Starting /dee2/code/volunteer_pipeline.sh SRR7166188 current disk space = 3107064573952 free memory = 1484670616 SRR7166188 SRAfilesize 487dd93d2dea5bb987315738575c2963 SRR7166188.sra SRR7166188.sra file validated SRR7166188 is paired end SRR7166188 is conventional basespace SRR7166188 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166188_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.79025 18.0 18.0 28.0 18.0 33.0 2 23.4315 18.0 18.0 30.0 18.0 33.0 3 26.80225 29.0 25.0 31.0 18.0 33.0 4 29.5165 32.0 28.0 33.0 25.0 33.0 5 31.8835 33.0 32.0 33.0 32.0 33.0 6 35.68275 37.0 36.0 38.0 31.0 38.0 7 36.505 38.0 37.0 38.0 34.0 38.0 8 37.20725 38.0 38.0 38.0 36.0 38.0 9 37.33825 38.0 38.0 38.0 36.0 38.0 10-14 37.38355 38.0 38.0 38.0 37.0 38.0 15-19 37.51985 38.0 38.0 38.0 37.6 38.0 20-24 37.49835 38.0 38.0 38.0 37.6 38.0 25-29 37.478449999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.4644 38.0 38.0 38.0 37.0 38.0 35-39 37.45934999999999 38.0 38.0 38.0 37.2 38.0 40-44 37.3883 38.0 38.0 38.0 37.0 38.0 45-49 37.43095 38.0 38.0 38.0 37.0 38.0 50-54 37.285199999999996 38.0 38.0 38.0 37.0 38.0 55-59 36.9815 38.0 38.0 38.0 36.8 38.0 60-64 37.1199 38.0 38.0 38.0 36.0 38.0 65-69 37.1717 38.0 38.0 38.0 36.2 38.0 70-74 37.15835 38.0 38.0 38.0 36.0 38.0 75-79 37.0118 38.0 38.0 38.0 36.0 38.0 80-84 36.85385 38.0 38.0 38.0 35.6 38.0 85-89 36.765 38.0 38.0 38.0 35.2 38.0 90-94 36.7367 38.0 38.0 38.0 35.0 38.0 95-99 36.594049999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.5374 38.0 38.0 38.0 34.2 38.0 105-109 36.3541 38.0 38.0 38.0 33.8 38.0 110-114 36.31115 38.0 38.0 38.0 34.0 38.0 115-119 36.076049999999995 38.0 37.4 38.0 33.0 38.0 120-124 35.701499999999996 38.0 36.8 38.0 31.4 38.0 125-129 35.772149999999996 38.0 37.0 38.0 31.6 38.0 130-134 35.6405 38.0 36.0 38.0 31.0 38.0 135-139 35.38095 38.0 36.0 38.0 30.6 38.0 140-144 35.085550000000005 38.0 35.8 38.0 29.2 38.0 145-149 34.498850000000004 38.0 35.0 38.0 27.4 38.0 150-151 31.183125 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 1.0 18 3.0 19 2.0 20 3.0 21 1.0 22 5.0 23 5.0 24 9.0 25 11.0 26 9.0 27 25.0 28 26.0 29 22.0 30 54.0 31 56.0 32 70.0 33 97.0 34 170.0 35 289.0 36 825.0 37 2311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.194472876151483 19.805527123848517 11.847492323439099 38.1525076765609 2 16.950000000000003 29.549999999999997 37.6 15.9 3 17.075000000000003 32.375 26.35 24.2 4 22.275 36.425000000000004 21.075 20.225 5 20.31015507753877 38.76938469234617 21.135567783891947 19.78489244622311 6 15.625 37.375 24.725 22.275 7 11.799999999999999 19.725 46.650000000000006 21.825 8 17.224999999999998 20.5 28.749999999999996 33.525 9 17.275 23.0 30.025000000000002 29.7 10-14 19.595000000000002 30.235 26.13 24.04 15-19 19.825 28.87 27.595 23.71 20-24 19.445 28.59 27.705000000000002 24.26 25-29 19.545 29.12 27.52 23.815 30-34 20.02 28.975 27.43 23.575 35-39 20.24 28.265 27.925 23.57 40-44 20.105 29.154999999999998 27.505000000000003 23.235 45-49 20.145 29.455 27.005000000000003 23.395 50-54 19.95292232183102 28.256623428657285 27.640607001552564 24.149847247959134 55-59 19.876904449601454 28.710523660579156 27.42407426092221 23.988497628897186 60-64 19.96294812737833 28.71019427198077 28.169437212096938 23.15742038854396 65-69 19.84 28.205000000000002 28.03 23.925 70-74 20.01 29.325000000000003 27.779999999999998 22.884999999999998 75-79 20.29 28.665000000000003 