Starting /dee2/code/volunteer_pipeline.sh SRR7166190 current disk space = 3107086106624 free memory = 1577786544 SRR7166190 SRAfilesize b64be598a8023cf191241b9276493f84 SRR7166190.sra SRR7166190.sra file validated SRR7166190 is paired end SRR7166190 is conventional basespace SRR7166190 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166190_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.82025 25.0 18.0 33.0 18.0 33.0 2 28.893 29.0 27.0 31.0 25.0 33.0 3 31.212 33.0 31.0 33.0 28.0 33.0 4 31.50275 33.0 32.0 33.0 30.0 33.0 5 32.34575 33.0 33.0 33.0 32.0 33.0 6 36.82725 38.0 37.0 38.0 35.0 38.0 7 36.803 38.0 37.0 38.0 34.0 38.0 8 37.2545 38.0 38.0 38.0 36.0 38.0 9 37.45375 38.0 38.0 38.0 37.0 38.0 10-14 37.5087 38.0 38.0 38.0 37.0 38.0 15-19 37.568200000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.53060000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.538199999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.5124 38.0 38.0 38.0 37.6 38.0 35-39 37.443850000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.39835 38.0 38.0 38.0 37.0 38.0 45-49 37.3799 38.0 38.0 38.0 37.0 38.0 50-54 37.20865 38.0 38.0 38.0 37.0 38.0 55-59 36.78745 38.0 38.0 38.0 36.0 38.0 60-64 37.01649999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.196099999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.13425 38.0 38.0 38.0 36.0 38.0 75-79 37.02395 38.0 38.0 38.0 36.0 38.0 80-84 36.847699999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.7105 38.0 38.0 38.0 35.0 38.0 90-94 36.74715 38.0 38.0 38.0 35.0 38.0 95-99 36.61825 38.0 38.0 38.0 34.4 38.0 100-104 36.481049999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.2245 38.0 38.0 38.0 33.6 38.0 110-114 36.34195 38.0 38.0 38.0 34.0 38.0 115-119 36.05650000000001 38.0 37.6 38.0 33.6 38.0 120-124 35.8551 38.0 36.8 38.0 32.2 38.0 125-129 35.7836 38.0 37.0 38.0 31.8 38.0 130-134 35.701350000000005 38.0 36.4 38.0 32.0 38.0 135-139 35.35315 38.0 36.0 38.0 31.0 38.0 140-144 34.97735 38.0 35.8 38.0 29.0 38.0 145-149 34.47285 38.0 35.0 38.0 27.8 38.0 150-151 30.898874999999997 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 3.0 16 2.0 17 3.0 18 1.0 19 4.0 20 2.0 21 2.0 22 3.0 23 3.0 24 14.0 25 13.0 26 16.0 27 16.0 28 14.0 29 21.0 30 40.0 31 47.0 32 79.0 33 110.0 34 186.0 35 260.0 36 665.0 37 2492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.81424148606811 17.543859649122805 8.281733746130032 29.36016511867905 2 20.200000000000003 25.474999999999998 35.949999999999996 18.375 3 17.575 31.05 26.875 24.5 4 22.625 37.05 21.5 18.825 5 19.1 38.275 22.95 19.675 6 17.075000000000003 36.35 24.2 22.375 7 13.200000000000001 19.1 46.025 21.675 8 17.9 21.725 27.175 33.2 9 17.525 23.200000000000003 29.325000000000003 29.95 10-14 19.384999999999998 30.165 26.784999999999997 23.665 15-19 20.26 28.95 27.61 23.18 20-24 20.685000000000002 28.535 27.415 23.365 25-29 20.05 29.235 27.544999999999998 23.169999999999998 30-34 19.89 29.625 27.41 23.075000000000003 35-39 19.965 28.62 27.994999999999997 23.419999999999998 40-44 20.645 28.78 27.62 22.955000000000002 45-49 19.905 28.310000000000002 27.834999999999997 23.95 50-54 20.250752256770312 28.88665997993982 27.111334002006014 23.751253761283852 55-59 20.344740177439796 28.699619771863116 27.219264892268697 23.73637515842839 60-64 19.955887513158554 29.465136097047473 27.264524537570807 23.31445185222317 65-69 19.615 28.415000000000003 27.985 23.985 70-74 19.82 28.384999999999998 