Starting /dee2/code/volunteer_pipeline.sh SRR7166187 current disk space = 3109404798976 free memory = 1285292372 SRR7166187 SRAfilesize d95df986b8c46838b7f3938ed97ba157 SRR7166187.sra SRR7166187.sra file validated SRR7166187 is paired end SRR7166187 is conventional basespace SRR7166187 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166187_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73325 33.0 32.0 34.0 28.0 34.0 2 32.19925 33.0 33.0 34.0 29.0 34.0 3 32.133 33.0 33.0 34.0 29.0 34.0 4 32.34475 33.0 33.0 34.0 31.0 34.0 5 32.387 33.0 33.0 34.0 31.0 34.0 6 36.58125 38.0 37.0 38.0 34.0 38.0 7 37.043 38.0 38.0 38.0 36.0 38.0 8 37.16625 38.0 38.0 38.0 36.0 38.0 9 37.07025 38.0 38.0 38.0 36.0 38.0 10-14 37.057249999999996 38.0 38.0 38.0 35.6 38.0 15-19 36.90285000000001 38.0 38.0 38.0 35.0 38.0 20-24 37.0258 38.0 38.0 38.0 36.0 38.0 25-29 36.7235 38.0 38.0 38.0 34.6 38.0 30-34 36.57275 38.0 38.0 38.0 34.0 38.0 35-39 36.4794 38.0 37.8 38.0 34.0 38.0 40-44 36.4456 38.0 38.0 38.0 34.0 38.0 45-49 36.3838 38.0 37.0 38.0 33.4 38.0 50-54 36.28365 38.0 37.0 38.0 33.2 38.0 55-59 36.13525 38.0 37.0 38.0 32.6 38.0 60-64 35.887950000000004 38.0 37.0 38.0 31.0 38.0 65-69 35.9013 38.0 37.0 38.0 31.0 38.0 70-74 35.8204 38.0 37.0 38.0 31.0 38.0 75-79 35.158899999999996 38.0 36.2 38.0 29.0 38.0 80-84 34.8783 38.0 36.0 38.0 28.0 38.0 85-89 34.8444 38.0 35.2 38.0 26.8 38.0 90-94 35.181650000000005 38.0 36.0 38.0 28.8 38.0 95-99 34.3927 38.0 34.6 38.0 24.8 38.0 100-104 34.08565 38.0 34.2 38.0 22.2 38.0 105-109 33.87845 38.0 34.0 38.0 20.0 38.0 110-114 32.9061 37.0 31.4 38.0 15.0 38.0 115-119 33.18075 37.2 33.2 38.0 15.0 38.0 120-124 32.23780000000001 37.0 30.6 38.0 15.0 38.0 125-129 32.1822 36.8 30.6 38.0 15.0 38.0 130-134 30.737299999999998 35.4 27.6 38.0 14.2 38.0 135-139 29.748699999999996 34.2 24.8 38.0 13.2 38.0 140-144 28.51275 34.0 21.8 38.0 6.4 38.0 145-149 26.8656 33.0 16.6 38.0 2.0 38.0 150-151 20.717125000000003 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 1.0 15 0.0 16 3.0 17 7.0 18 5.0 19 13.0 20 13.0 21 8.0 22 24.0 23 24.0 24 33.0 25 46.0 26 62.0 27 76.0 28 85.0 29 119.0 30 117.0 31 175.0 32 211.0 33 296.0 34 407.0 35 560.0 36 901.0 37 809.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.66160081053698 18.161094224924014 10.688956433637285 39.488348530901725 2 19.2 27.05 38.35 15.4 3 16.825000000000003 31.175000000000004 27.125 24.875 4 20.5 38.4 21.675 19.425 5 19.475 38.775 23.575 18.175 6 15.024999999999999 37.8 25.6 21.575 7 11.75 20.4 46.975 20.875 8 17.175 21.0 29.15 32.675 9 16.3 22.2 31.624999999999996 29.875 10-14 18.66 30.2 26.665 24.474999999999998 15-19 18.925 29.520000000000003 27.24 24.315 20-24 19.095000000000002 29.299999999999997 27.605 24.0 25-29 19.17 29.32 28.205000000000002 23.305 30-34 19.15 28.48 29.125 23.244999999999997 35-39 19.0 29.515 28.075 23.41 40-44 19.48 29.354999999999997 27.855 23.31 45-49 19.165 29.125 27.875 23.835 50-54 19.064999999999998 29.515 28.1 23.32 55-59 19.015 28.815 28.415000000000003 23.755000000000003 60-64 19.61 