675 38.975 21.725 16.625 6 17.849999999999998 37.225 25.3 19.625 7 16.900000000000002 15.75 46.5 20.849999999999998 8 20.1 21.224999999999998 29.225 29.45 9 22.325 22.775000000000002 29.95 24.95 10-14 21.725 28.95 27.87 21.455 15-19 22.43 27.685 28.82 21.065 20-24 22.555 28.720000000000002 28.249999999999996 20.474999999999998 25-29 22.314999999999998 28.325 29.154999999999998 20.205000000000002 30-34 21.795 28.595 28.895 20.715 35-39 22.425 28.76 28.675 20.14 40-44 22.685 28.685 28.33 20.3 45-49 22.16 27.900000000000002 28.98 20.96 50-54 22.05 27.91 29.07 20.97 55-59 22.795 27.62 29.345 20.24 60-64 22.895 28.134999999999998 28.705000000000002 20.265 65-69 22.470000000000002 27.305 29.84 20.385 70-74 23.044999999999998 28.349999999999998 28.74 19.865 75-79 23.3 28.134999999999998 28.48 20.085 80-84 22.73 28.285 28.93 20.055 85-89 22.48 28.634999999999998 28.595 20.29 90-94 22.994999999999997 27.96 28.970000000000002 20.075000000000003 95-99 23.165 27.97 28.675 20.19 100-104 22.879575915183036 28.035607121424285 28.440688137627525 20.644128825765154 105-109 22.92761018560208 28.020411226174396 29.126019310620844 19.925959277602683 110-114 22.605651412853213 28.06201550387597 29.27731932983246 20.05501375343836 115-119 23.45 28.060000000000002 28.875 19.615 120-124 23.68118405920296 28.046402320116005 28.461423071153558 19.810990549527478 125-129 23.585 28.050000000000004 28.189999999999998 20.175 130-134 24.065 27.584999999999997 28.315 20.035 135-139 24.104999999999997 27.894999999999996 28.194999999999997 19.805 140-144 24.83 28.134999999999998 27.98 19.055 145-149 25.83 27.46 27.584999999999997 19.125 150-151 26.025 26.637499999999996 28.349999999999998 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 1.5 20 2.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.5 26 3.5 27 8.5 28 13.0 29 17.0 30 23.5 31 25.0 32 33.0 33 53.0 34 64.0 35 76.0 36 97.0 37 118.5 38 153.5 39 191.0 40 216.5 41 240.0 42 293.5 43 318.5 44 300.0 45 276.0 46 238.0 47 227.5 48 218.5 49 176.0 50 143.5 51 121.5 52 90.5 53 69.5 54 49.5 55 34.5 56 28.0 57 17.5 58 12.0 59 11.5 60 10.5 61 6.0 62 2.0 63 2.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.055 110-114 0.025 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.35202413879808897 0.7000000000000001 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.55 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.9875 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 130-134 >>END_MODULE Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695202 spots for SRR7166186.sra Written 695202 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra Read 695200 spots for SRR7166186.sra Written 695200 spots for SRR7166186.sra SRR ids: ['SRR7166186.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jc58no88 SRR7166186.sra spots: 13904002 blocks: [[1, 695200], [695201, 1390400], [1390401, 2085600], [2085601, 2780800], [2780801, 3476000], [3476001, 4171200], [4171201, 4866400], [4866401, 5561600], [5561601, 6256800], [6256801, 6952000], [6952001, 7647200], [7647201, 8342400], [8342401, 9037600], [9037601, 9732800], [9732801, 10428000], [10428001, 11123200], [11123201, 11818400], [11818401, 12513600], [12513601, 13208800], [13208801, 13904002]] SRR7166186 file size 4689909 SRR7166186 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166186 SRR7166186_1.fastq SRR7166186_2.fastq Input file: SRR7166186_1.fastq Paired file: SRR7166186_2.fastq trimmed: SRR7166186-trimmed-pair1.fastq, SRR7166186-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 22:53:38 2025 >> started Fri Feb 14 22:53:54 2025 >> done (16.081s) 13904002 read pairs processed; of these: 15961 ( 0.11%) short read pairs filtered out after trimming by size control 12999 ( 0.09%) empty read pairs filtered out after trimming by size control 13875042 (99.79%) read pairs available; of these: 8981296 (64.73%) trimmed read pairs available after processing 4893746 (35.