27.389999999999997 23.655 80-84 20.044999999999998 28.7 27.82 23.435 85-89 20.235 28.33 27.41 24.025 90-94 19.74 28.799999999999997 27.85 23.61 95-99 20.05 28.65 27.455000000000002 23.845 100-104 20.330000000000002 28.975 27.38 23.315 105-109 19.72867440929115 28.959751702042453 27.853424108930717 23.45814977973568 110-114 20.68 29.294999999999998 26.790000000000003 23.235 115-119 20.575 28.96 27.205000000000002 23.26 120-124 20.585 28.345 26.974999999999998 24.095 125-129 20.044999999999998 29.12 27.02 23.815 130-134 20.990000000000002 28.95 27.089999999999996 22.97 135-139 21.11 28.95 26.85 23.09 140-144 20.655 28.84 27.05 23.455000000000002 145-149 20.474999999999998 28.444999999999997 26.834999999999997 24.245 150-151 21.61621215911934 27.75831873905429 27.5331498623968 23.092319239429575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 3.5 25 3.5 26 5.5 27 8.5 28 10.0 29 13.0 30 20.0 31 31.0 32 34.0 33 40.5 34 58.0 35 73.0 36 88.5 37 114.5 38 153.0 39 185.0 40 201.0 41 232.5 42 260.0 43 265.0 44 280.0 45 288.0 46 275.0 47 248.0 48 211.5 49 187.0 50 170.5 51 131.5 52 98.5 53 74.0 54 53.5 55 47.0 56 37.5 57 30.5 58 18.0 59 7.5 60 10.0 61 8.0 62 4.5 63 6.0 64 5.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.165 55-59 0.89 60-64 0.13999999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.12 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.0374999999999996 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.575 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035757453 20.675 115-119 >>END_MODULE SRR7166188 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166188_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.892 33.0 33.0 34.0 32.0 34.0 2 32.9165 33.0 33.0 34.0 32.0 34.0 3 33.04375 33.0 33.0 34.0 32.0 34.0 4 32.98275 34.0 33.0 34.0 32.0 34.0 5 32.99225 34.0 33.0 34.0 32.0 34.0 6 37.17575 38.0 38.0 38.0 37.0 38.0 7 37.0855 38.0 38.0 38.0 36.0 38.0 8 37.16025 38.0 38.0 38.0 37.0 38.0 9 37.15975 38.0 38.0 38.0 37.0 38.0 10-14 37.16685 38.0 38.0 38.0 36.4 38.0 15-19 37.160199999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.11765 38.0 38.0 38.0 36.4 38.0 25-29 37.0512 38.0 38.0 38.0 36.0 38.0 30-34 36.9944 38.0 38.0 38.0 36.2 38.0 35-39 36.90795 38.0 38.0 38.0 36.0 38.0 40-44 36.93075 38.0 38.0 38.0 36.0 38.0 45-49 36.72774999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.589549999999996 38.0 38.0 38.0 34.4 38.0 55-59 36.516450000000006 38.0 38.0 38.0 34.2 38.0 60-64 36.578250000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.5737 38.0 38.0 38.0 34.6 38.0 70-74 36.431599999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.3027 38.0 38.0 38.0 34.0 38.0 80-84 36.17315 38.0 37.6 38.0 33.2 38.0 85-89 36.05475 38.0 37.0 38.0 33.0 38.0 90-94 35.787600000000005 38.0 37.0 38.0 31.2 38.0 95-99 35.68145 38.0 37.0 38.0 31.0 38.0 100-104 35.44005 38.0 36.8 38.0 30.0 38.0 105-109 35.4248 38.0 36.8 38.0 29.8 38.0 110-114 35.07000000000001 38.0 36.0 38.0 27.8 38.0 115-119 34.8112 38.0 35.2 38.0 27.2 38.0 120-124 34.49175 38.0 35.0 38.0 25.6 38.0 125-129 34.2128 38.0 35.0 38.0 23.6 38.0 130-134 33.6298 38.0 34.4 38.0 19.8 38.0 135-139 33.0703 38.0 34.0 38.0 15.0 38.0 140-144 32.63485 38.0 33.6 38.0 14.2 38.0 145-149 31.228550000000002 37.2 31.8 38.0 8.6 38.0 150-151 26.468249999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 2.0 5 2.0 6 2.0 7 0.0 8 0.0 9 2.0 10 2.0 11 0.0 