29.07 27.750000000000004 23.57 65-69 19.6 29.299999999999997 27.955000000000002 23.145 70-74 19.881840484654283 29.119311069944427 27.662344164622237 23.336504280779053 75-79 19.459844361934795 29.322008036213827 27.185799298102843 24.032348303748538 80-84 19.33971876910536 28.861830038720193 28.07214183819034 23.726309353984103 85-89 19.415 28.884999999999998 27.875 23.825 90-94 19.55 28.88 28.155 23.415 95-99 19.744999999999997 29.09 28.055000000000003 23.11 100-104 19.415 29.104999999999997 28.53 22.95 105-109 19.439999999999998 28.845 27.884999999999998 23.830000000000002 110-114 19.765 28.38 28.294999999999998 23.56 115-119 19.79 28.68 27.529999999999998 24.0 120-124 19.551843145100786 28.625018756564796 27.924773670784774 23.89836442754964 125-129 20.11013767209011 28.750938673341675 27.759699624530665 23.379224030037545 130-134 20.42104200323102 29.609248788368337 26.358037156704363 23.611672051696285 135-139 19.82175937515646 28.438391828969106 27.492114354378412 24.247734441496018 140-144 19.877951180472188 28.53641456582633 27.170868347338935 24.414765906362547 145-149 20.455686038341863 28.560674495633847 27.5268493425675 23.456790123456788 150-151 20.74668003006765 27.800050112753695 28.18842395389627 23.264845903282385 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 4.0 25 6.5 26 9.0 27 8.0 28 10.5 29 19.0 30 27.0 31 32.0 32 40.5 33 51.5 34 67.5 35 100.5 36 124.5 37 134.0 38 156.0 39 189.0 40 215.0 41 252.0 42 271.0 43 279.5 44 274.5 45 249.0 46 249.0 47 242.5 48 212.5 49 172.0 50 136.0 51 120.0 52 96.0 53 69.0 54 53.5 55 35.0 56 26.0 57 17.5 58 11.5 59 7.5 60 6.5 61 6.5 62 3.0 63 2.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.135 75-79 1.695 80-84 1.8599999999999999 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.125 130-134 0.96 135-139 0.135 140-144 0.04 145-149 0.37 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.6875 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.7375 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTACC 10 0.0069178343 144.3875 9 >>END_MODULE SRR7166187 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166187_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62425 33.0 33.0 34.0 32.0 34.0 2 32.663 33.0 33.0 34.0 32.0 34.0 3 32.70275 33.0 33.0 34.0 32.0 34.0 4 32.59775 33.0 33.0 34.0 32.0 34.0 5 32.651 33.0 33.0 34.0 32.0 34.0 6 36.752 38.0 38.0 38.0 35.0 38.0 7 36.896 38.0 38.0 38.0 35.0 38.0 8 36.8275 38.0 38.0 38.0 36.0 38.0 9 36.737 38.0 38.0 38.0 35.0 38.0 10-14 36.74035 38.0 38.0 38.0 35.0 38.0 15-19 36.6264 38.0 38.0 38.0 34.4 38.0 20-24 36.4618 38.0 38.0 38.0 33.8 38.0 25-29 36.56785 38.0 38.0 38.0 34.0 38.0 30-34 36.5443 38.0 38.0 38.0 34.0 38.0 35-39 36.4125 38.0 38.0 38.0 33.8 38.0 40-44 36.300349999999995 38.0 38.0 38.0 33.4 38.0 45-49 36.0732 38.0 37.8 38.0 32.2 38.0 50-54 35.9605 38.0 37.0 38.0 31.0 38.0 55-59 36.129549999999995 38.0 37.4 38.0 32.0 38.0 60-64 35.9767 38.0 37.0 38.0 31.2 38.0 65-69 35.93045 38.0 37.0 38.0 31.0 38.0 70-74 35.7102 38.0 37.0 38.0 29.6 38.0 75-79 35.59115 