28.194999999999997 23.599999999999998 75-79 20.330000000000002 28.285 27.26 24.125 80-84 19.965 27.944999999999997 27.96 24.13 85-89 20.785 28.43 27.644999999999996 23.14 90-94 20.005 28.310000000000002 28.04 23.645 95-99 19.965 28.955 27.315 23.765 100-104 20.665 28.189999999999998 27.41 23.735 105-109 20.149365946569095 28.98100345847326 27.241742268557967 23.627888326399678 110-114 20.810000000000002 27.994999999999997 26.775 24.42 115-119 20.724999999999998 28.13 27.355 23.79 120-124 21.15 28.015 26.93 23.905 125-129 20.75 28.685 26.640000000000004 23.925 130-134 20.985 28.535 26.889999999999997 23.59 135-139 21.185000000000002 28.575 26.815 23.425 140-144 21.12 28.285 26.5 24.095 145-149 20.794999999999998 28.175 26.51 24.52 150-151 20.497748874437217 28.12656328164082 26.575787893946973 24.79989994997499 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 3.0 26 4.0 27 9.0 28 16.0 29 16.0 30 17.0 31 24.5 32 37.5 33 51.0 34 61.5 35 76.5 36 94.0 37 117.0 38 142.5 39 169.0 40 204.0 41 209.5 42 230.5 43 254.5 44 256.0 45 279.5 46 276.5 47 266.0 48 239.0 49 192.0 50 169.5 51 152.5 52 107.5 53 69.5 54 59.5 55 50.5 56 42.0 57 27.5 58 16.0 59 13.5 60 10.5 61 6.5 62 6.5 63 5.5 64 3.0 65 2.0 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.3 55-59 1.375 60-64 0.255 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.245 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.2125000000000004 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.55 0.0 0.0 0.0 0.0 130-131 7.05 0.0 0.0 0.0 0.0 132-133 7.762499999999999 0.0 0.0 0.0 0.0 134-135 8.350000000000001 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 10.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCGTC 10 0.0068768123 144.675 145 AAGCAAG 10 0.0068768123 144.675 9 >>END_MODULE SRR7166190 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166190_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.828 33.0 33.0 34.0 32.0 34.0 2 32.84175 33.0 33.0 34.0 32.0 34.0 3 32.9485 33.0 33.0 34.0 32.0 34.0 4 32.891 33.0 33.0 34.0 32.0 34.0 5 32.9395 33.0 33.0 34.0 32.0 34.0 6 37.10475 38.0 38.0 38.0 36.0 38.0 7 37.0325 38.0 38.0 38.0 36.0 38.0 8 37.0125 38.0 38.0 38.0 36.0 38.0 9 37.16025 38.0 38.0 38.0 37.0 38.0 10-14 37.08845 38.0 38.0 38.0 36.4 38.0 15-19 37.016200000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.0179 38.0 38.0 38.0 36.2 38.0 25-29 37.0185 38.0 38.0 38.0 36.0 38.0 30-34 36.895900000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.82315000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.78959999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.604549999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.50765 38.0 38.0 38.0 34.2 38.0 55-59 36.3848 38.0 38.0 38.0 34.0 38.0 60-64 36.421850000000006 38.0 38.0 38.0 34.0 38.0 65-69 36.3562 38.0 38.0 38.0 34.0 38.0 70-74 36.34805 38.0 38.0 38.0 34.0 38.0 75-79 36.203450000000004 38.0 37.8 38.0 33.4 38.0 80-84 36.106649999999995 38.0 37.6 38.0 33.2 38.0 85-89 35.994099999999996 38.0 37.0 38.0 33.0 38.0 90-94 35.7887 38.0 37.0 38.0 31.4 38.0 95-99 35.609300000000005 38.0 37.0 38.0 31.0 38.0 100-104 35.30995 38.0 36.6 38.0 29.0 38.0 105-109 35.08095 38.0 36.0 38.0 28.2 38.0 110-114 34.67885 38.0 35.0 38.0 26.0 38.0 115-119 34.60065 38.0 35.0 38.0 26.4 38.0 120-124 34.18065 38.0 34.6 38.0 23.4 38.0 125-129 34.06195 38.0 34.8 38.0 23.2 38.0 130-134 33.40335 38.0 33.8 38.0 19.4 38.0 135-139 32.92895 38.0 33.8 38.0 16.0 38.0 140-144 32.4718 38.0 33.0 38.0 14.0 38.0 145-149 30.891700000000004 36.8 30.6 38.0 8.6 38.0 150-151 26.238625 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 0.0 6 1.0 7 4.0 8 1.0 9 4.0 10 5.0 11 3.0 12 3.0 13 1.0 14 3.0 15 3.0 16 5.0 17 4.0 18 7.0 19 7.0 20 8.0 21 9.0 22 17.0 23 20.0 24 16.0 25 17.0 26 22.0 27 37.0 28 40.0 29 44.0 30 78.0 31 75.0 32 107.0 33 158.0 34 235.0 35 390.0 36 833.0 37 1832.