Starting /dee2/code/volunteer_pipeline.sh SRR7166189 current disk space = 3107527651328 free memory = 1463523908 SRR7166189 SRAfilesize 75200e1241bf072ed41d4ee2119fd625 SRR7166189.sra SRR7166189.sra file validated SRR7166189 is paired end SRR7166189 is conventional basespace SRR7166189 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.226 18.0 18.0 25.0 18.0 33.0 2 21.6385 18.0 18.0 27.0 18.0 31.0 3 26.58125 27.0 25.0 29.0 18.0 31.0 4 29.78475 32.0 27.0 32.0 25.0 33.0 5 31.6105 32.0 32.0 33.0 30.0 33.0 6 35.62925 37.0 35.0 38.0 31.0 38.0 7 36.6475 38.0 37.0 38.0 34.0 38.0 8 36.78175 38.0 37.0 38.0 34.0 38.0 9 37.10325 38.0 38.0 38.0 36.0 38.0 10-14 37.3633 38.0 38.0 38.0 36.6 38.0 15-19 37.40015 38.0 38.0 38.0 37.0 38.0 20-24 37.47024999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.480500000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.4216 38.0 38.0 38.0 37.0 38.0 35-39 37.406099999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.40495 38.0 38.0 38.0 37.0 38.0 45-49 37.3549 38.0 38.0 38.0 37.0 38.0 50-54 37.284800000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.999849999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.085449999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.126 38.0 38.0 38.0 36.0 38.0 70-74 37.022349999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.00205 38.0 38.0 38.0 36.0 38.0 80-84 36.89545 38.0 38.0 38.0 35.8 38.0 85-89 36.749249999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.59589999999999 38.0 38.0 38.0 34.2 38.0 95-99 36.6272 38.0 38.0 38.0 34.2 38.0 100-104 36.4805 38.0 38.0 38.0 34.0 38.0 105-109 36.378750000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.3549 38.0 38.0 38.0 33.8 38.0 115-119 36.114599999999996 38.0 37.0 38.0 32.8 38.0 120-124 35.99245 38.0 37.0 38.0 32.2 38.0 125-129 35.736450000000005 38.0 36.4 38.0 31.4 38.0 130-134 35.5886 38.0 36.0 38.0 31.0 38.0 135-139 35.3184 38.0 36.0 38.0 30.4 38.0 140-144 34.93985 38.0 35.6 38.0 29.2 38.0 145-149 34.426 38.0 35.0 38.0 26.6 38.0 150-151 31.411749999999998 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 1.0 18 1.0 19 4.0 20 0.0 21 3.0 22 4.0 23 7.0 24 8.0 25 6.0 26 8.0 27 19.0 28 16.0 29 37.0 30 43.0 31 54.0 32 86.0 33 108.0 34 158.0 35 315.0 36 908.0 37 2206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.178807947019866 28.731533367294958 10.341314314824249 37.74834437086093 2 10.125 33.225 38.15 18.5 3 17.2 31.45 25.924999999999997 25.424999999999997 4 21.85 38.05 20.3 19.8 5 20.240480961923847 37.95090180360721 23.52204408817635 18.286573146292582 6 15.575 37.724999999999994 25.275 21.425 7 12.525 19.400000000000002 46.825 21.25 8 17.375 20.0 29.225 33.4 9 17.625 20.724999999999998 29.95 31.7 10-14 18.87 30.14 26.645000000000003 24.345 15-19 19.985 27.839999999999996 27.900000000000002 24.275 20-24 19.695 28.970000000000002 27.905 23.43 25-29 19.49 28.925 27.96 23.625 30-34 19.395 28.93 27.750000000000004 23.925 35-39 19.5 29.035 27.639999999999997 23.825 40-44 19.545 28.985 27.715 23.755000000000003 45-49 19.595000000000002 29.160000000000004 27.500000000000004 23.745 50-54 19.7 29.64 27.27 23.39 55-59 19.865218265942467 28.96298531482599 28.429893381613358 22.741903037618187 60-64 19.421508282039735 28.934594405244457 28.108892558674874 23.535004754040934 65-69 19.73 28.865000000000002 27.765 23.64 70-74 20.150000000000002 29.215000000000003 27.295 23.34 75-79 19.75 28.494999999999997 27.725 24.03 80-84 19.59 28.610000000000003 27.794999999999998 24.005000000000003 85-89 19.96 29.25 27.405 23.385 90-94 19.975 28.67 27.639999999999997 23.715 95-99 20.150000000000002 28.455000000000002 28.565 22.830000000000002 100-104 20.37120416228926 28.12046625644104 28.01040572314773 23.497923858121965 105-109 20.40346398358112 28.763077539170045 27.50663262752165 23.326825849727186 