38.0 37.0 38.0 29.0 38.0 80-84 35.599000000000004 38.0 37.0 38.0 29.0 38.0 85-89 35.41695 38.0 36.4 38.0 29.0 38.0 90-94 35.213300000000004 38.0 36.0 38.0 28.6 38.0 95-99 34.7727 38.0 35.4 38.0 26.4 38.0 100-104 34.5622 38.0 35.0 38.0 25.2 38.0 105-109 34.551399999999994 38.0 35.0 38.0 25.4 38.0 110-114 34.28645 38.0 34.6 38.0 23.8 38.0 115-119 33.82555000000001 38.0 34.0 38.0 19.8 38.0 120-124 33.25105 38.0 33.8 38.0 16.2 38.0 125-129 32.52015 37.6 31.2 38.0 15.0 38.0 130-134 31.723950000000002 36.8 30.4 38.0 14.6 38.0 135-139 31.11255 36.0 30.4 38.0 13.2 38.0 140-144 30.20095 36.0 28.2 38.0 10.2 38.0 145-149 27.9166 34.6 19.8 38.0 2.0 38.0 150-151 22.47975 28.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 5.0 12 0.0 13 2.0 14 2.0 15 5.0 16 9.0 17 6.0 18 10.0 19 18.0 20 8.0 21 21.0 22 25.0 23 34.0 24 24.0 25 45.0 26 40.0 27 56.0 28 76.0 29 82.0 30 115.0 31 131.0 32 167.0 33 223.0 34 311.0 35 432.0 36 761.0 37 1382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.05 14.899999999999999 14.299999999999999 33.75 2 22.55 23.375 38.475 15.6 3 19.1 27.175 32.4 21.325 4 22.35 36.6 22.1 18.95 5 23.549999999999997 38.574999999999996 21.55 16.325 6 17.7 39.900000000000006 23.674999999999997 18.725 7 16.55 15.1 47.599999999999994 20.75 8 20.375 19.85 30.25 29.525000000000002 9 22.75 22.85 29.15 25.25 10-14 22.965 28.4 27.950000000000003 20.685000000000002 15-19 22.88 27.644999999999996 28.9 20.575 20-24 22.985 28.46 28.345 20.21 25-29 22.57 28.499999999999996 28.9 20.03 30-34 22.395 27.975 29.625 20.005 35-39 22.85 27.950000000000003 28.95 20.25 40-44 22.189999999999998 28.025 29.110000000000003 20.674999999999997 45-49 23.24 27.73 29.085 19.945 50-54 22.63 28.425 29.060000000000002 19.885 55-59 23.47 27.925 28.655 19.950000000000003 60-64 23.47 28.335 28.625 19.57 65-69 23.445 28.105000000000004 28.49 19.96 70-74 23.65 28.49 28.175 19.685 75-79 23.78 28.215 28.52 19.485 80-84 23.355 27.339999999999996 29.354999999999997 19.950000000000003 85-89 23.36 28.12 29.25 19.27 90-94 23.605 28.4 28.199999999999996 19.794999999999998 95-99 23.1 27.48 29.09 20.330000000000002 100-104 23.71 28.64 28.42 19.23 105-109 23.82 27.51 29.435 19.235 110-114 23.43 28.62 28.23 19.72 115-119 24.175 27.6 28.89 19.335 120-124 23.61 28.084999999999997 28.425 19.88 125-129 23.82 28.23 28.07 19.88 130-134 24.175 28.21 28.15 19.465 135-139 24.445 28.225 27.62 19.71 140-144 24.72 27.725 28.305000000000003 19.25 145-149 25.124999999999996 28.189999999999998 27.189999999999998 19.495 150-151 26.237500000000004 27.487499999999997 27.800000000000004 18.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 3.5 26 6.0 27 6.5 28 10.0 29 13.0 30 12.5 31 19.0 32 29.5 33 39.5 34 60.5 35 81.5 36 96.5 37 120.0 38 162.0 39 195.5 40 209.0 41 251.5 42 292.0 43 297.5 44 302.0 45 286.5 46 271.5 47 246.0 48 196.0 49 171.5 50 152.0 51 122.0 52 90.5 53 64.0 54 53.5 55 45.0 56 30.0 57 23.0 58 14.0 59 5.5 60 3.5 61 2.0 62 3.0 63 1.5 64 1.0 65 1.0 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.7750000000000004 