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.699999999999996 16.625 11.5 29.175 2 22.575 25.15 35.625 16.650000000000002 3 21.475 26.075 32.025 20.424999999999997 4 23.575 34.775 21.125 20.525 5 21.625 38.824999999999996 22.0 17.549999999999997 6 17.38369184592296 38.19409704852426 24.337168584292147 20.08504252126063 7 17.7633224918689 15.911933950462847 45.90943207405554 20.41531148361271 8 21.240930698023515 21.115836877658246 26.8951713785339 30.748061045784336 9 22.166624968726545 24.0180135101326 27.62071553665249 26.194645984488368 10-14 23.171951585475643 28.458537561268383 26.818045413624088 21.55146543963189 15-19 22.516755026507955 27.608282484745423 28.313494048214466 21.56146844053216 20-24 23.087315486614962 28.481361020765572 27.530647985989493 20.900675506629973 25-29 22.98649324662331 28.769384692346172 27.573786893446723 20.670335167583794 30-34 23.072304228171127 27.980985739304476 27.760820615461597 21.185889417062796 35-39 22.481861396047034 27.500625469101823 28.35126344758569 21.66624968726545 40-44 23.482611958969226 28.101075806855143 27.965974480860645 20.450337753314987 45-49 23.282461846384788 27.615711783837877 28.531398548911685 20.57042782086565 50-54 23.597698273705277 27.56067050287716 27.955966975231423 20.88566424818614 55-59 23.71778834125594 27.615711783837877 28.126094570928196 20.540405303977984 60-64 22.842131598699027 27.75081310983237 28.386289717287966 21.020765574180636 65-69 23.427570678008504 27.535651738804102 27.860895671753816 21.175881911433574 70-74 23.61270953214911 28.04603452589442 27.755816862646988 20.58543907930948 75-79 23.757818363772827 28.116087065298974 27.990993244933698 20.135101325994494 80-84 23.207405554165625 28.08606454841131 28.126094570928196 20.58043532649487 85-89 23.682762071553665 28.08606454841131 27.695771828871653 20.535401551163375 90-94 23.522641981486114 27.495621716287218 28.066049537152864 20.915686765073804 95-99 23.377533149862398 28.20115086314736 28.371278458844134 20.05003752814611 100-104 23.39754816112084 28.231173380035024 27.8558919189392 20.515386539904927 105-109 24.008006004503375 27.72579434575932 27.905929447085313 20.36027020265199 110-114 23.742807105328996 27.745809357017766 28.216162121591193 20.295221416062045 115-119 25.093820365273956 27.640730547910934 27.81085814360771 19.454590943207407 120-124 24.55841881411058 27.5806855141356 27.72579434575932 20.135101325994494 125-129 24.078058543907932 28.261195896922693 27.72079059294471 19.93995496622467 130-134 24.73855391543658 28.271203402551915 26.69001751313485 20.300225168876658 135-139 25.238929196897676 28.396297222917187 27.175381536152116 19.189392044033024 140-144 25.087561292905036 28.1346942860002 27.429200440308215 19.348543980786552 145-149 25.794345759319487 27.87090317738304 26.670002501876404 19.664748561421067 150-151 26.27235213204952 27.935475803426286 26.32237088908341 19.46980117544079 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 4.0 27 7.0 28 7.0 29 9.0 30 13.5 31 16.0 32 26.5 33 35.5 34 