12 1.0 13 2.0 14 5.0 15 4.0 16 6.0 17 4.0 18 7.0 19 10.0 20 11.0 21 7.0 22 14.0 23 7.0 24 20.0 25 18.0 26 25.0 27 39.0 28 51.0 29 47.0 30 59.0 31 83.0 32 94.0 33 150.0 34 212.0 35 371.0 36 853.0 37 1885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.775 14.575 15.275 32.375 2 23.35 23.75 38.275 14.625 3 19.8 26.55 30.95 22.7 4 23.375 35.125 21.65 19.85 5 22.675 37.875 22.775000000000002 16.675 6 16.708354177088545 38.669334667333665 25.71285642821411 18.90945472736368 7 15.78289144572286 15.582791395697848 45.89794897448725 22.736368184092047 8 20.885442721360683 20.58529264632316 29.839919959979987 28.68934467233617 9 23.167375531648737 23.2424318238679 28.29622216662497 25.293970477858394 10-14 22.422242224222423 28.982898289828984 27.702770277027707 20.89208920892089 15-19 23.224644928985796 27.525505101020205 28.020604120824167 21.229245849169835 20-24 22.701106272213046 29.028382640036043 27.837012564449115 20.433498523301797 25-29 22.54901960784314 28.246298519407766 28.631452581032413 20.573229291716686 30-34 23.226710717324924 27.76192621514742 28.182409771236923 20.828953296290734 35-39 22.887887887887885 27.927927927927925 28.503503503503502 20.68068068068068 40-44 23.123123123123122 27.837837837837835 28.393393393393396 20.645645645645647 45-49 23.45314377252703 27.693231878253904 28.524229074889867 20.329395274329194 50-54 23.55944931163955 27.249061326658325 28.996245306633288 20.195244055068837 55-59 23.103879849812266 27.244055068836044 28.785982478097623 20.866082603254068 60-64 22.898623279098874 28.14518147684606 28.330413016270338 20.625782227784732 65-69 22.963704630788488 28.175219023779725 28.355444305381727 20.505632040050063 70-74 22.973717146433042 28.420525657071337 28.390488110137674 20.21526908635795 75-79 23.359198998748436 28.02503128911139 28.425531914893615 20.190237797246557 80-84 23.123123123123122 27.642642642642645 28.663663663663662 20.57057057057057 85-89 24.043852623147778 28.399078894673607 27.422907488986787 20.13416099319183 90-94 22.71452888755382 28.86752778612196 28.06147992390107 20.35646340242315 95-99 23.175127665965757 28.001401822369083 28.236707720036048 20.586762791629116 100-104 23.319148936170212 28.225281602002504 28.195244055068834 20.260325406758447 105-109 23.824780976220275 28.38548185231539 28.170212765957448 19.619524405506883 110-114 23.61187603264407 27.762479347118614 28.363290442096833 20.26235417814049 115-119 24.498072397736944 27.687377960246334 28.11795924498072 19.696590397035997 120-124 24.053675145203286 27.548567995193267 28.71520128179451 19.682555577808934 125-129 24.65328193060632 27.602263055124414 27.732438792369702 20.012016221899565 130-134 25.131414267834796 27.9549436795995 27.364205256570713 19.549436795994993 135-139 24.770963704630788 27.739674593241553 28.175219023779725 19.314142678347935 140-144 24.967464210631697 27.66042646911603 27.835619181099208 19.536490139153067 145-149 25.82599118942731 27.167601121345612 27.543051661994394 19.463356027232678 150-151 25.56597873671044 27.86741713570982 26.541588492808003 20.02501563477173 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 3.0 25 4.0 26 6.0 27 6.0 28 6.0 29 10.5 30 17.5 31 26.5 32 30.5 33 41.0 34 54.5 35 67.0 36 92.5 37 122.0 38 153.0 39 178.0 40 204.0 41 235.0 42 237.5 43 263.5 44 288.0 45 283.0 46 291.5 47 255.0 48 207.0 49 189.5 50 155.0 51 129.5 52 108.5 53 82.0 54 65.0 55 43.5 56 34.5 57 26.0 58 17.0 59 14.5 60 11.5 61 8.0 62 5.5 63 5.0 64 3.5 65 3.5 66 3.