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 4.025 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGAAA 10 0.006830828 145.0 6 CTGGGAA 10 0.006830828 145.0 1 GAAAAGG 10 0.006830828 145.0 1 GAAAAAT 10 0.006830828 145.0 9 AGGTGAA 10 0.006830828 145.0 5 TGGGAAC 10 0.006830828 145.0 2 >>END_MODULE Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813554 spots for SRR7166187.sra Written 813554 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra Read 813536 spots for SRR7166187.sra Written 813536 spots for SRR7166187.sra SRR ids: ['SRR7166187.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uel5fv7h SRR7166187.sra spots: 16270738 blocks: [[1, 813536], [813537, 1627072], [1627073, 2440608], [2440609, 3254144], [3254145, 4067680], [4067681, 4881216], [4881217, 5694752], [5694753, 6508288], [6508289, 7321824], [7321825, 8135360], [8135361, 8948896], [8948897, 9762432], [9762433, 10575968], [10575969, 11389504], [11389505, 12203040], [12203041, 13016576], [13016577, 13830112], [13830113, 14643648], [14643649, 15457184], [15457185, 16270738]] SRR7166187 file size 5491918 SRR7166187 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166187 SRR7166187_1.fastq SRR7166187_2.fastq Input file: SRR7166187_1.fastq Paired file: SRR7166187_2.fastq trimmed: SRR7166187-trimmed-pair1.fastq, SRR7166187-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 21:14:02 2025 >> started Fri Feb 14 21:14:24 2025 >> done (21.670s) 16270738 read pairs processed; of these: 14078 ( 0.09%) short read pairs filtered out after trimming by size control 11133 ( 0.07%) empty read pairs filtered out after trimming by size control 16245527 (99.85%) read pairs available; of these: 10516839 (64.74%) trimmed read pairs available after processing 5728688 (35.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 6 0.00% 21 6 0.00% 22 2 0.00% 23 5 0.00% 24 8 0.00% 25 2 0.00% 26 13 0.00% 27 5 0.00% 28 3 0.00% 29 8 0.00% 30 7 0.00% 31 9 0.00% 32 11 0.00% 33 11 0.00% 34 8 0.00% 35 9 0.00% 36 17 0.00% 37 11 0.00% 38 15 0.00% 39 15 0.00% 40 13 0.00% 41 20 0.00% 42 22 0.00% 43 24 0.00% 44 28 0.00% 45 31 0.00% 46 32 0.00% 47 33 0.00% 48 34 0.00% 49 52 0.00% 50 55 0.00% 51 66 0.00% 52 64 0.00% 53 86 0.00% 54 73 0.00% 55 104 0.00% 56 108 0.00% 57 126 0.00% 58 173 0.00% 59 164 0.00% 60 205 0.00% 61 237 0.00% 62 239 0.00% 63 279 0.00% 64 358 0.00% 65 373 0.00% 66 422 0.00% 67 465 0.00% 68 591 0.00% 69 666 0.00% 70 780 0.00% 71 824 0.01% 72 943 0.01% 73 1068 0.01% 74 1175 0.01% 75 1337 0.01% 76 1501 0.01% 77 1627 0.01% 78 1884 0.01% 79 2069 0.01% 80 2468 0.02% 81 2680 0.02% 82 3097 0.02% 83 3504 0.02% 84 4295 0.03% 85 4779 0.03% 86 5138 0.03% 87 5790 0.04% 88 6336 0.04% 89 6667 0.04% 90 7249 0.04% 91 7677 0.05% 92 8370 0.05% 93 9085 0.06% 94 9829 0.06% 95 10572 0.07% 96 11311 0.07% 97 11813 0.07% 98 12580 0.08% 99 13535 0.08% 100 14426 0.09% 101 15538 0.10% 102 16575 0.10% 103 17507 0.11% 104 19019 0.12% 105 20074 0.12% 106 20942 0.13% 107 21903 0.13% 108 23307 0.14% 109 24495 0.15% 110 25978 0.16% 111 27692 0.17% 