36.0 35 53.0 36 78.0 37 107.5 38 138.0 39 150.5 40 183.5 41 235.0 42 259.0 43 281.0 44 296.5 45 285.0 46 273.0 47 264.0 48 237.5 49 202.5 50 175.0 51 150.5 52 120.0 53 89.0 54 64.5 55 48.0 56 37.5 57 29.0 58 23.0 59 14.5 60 10.0 61 8.0 62 5.0 63 3.5 64 2.5 65 1.0 66 1.5 67 2.5 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.075 8 0.075 9 0.075 10-14 0.03 15-19 0.03 20-24 0.075 25-29 0.05 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.075 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.06999999999999999 145-149 0.075 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.5875 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.3375000000000004 0.0 0.0 0.0 0.0 116-117 3.7125000000000004 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 8.0375 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.5125 0.0 0.0 0.0 0.0 138-139 10.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186999 spots for SRR7166190.sra Written 1186999 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra Read 1186996 spots for SRR7166190.sra Written 1186996 spots for SRR7166190.sra SRR ids: ['SRR7166190.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6x7dhaev SRR7166190.sra spots: 23739923 blocks: [[1, 1186996], [1186997, 2373992], [2373993, 3560988], [3560989, 4747984], [4747985, 5934980], [5934981, 7121976], [7121977, 8308972], [8308973, 9495968], [9495969, 10682964], [10682965, 11869960], [11869961, 13056956], [13056957, 14243952], [14243953, 15430948], [15430949, 16617944], [16617945, 17804940], [17804941, 18991936], [18991937, 20178932], [20178933, 21365928], [21365929, 22552924], [22552925, 23739923]] SRR7166190 file size 8022980 SRR7166190 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166190 SRR7166190_1.fastq SRR7166190_2.fastq Input file: SRR7166190_1.fastq Paired file: SRR7166190_2.fastq trimmed: SRR7166190-trimmed-pair1.fastq, SRR7166190-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 22:59:32 2025 >> started Fri Feb 14 22:59:58 2025 >> done (26.175s) 23739923 read pairs processed; of these: 22884 ( 0.10%) short read pairs filtered out after trimming by size control 17932 ( 0.08%) empty read pairs filtered out after trimming by size control 23699107 (99.83%) read pairs available; of these: 11427259 (48.22%) trimmed read pairs available after processing 12271848 (51.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 3 0.00% 20 6 0.00% 21 16 0.00% 22 10 0.00% 23 4 0.00% 24 9 0.00% 25 7 0.00% 26 13 0.00% 27 5 0.00% 28 11 0.00% 29 10 0.00% 30 12 0.00% 31 14 0.00% 32 8 0.00% 33 8 0.00% 34 14 0.00% 35 16 0.00% 36 15 0.00% 37 18 0.00% 38 24 0.00% 39 27 0.00% 40 29 0.00% 41 18 0.00% 42 32 0.00% 43 21 0.00% 44 34 0.00% 45 56 0.00% 46 38 0.00% 47 54 0.00% 48 76 0.00% 49 56 0.00% 50 97 0.00% 51 97 0.00% 52 97 0.00% 53 113 0.00% 54 133 0.00% 55 152 0.00% 56 159 0.00% 57 198 0.00% 58 246 0.00% 59 263 0.00% 60 322 0.00% 61 342 0.00% 62 414 0.00% 63 492 0.00% 64 489 0.00% 65 605 0.00% 66 657 0.00% 67 757 0.00% 68 767 0.00% 69 1015 0.00% 70 1235 0.01% 71 1367 0.01% 72 1621 0.01% 73 1790 0.01% 74 2000 0.01% 75 2268 0.01% 76 2601 0.01% 77 2852 0.01% 78 3181 0.01% 79 3559 0.02% 80 4254 0.02% 81 5011 0.02% 82 5577 0.02% 83 6632 0.03% 84 8995 0.04% 85 9133 0.04% 86 9345 0.04% 87 10284 0.04% 88 11098 0.05% 89 11743 0.05% 90 13051 0.06% 91 14180 0.06% 92 15996 0.07% 93 17396 0.07% 94 18722 0.08% 95 19807 0.08% 96 20919 0.09% 97 22110 0.09% 98 23404 0.10% 99 26116 0.11% 