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.075 10-14 0.01 15-19 0.02 20-24 0.11499999999999999 25-29 0.04 30-34 0.11499999999999999 35-39 0.1 40-44 0.1 45-49 0.12 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.1 85-89 0.12 90-94 0.13 95-99 0.13 100-104 0.125 105-109 0.125 110-114 0.135 115-119 0.135 120-124 0.13999999999999999 125-129 0.135 130-134 0.125 135-139 0.125 140-144 0.11 145-149 0.12 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77432296890673 99.47500000000001 2 0.17552657973921765 0.35000000000000003 3 0.025075225677031094 0.075 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.425000000000001 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTGA 10 0.0070686177 143.35 4 AAAAGCT 10 0.0070686177 143.35 9 >>END_MODULE Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132514 spots for SRR7166188.sra Written 1132514 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra Read 1132495 spots for SRR7166188.sra Written 1132495 spots for SRR7166188.sra SRR ids: ['SRR7166188.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eduue91n SRR7166188.sra spots: 22649919 blocks: [[1, 1132495], [1132496, 2264990], [2264991, 3397485], [3397486, 4529980], [4529981, 5662475], [5662476, 6794970], [6794971, 7927465], [7927466, 9059960], [9059961, 10192455], [10192456, 11324950], [11324951, 12457445], [12457446, 13589940], [13589941, 14722435], [14722436, 15854930], [15854931, 16987425], [16987426, 18119920], [18119921, 19252415], [19252416, 20384910], [20384911, 21517405], [21517406, 22649919]] SRR7166188 file size 7653613 SRR7166188 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166188 SRR7166188_1.fastq SRR7166188_2.fastq Input file: SRR7166188_1.fastq Paired file: SRR7166188_2.fastq trimmed: SRR7166188-trimmed-pair1.fastq, SRR7166188-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 23:08:33 2025 >> started Fri Feb 14 23:09:22 2025 >> done (49.324s) 22649919 read pairs processed; of these: 16037 ( 0.07%) short read pairs filtered out after trimming by size control 16733 ( 0.07%) empty read pairs filtered out after trimming by size control 22617149 (99.86%) read pairs available; of these: 10390994 (45.94%) trimmed read pairs available after processing 12226155 (54.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 7 0.00% 20 11 0.00% 21 6 0.00% 22 8 0.00% 23 10 0.00% 24 11 0.00% 25 16 0.00% 26 9 0.00% 27 7 0.00% 28 9 0.00% 29 15 0.00% 30 6 0.00% 31 7 0.00% 32 15 0.00% 33 10 0.00% 34 10 0.00% 35 15 0.00% 36 15 0.00% 37 19 0.00% 38 23 0.00% 39 14 0.00% 40 28 0.00% 41 24 0.00% 42 28 0.00% 43 23 0.00% 44 29 0.00% 45 36 0.00% 46 40 0.00% 47 52 0.00% 48 73 0.00% 49 77 0.00% 50 74 0.00% 51 90 0.00% 52 101 0.00% 53 96 0.00% 54 96 0.00% 55 126 0.00% 56 150 0.00% 57 162 0.00% 58 199 0.00% 59 205 0.00% 60 271 0.00% 61 314 0.00% 62 304 0.00% 63 362 0.00% 64 393 0.00% 65 464 0.00% 66 542 0.00% 67 553 0.00% 68 694 0.00% 69 802 0.00% 70 994 0.00% 71 1020 0.00% 72 1175 0.01% 73 1387 0.01% 74 1406 0.01% 75 1728 0.01% 76 2016 0.01% 77 2077 0.01% 78 2477 0.01% 79 2765 0.01% 80 3200 0.01% 81 3594 0.02% 82 4142 0.02% 83 4671 0.02% 84 6368 0.03% 85 6683 0.03% 86 7066 0.03% 87 7511 0.03% 88 8288 0.04% 89 8930 0.04% 90 9605 0.04% 91 10646 0.05% 92 11613 0.05% 93 12362 0.05% 94 13558 0.06% 95 14472 0.06% 96 15497 0.07% 97 16602 