110-114 20.349999999999998 29.34 27.55 22.759999999999998 115-119 20.585 28.860000000000003 27.634999999999998 22.919999999999998 120-124 21.279999999999998 29.049999999999997 26.805 22.865 125-129 20.615 28.549999999999997 27.43 23.405 130-134 20.26 28.134999999999998 27.794999999999998 23.810000000000002 135-139 20.405 28.78 27.084999999999997 23.73 140-144 20.775 29.115000000000002 26.61 23.5 145-149 20.865000000000002 28.77 27.185 23.18 150-151 21.81430898383661 27.603057260994863 26.876331286806167 23.70630246836236 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 4.0 25 4.5 26 7.0 27 9.0 28 8.0 29 16.0 30 23.5 31 30.0 32 46.5 33 57.5 34 64.5 35 70.0 36 97.0 37 124.5 38 150.5 39 177.5 40 197.5 41 238.5 42 273.5 43 294.5 44 295.5 45 278.0 46 270.0 47 252.0 48 207.5 49 173.0 50 146.5 51 120.0 52 95.0 53 69.5 54 52.5 55 40.0 56 27.5 57 16.0 58 13.5 59 12.5 60 7.0 61 6.0 62 6.5 63 5.0 64 2.5 65 0.5 66 0.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.58 60-64 0.08499999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.11499999999999999 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATGT 10 0.0068343505 144.975 3 CATGTCA 10 0.0068343505 144.975 5 >>END_MODULE SRR7166189 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166189_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74925 33.0 33.0 34.0 32.0 34.0 2 32.868 33.0 33.0 34.0 32.0 34.0 3 32.97725 33.0 33.0 34.0 32.0 34.0 4 32.93875 33.0 33.0 34.0 32.0 34.0 5 32.9075 33.0 33.0 34.0 32.0 34.0 6 37.2075 38.0 38.0 38.0 37.0 38.0 7 37.1945 38.0 38.0 38.0 37.0 38.0 8 37.1625 38.0 38.0 38.0 37.0 38.0 9 37.20525 38.0 38.0 38.0 37.0 38.0 10-14 37.18405 38.0 38.0 38.0 36.2 38.0 15-19 37.1743 38.0 38.0 38.0 36.8 38.0 20-24 37.1558 38.0 38.0 38.0 36.6 38.0 25-29 37.1178 38.0 38.0 38.0 36.0 38.0 30-34 37.09785 38.0 38.0 38.0 36.0 38.0 35-39 37.023 38.0 38.0 38.0 36.0 38.0 40-44 36.968900000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.876999999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.74105 38.0 38.0 38.0 35.0 38.0 55-59 36.653 38.0 38.0 38.0 34.6 38.0 60-64 36.651599999999995 38.0 38.0 38.0 34.6 38.0 65-69 36.5908 38.0 38.0 38.0 34.2 38.0 70-74 36.4965 38.0 38.0 38.0 34.0 38.0 75-79 36.371950000000005 38.0 38.0 38.0 33.8 38.0 80-84 36.2352 38.0 37.6 38.0 33.4 38.0 85-89 36.188300000000005 38.0 37.2 38.0 33.4 38.0 90-94 35.9765 38.0 37.0 38.0 32.4 38.0 95-99 35.8161 38.0 37.0 38.0 31.6 38.0 100-104 35.61005 38.0 37.0 38.0 30.6 38.0 105-109 35.3768 38.0 36.0 38.0 29.0 38.0 110-114 35.15410000000001 38.0 36.0 38.0 28.4 38.0 115-119 34.882949999999994 38.0 35.4 38.0 27.6 38.0 120-124 34.516999999999996 38.0 35.0 38.0 25.4 38.0 125-129 34.25275 38.0 35.0 38.0 23.6 38.0 130-134 33.67675 38.0 34.0 38.0 21.4 38.0 135-139 33.2402 38.0 34.0 38.0 17.4 38.0 140-144 32.322199999999995 37.4 33.2 38.0 14.2 38.0 145-149 31.1201 36.8 31.0 38.0 8.6 38.0 150-151 26.42925 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 5.0 16 4.0 17 3.0 18 6.0 19 3.0 20 7.0 21 9.0 22 15.0 23 14.0 24 19.0 25 25.0 26 27.0 27 26.0 28 50.0 29 39.0 30 71.0 31 74.0 32 91.0 33 143.0 34 244.0 35 424.0 36 874.0 37 1814.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.125 15.2 13.3 30.375000000000004 2 22.45 24.525 35.825 17.2 3 20.325 26.474999999999998 31.0 22.2 4 24.05 35.15 22.075 18.725 5 24.25 36.95 21.85 16.950000000000003 6 18.15 37.8 24.325 19.725 7 17.0 15.4 46.800000000000004 20.8 8 19.525000000000002 21.425 30.099999999999998 28.95 9 22.25 22.825 29.175 25.75 10-14 22.43 29.12 27.195000000000004 21.255 15-19 23.145 27.665 28.59 20.599999999999998 20-24 22.900000000000002 27.965 28.475 20.66 25-29 23.255 28.28 28.15 20.315 30-34 22.900000000000002 28.199999999999996 28.610000000000003 20.29 35-39 22.685 28.655 28.134999999999998 20.525 40-44 22.355 28.395 