112 29266 0.18% 113 30889 0.19% 114 33431 0.21% 115 34983 0.22% 116 36022 0.22% 117 37508 0.23% 118 39625 0.24% 119 41763 0.26% 120 44499 0.27% 121 46850 0.29% 122 49844 0.31% 123 52316 0.32% 124 55562 0.34% 125 58886 0.36% 126 62540 0.38% 127 66564 0.41% 128 69806 0.43% 129 74371 0.46% 130 79564 0.49% 131 84699 0.52% 132 91557 0.56% 133 98249 0.60% 134 105966 0.65% 135 115506 0.71% 136 121068 0.75% 137 127998 0.79% 138 138260 0.85% 139 154149 0.95% 140 176140 1.08% 141 173321 1.07% 142 191999 1.18% 143 214324 1.32% 144 248454 1.53% 145 301307 1.85% 146 381669 2.35% 147 507134 3.12% 148 707282 4.35% 149 1251796 7.71% 150 3968907 24.43% 151 5728688 35.26% 16245527 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=18.29 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=6.5 sequence=CACCATCATTGTAAAGGAACAACTGAG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=43.67 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166187 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 21:15:47 Started mapping on | Feb 14 21:15:47 Finished on | Feb 14 21:17:20 Mapping speed, Million of reads per hour | 628.86 Number of input reads | 16245527 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15570827 Uniquely mapped reads % | 95.85% Average mapped length | 290.74 Number of splices: Total | 15206892 Number of splices: Annotated (sjdb) | 14914451 Number of splices: GT/AG | 14964927 Number of splices: GC/AG | 191618 Number of splices: AT/AC | 11413 Number of splices: Non-canonical | 38934 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366355 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 25386 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 323844 323844 323844 N_multimapping 366355 366355 366355 N_noFeature 568239 15390625 668981 N_ambiguous 157610 1003 77513 UnstrandedReadsAssigned:14844978 PositiveStrandReadsAssigned:179199 NegativeStrandReadsAssigned:14824333 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7166187 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166187-trimmed-pair1.fastq SRR7166187-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,245,527 reads, 14,740,998 reads pseudoaligned [quant] estimated average fragment length: 239.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7166187.ke.tsv 34699 SRR7166187.se.tsv 87100 total ==> SRR7166187.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.5 1271 48.2738 Potri.005G024800.1.v4.1 1035 796.502 479 40.6455 Potri.004G059700.1.v4.1 961 722.508 21 1.96445 Potri.007G009000.2.v4.1 1416 1177.5 1 0.0573987 Potri.003G141000.2.v4.1 2943 2704.5 852.862 21.3135 Potri.016G087400.1.v4.1 270 82.0321 1040.61 857.371 Potri.015G069301.1.v4.1 564 330.272 0 0 Potri.010G195200.1.v4.1 1773 1534.5 198.618 8.74811 Potri.012G127500.1.v4.1 977 738.502 5278 483.038 ==> SRR7166187.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 185 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 511 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 174 SRR7166187 completed mapping pipeline successfully