0.07% 98 17886 0.08% 99 20198 0.09% 100 19788 0.09% 101 21116 0.09% 102 22759 0.10% 103 23975 0.11% 104 25229 0.11% 105 26669 0.12% 106 28488 0.13% 107 29296 0.13% 108 30887 0.14% 109 32403 0.14% 110 33724 0.15% 111 35553 0.16% 112 37367 0.17% 113 39563 0.17% 114 41278 0.18% 115 43145 0.19% 116 44747 0.20% 117 46384 0.21% 118 48125 0.21% 119 50236 0.22% 120 51996 0.23% 121 54273 0.24% 122 55925 0.25% 123 58890 0.26% 124 61217 0.27% 125 63431 0.28% 126 66041 0.29% 127 68336 0.30% 128 70996 0.31% 129 73921 0.33% 130 76518 0.34% 131 79602 0.35% 132 82512 0.36% 133 87201 0.39% 134 91529 0.40% 135 95011 0.42% 136 100753 0.45% 137 105025 0.46% 138 111802 0.49% 139 118513 0.52% 140 126120 0.56% 141 136629 0.60% 142 149919 0.66% 143 165521 0.73% 144 190655 0.84% 145 222956 0.99% 146 271779 1.20% 147 364167 1.61% 148 537139 2.37% 149 1007788 4.46% 150 4737499 20.95% 151 12226155 54.06% 22617149 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=166.70 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=22.9 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.98 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=3.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=98.57 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=14.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7166188 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:10:27 Started mapping on | Feb 14 23:10:33 Finished on | Feb 14 23:13:32 Mapping speed, Million of reads per hour | 454.87 Number of input reads | 22617149 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21341799 Uniquely mapped reads % | 94.36% Average mapped length | 293.34 Number of splices: Total | 21264371 Number of splices: Annotated (sjdb) | 20867171 Number of splices: GT/AG | 20919075 Number of splices: GC/AG | 270023 Number of splices: AT/AC | 15538 Number of splices: Non-canonical | 59735 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 554582 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 60082 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734018 734018 734018 N_multimapping 554582 554582 554582 N_noFeature 732507 21050504 924704 N_ambiguous 206636 1921 106229 UnstrandedReadsAssigned:20402656 PositiveStrandReadsAssigned:289374 NegativeStrandReadsAssigned:20310866 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166188 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166188-trimmed-pair1.fastq SRR7166188-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,617,149 reads, 20,206,067 reads pseudoaligned [quant] estimated average fragment length: 239.496 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR7166188.ke.tsv 34699 SRR7166188.se.tsv 87100 total ==> SRR7166188.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.5 1532 45.4625 Potri.005G024800.1.v4.1 1035 796.504 235 15.5802 Potri.004G059700.1.v4.1 961 722.53 37 2.7042 Potri.007G009000.2.v4.1 1416 1177.5 2 0.0896934 Potri.003G141000.2.v4.1 2943 2704.5 765.282 14.9426 Potri.016G087400.1.v4.1 270 84.8501 1304 811.556 Potri.015G069301.1.v4.1 564 331.532 0 0 Potri.010G195200.1.v4.1 1773 1534.5 379.56 13.0619 Potri.012G127500.1.v4.1 977 738.525 7675 548.79 ==> SRR7166188.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 290 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 540 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 205 SRR7166188 completed mapping pipeline successfully