28.804999999999996 20.445 45-49 22.785 29.04 27.83 20.345 50-54 23.075000000000003 27.77 28.825 20.330000000000002 55-59 23.165 28.444999999999997 28.165000000000003 20.225 60-64 22.605 28.134999999999998 28.599999999999998 20.66 65-69 22.915 27.495000000000005 29.005 20.585 70-74 23.1 28.155 28.49 20.255000000000003 75-79 23.580000000000002 27.73 27.625 21.065 80-84 23.845 27.725 28.110000000000003 20.32 85-89 23.355 27.88 28.765 20.0 90-94 23.615 28.560000000000002 28.134999999999998 19.689999999999998 95-99 23.385 28.09 28.21 20.315 100-104 23.685000000000002 27.955000000000002 27.965 20.395 105-109 23.71 27.965 28.355000000000004 19.97 110-114 23.225 28.315 28.4 20.06 115-119 24.07 27.500000000000004 28.425 20.005 120-124 23.79 28.46 27.875 19.875 125-129 24.099999999999998 27.66 28.435 19.805 130-134 24.315 27.634999999999998 28.335 19.715 135-139 24.485 26.900000000000002 28.785 19.830000000000002 140-144 24.845 28.060000000000002 27.689999999999998 19.405 145-149 24.55 28.32 27.465 19.665 150-151 25.985730379271498 27.37514081862561 27.099762172987855 19.539366629115033 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.0 24 3.0 25 3.5 26 3.0 27 4.5 28 6.0 29 9.5 30 13.0 31 17.0 32 23.5 33 36.5 34 52.5 35 69.5 36 85.5 37 109.0 38 141.5 39 186.0 40 224.0 41 248.0 42 269.0 43 285.5 44 298.0 45 303.5 46 293.0 47 254.5 48 227.5 49 194.0 50 150.0 51 111.0 52 85.5 53 68.0 54 53.5 55 49.5 56 34.0 57 21.0 58 14.5 59 12.5 60 9.0 61 5.0 62 5.5 63 4.5 64 2.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67328474491079 99.15 2 0.25131942699170645 0.5 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGACC 10 0.006830828 145.0 6 ATTTGAC 10 0.006830828 145.0 1 CAAATCT 10 0.006830828 145.0 3 >>END_MODULE Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799516 spots for SRR7166189.sra Written 799516 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra Read 799497 spots for SRR7166189.sra Written 799497 spots for SRR7166189.sra SRR ids: ['SRR7166189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__xjmypu4 SRR7166189.sra spots: 15989959 blocks: [[1, 799497], [799498, 1598994], [1598995, 2398491], [2398492, 3197988], [3197989, 3997485], [3997486, 4796982], [4796983, 5596479], [5596480, 6395976], [6395977, 7195473], [7195474, 7994970], [7994971, 8794467], [8794468, 9593964], [9593965, 10393461], [10393462, 11192958], [11192959, 11992455], [11992456, 12791952], [12791953, 13591449], [13591450, 14390946], [14390947, 15190443], [15190444, 15989959]] SRR7166189 file size 5396772 SRR7166189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166189 SRR7166189_1.fastq SRR7166189_2.fastq Input file: SRR7166189_1.fastq Paired file: SRR7166189_2.fastq trimmed: SRR7166189-trimmed-pair1.fastq, SRR7166189-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 22:34:07 2025 >> started Fri Feb 14 22:34:27 2025 >> done (19.990s) 15989959 read pairs processed; of these: 9777 ( 0.06%) short read pairs filtered out after trimming by size control 12990 ( 0.08%) empty read pairs filtered out after trimming by size control 15967192 (99.86%) read pairs available; of these: 8051180 (50.42%) trimmed read pairs available after processing 7916012 (49.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 3 0.00% 21 6 0.00% 22 7 0.00% 23 6 0.00% 24 9 0.00% 25 11 0.00% 26 4 0.00% 27 4 0.00% 28 8 0.00% 29 8 0.00% 30 8 0.00% 31 9 0.00% 32 8 0.00% 33 10 0.00% 34 12 0.00% 35 12 0.00% 36 6 0.00% 37 7 0.00% 38 13 0.00% 39 14 0.00% 40 16 0.00% 41 20 0.00% 42 29 0.00% 43 18 0.00% 44 18 0.00% 45 35 0.00% 46 25 0.00% 47 41 0.00% 48 30 0.00% 49 35 0.00% 50 59 0.00% 51 34 0.00% 52 53 0.00% 53 65 0.00% 54 77 0.00% 55 75 0.00% 56 88 0.00% 57 119 0.00% 58 123 0.00% 59 173 0.00% 60 189 0.00% 61 205 0.00% 62 240 0.00% 63 270 0.00% 64 252 0.00% 65 302 0.00% 66 390 0.00% 