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 6 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 10 0.00% 26 3 0.00% 27 6 0.00% 28 6 0.00% 29 3 0.00% 30 8 0.00% 31 5 0.00% 32 8 0.00% 33 6 0.00% 34 7 0.00% 35 14 0.00% 36 11 0.00% 37 10 0.00% 38 14 0.00% 39 12 0.00% 40 8 0.00% 41 20 0.00% 42 18 0.00% 43 14 0.00% 44 22 0.00% 45 24 0.00% 46 28 0.00% 47 26 0.00% 48 38 0.00% 49 46 0.00% 50 49 0.00% 51 61 0.00% 52 76 0.00% 53 68 0.00% 54 84 0.00% 55 83 0.00% 56 110 0.00% 57 113 0.00% 58 137 0.00% 59 140 0.00% 60 150 0.00% 61 187 0.00% 62 213 0.00% 63 286 0.00% 64 294 0.00% 65 329 0.00% 66 372 0.00% 67 428 0.00% 68 539 0.00% 69 586 0.00% 70 672 0.00% 71 720 0.01% 72 865 0.01% 73 970 0.01% 74 1034 0.01% 75 1093 0.01% 76 1230 0.01% 77 1378 0.01% 78 1388 0.01% 79 1583 0.01% 80 1844 0.01% 81 2134 0.02% 82 2300 0.02% 83 2682 0.02% 84 3566 0.03% 85 4046 0.03% 86 4293 0.03% 87 4789 0.03% 88 5162 0.04% 89 5472 0.04% 90 6130 0.04% 91 7067 0.05% 92 7826 0.06% 93 8565 0.06% 94 8719 0.06% 95 8973 0.06% 96 9439 0.07% 97 10639 0.08% 98 11419 0.08% 99 12570 0.09% 100 13525 0.10% 101 13977 0.10% 102 14529 0.10% 103 15135 0.11% 104 16031 0.12% 105 17754 0.13% 106 18306 0.13% 107 19046 0.14% 108 19274 0.14% 109 20379 0.15% 110 22429 0.16% 111 23262 0.17% 112 25119 0.18% 113 27251 0.20% 114 28374 0.20% 115 28752 0.21% 116 30575 0.22% 117 34222 0.25% 118 36136 0.26% 119 39724 0.29% 120 40494 0.29% 121 41428 0.30% 122 42558 0.31% 123 44772 0.32% 124 49544 0.36% 125 52268 0.38% 126 55135 0.40% 127 59477 0.43% 128 62466 0.45% 129 67292 0.48% 130 71546 0.52% 131 77791 0.56% 132 84280 0.61% 133 89578 0.65% 134 96974 0.70% 135 103525 0.75% 136 107314 0.77% 137 111367 0.80% 138 122105 0.88% 139 137688 0.99% 140 160833 1.16% 141 154938 1.12% 142 165665 1.19% 143 183484 1.32% 144 213440 1.54% 145 253443 1.83% 146 321518 2.32% 147 429410 3.09% 148 611509 4.41% 149 1041783 7.51% 150 3320607 23.93% 151 4893746 35.27% 13875042 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=30 prefix-density=0.59 prefix-fanout=2.9 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=23.40 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=9.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=20 prefix-density=0.74 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=27.69 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166186 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 22:54:53 Started mapping on | Feb 14 22:54:53 Finished on | Feb 14 22:56:48 Mapping speed, Million of reads per hour | 434.35 Number of input reads | 13875042 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12974204 Uniquely mapped reads % | 93.51% Average mapped length | 290.44 Number of splices: Total | 12396852 Number of splices: Annotated (sjdb) | 12162165 Number of splices: GT/AG | 12195855 Number of splices: GC/AG | 157476 Number of splices: AT/AC | 9354 Number of splices: Non-canonical | 34167 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338578 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 26205 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579237 579237 579237 N_multimapping 338578 338578 338578 N_noFeature 485895 12799688 588514 N_ambiguous 137003 798 64690 UnstrandedReadsAssigned:12351306 PositiveStrandReadsAssigned:173718 NegativeStrandReadsAssigned:12321000 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7166186 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166186-trimmed-pair1.fastq SRR7166186-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,875,042 reads, 12,245,365 reads pseudoaligned [quant] estimated average fragment length: 231.959 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7166186.ke.tsv 34699 SRR7166186.se.tsv 87100 total ==> SRR7166186.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.04 1109 47.0212 Potri.005G024800.1.v4.1 1035 804.041 153 14.4181 Potri.004G059700.1.v4.1 961 730.051 18 1.86817 Potri.007G009000.2.v4.1 1416 1185.04 0 0 Potri.003G141000.2.v4.1 2943 2712.04 496.193 13.8628 Potri.016G087400.1.v4.1 270 84.3951 852.171 765.079 Potri.015G069301.1.v4.1 564 336.427 0 0 Potri.010G195200.1.v4.1 1773 1542.04 404 19.851 Potri.012G127500.1.v4.1 977 746.046 3863 392.333 ==> SRR7166186.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 476 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 424 SRR7166186 completed mapping pipeline successfully