100 26045 0.11% 101 28141 0.12% 102 30319 0.13% 103 32795 0.14% 104 34600 0.15% 105 36549 0.15% 106 37771 0.16% 107 38913 0.16% 108 40635 0.17% 109 42256 0.18% 110 44201 0.19% 111 46655 0.20% 112 49140 0.21% 113 52296 0.22% 114 55089 0.23% 115 57893 0.24% 116 59217 0.25% 117 61386 0.26% 118 62961 0.27% 119 63704 0.27% 120 66072 0.28% 121 69001 0.29% 122 71689 0.30% 123 76017 0.32% 124 79904 0.34% 125 82559 0.35% 126 85194 0.36% 127 87208 0.37% 128 88991 0.38% 129 91516 0.39% 130 94532 0.40% 131 97451 0.41% 132 101983 0.43% 133 107814 0.45% 134 112910 0.48% 135 118152 0.50% 136 122556 0.52% 137 127529 0.54% 138 134125 0.57% 139 139550 0.59% 140 146613 0.62% 141 157415 0.66% 142 170833 0.72% 143 188865 0.80% 144 214727 0.91% 145 249284 1.05% 146 300202 1.27% 147 393067 1.66% 148 570769 2.41% 149 1055660 4.45% 150 4820167 20.34% 151 12271848 51.78% 23699107 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.93 fanout-score-rank=8 prefix-density=0.61 prefix-fanout=3.5 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=147.06 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=22.3 sequence=CCACCACCATGGGCTTGGTGGGAATCATCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.63 fanout-score-rank=27 prefix-density=0.31 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=117.44 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=21.8 sequence=GAAGAAGAGAGG SRR7166190 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:00:57 Started mapping on | Feb 14 23:00:57 Finished on | Feb 14 23:02:58 Mapping speed, Million of reads per hour | 705.10 Number of input reads | 23699107 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 22552528 Uniquely mapped reads % | 95.16% Average mapped length | 291.66 Number of splices: Total | 22343994 Number of splices: Annotated (sjdb) | 21993926 Number of splices: GT/AG | 22001352 Number of splices: GC/AG | 274054 Number of splices: AT/AC | 15322 Number of splices: Non-canonical | 53266 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 592620 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 58026 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574028 574028 574028 N_multimapping 592620 592620 592620 N_noFeature 563573 22288280 723888 N_ambiguous 208241 1711 102936 UnstrandedReadsAssigned:21780714 PositiveStrandReadsAssigned:262537 NegativeStrandReadsAssigned:21725704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166190 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166190-trimmed-pair1.fastq SRR7166190-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,699,107 reads, 21,578,591 reads pseudoaligned [quant] estimated average fragment length: 225.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7166190.ke.tsv 34699 SRR7166190.se.tsv 87100 total ==> SRR7166190.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.39 1013 26.0651 Potri.005G024800.1.v4.1 1035 810.391 221 12.5841 Potri.004G059700.1.v4.1 961 736.43 35 2.19312 Potri.007G009000.2.v4.1 1416 1191.39 0 0 Potri.003G141000.2.v4.1 2943 2718.39 738.515 12.5364 Potri.016G087400.1.v4.1 270 90.2164 1647.54 842.706 Potri.015G069301.1.v4.1 564 344.639 0 0 Potri.010G195200.1.v4.1 1773 1548.39 127 3.78485 Potri.012G127500.1.v4.1 977 752.407 3108 190.614 ==> SRR7166190.se.tsv <== Potri.001G166300.v4.1 6 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 506 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 179 SRR7166190 completed mapping pipeline successfully