67 434 0.00% 68 478 0.00% 69 573 0.00% 70 613 0.00% 71 758 0.00% 72 852 0.01% 73 1025 0.01% 74 1124 0.01% 75 1254 0.01% 76 1497 0.01% 77 1605 0.01% 78 1750 0.01% 79 1991 0.01% 80 2288 0.01% 81 2556 0.02% 82 2881 0.02% 83 3237 0.02% 84 4041 0.03% 85 4547 0.03% 86 4904 0.03% 87 5493 0.03% 88 5880 0.04% 89 6241 0.04% 90 6840 0.04% 91 7606 0.05% 92 8109 0.05% 93 8806 0.06% 94 9561 0.06% 95 10115 0.06% 96 10588 0.07% 97 11441 0.07% 98 12576 0.08% 99 13379 0.08% 100 13781 0.09% 101 14440 0.09% 102 15306 0.10% 103 16558 0.10% 104 17366 0.11% 105 18263 0.11% 106 19223 0.12% 107 19881 0.12% 108 20795 0.13% 109 21752 0.14% 110 23057 0.14% 111 24231 0.15% 112 25634 0.16% 113 26799 0.17% 114 28424 0.18% 115 29774 0.19% 116 30917 0.19% 117 32002 0.20% 118 33338 0.21% 119 34228 0.21% 120 35596 0.22% 121 37829 0.24% 122 39196 0.25% 123 41615 0.26% 124 43226 0.27% 125 45449 0.28% 126 47125 0.30% 127 48597 0.30% 128 50206 0.31% 129 52555 0.33% 130 54805 0.34% 131 57823 0.36% 132 61038 0.38% 133 65348 0.41% 134 68925 0.43% 135 72623 0.45% 136 76426 0.48% 137 81200 0.51% 138 86514 0.54% 139 93216 0.58% 140 100862 0.63% 141 110756 0.69% 142 122746 0.77% 143 137535 0.86% 144 159391 1.00% 145 189142 1.18% 146 233184 1.46% 147 309295 1.94% 148 454515 2.85% 149 848807 5.32% 150 3601665 22.56% 151 7916012 49.58% 15967192 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.0 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=147.69 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=23.8 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.45 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=63.33 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.2 sequence=AGAAAATGGAAACCTTTCTATTCACCTCTGAGTCAGTGAATGAGGGCCACCCTGACAAACTATGTGACCAGATCTCTGATGCAGTGCTCGATGCCTGCCTTGAGCA SRR7166189 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 22:35:48 Started mapping on | Feb 14 22:35:48 Finished on | Feb 14 22:37:53 Mapping speed, Million of reads per hour | 459.86 Number of input reads | 15967192 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15095727 Uniquely mapped reads % | 94.54% Average mapped length | 292.86 Number of splices: Total | 14503066 Number of splices: Annotated (sjdb) | 14231085 Number of splices: GT/AG | 14265176 Number of splices: GC/AG | 187154 Number of splices: AT/AC | 10394 Number of splices: Non-canonical | 40342 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391145 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 32015 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489768 489768 489768 N_multimapping 391145 391145 391145 N_noFeature 526453 14912500 633383 N_ambiguous 153968 1001 77048 UnstrandedReadsAssigned:14415306 PositiveStrandReadsAssigned:182226 NegativeStrandReadsAssigned:14385296 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166189 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166189-trimmed-pair1.fastq SRR7166189-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,967,192 reads, 14,264,765 reads pseudoaligned [quant] estimated average fragment length: 240.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7166189.ke.tsv 34699 SRR7166189.se.tsv 87100 total ==> SRR7166189.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778 1371 58.402 Potri.005G024800.1.v4.1 1035 795.003 207 19.7208 Potri.004G059700.1.v4.1 961 721.061 26 2.73101 Potri.007G009000.2.v4.1 1416 1176 0 0 Potri.003G141000.2.v4.1 2943 2703 677.214 18.9759 Potri.016G087400.1.v4.1 270 85.0403 665 592.27 Potri.015G069301.1.v4.1 564 331.737 0 0 Potri.010G195200.1.v4.1 1773 1533 478.868 23.6589 Potri.012G127500.1.v4.1 977 737.027 2180 224.025 ==> SRR7166189.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 558 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 348 SRR7166189 completed mapping pipeline successfully