Starting /dee2/code/volunteer_pipeline.sh SRR7166191 current disk space = 3105822187520 free memory = 1577184804 SRR7166191 SRAfilesize 19724a6e364f86fff374415b9ac23fdf SRR7166191.sra SRR7166191.sra file validated SRR7166191 is paired end SRR7166191 is conventional basespace SRR7166191 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166191_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.04175 32.0 30.0 33.0 18.0 33.0 2 32.22075 33.0 32.0 33.0 30.0 34.0 3 31.99175 33.0 31.0 33.0 29.0 34.0 4 32.366 33.0 33.0 33.0 31.0 34.0 5 32.93625 33.0 33.0 34.0 32.0 34.0 6 36.864 38.0 37.0 38.0 35.0 38.0 7 37.18575 38.0 38.0 38.0 36.0 38.0 8 37.35625 38.0 38.0 38.0 37.0 38.0 9 37.47575 38.0 38.0 38.0 37.0 38.0 10-14 37.528800000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.5242 38.0 38.0 38.0 37.0 38.0 20-24 37.52655 38.0 38.0 38.0 37.4 38.0 25-29 37.46025 38.0 38.0 38.0 37.2 38.0 30-34 37.46284999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.4351 38.0 38.0 38.0 37.0 38.0 40-44 37.40050000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.35835 38.0 38.0 38.0 37.0 38.0 50-54 37.1117 38.0 38.0 38.0 36.6 38.0 55-59 36.4264 38.0 38.0 38.0 35.8 38.0 60-64 36.7774 38.0 38.0 38.0 35.6 38.0 65-69 37.05995 38.0 38.0 38.0 36.0 38.0 70-74 37.028150000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.950300000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.91010000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.75635 38.0 38.0 38.0 34.8 38.0 90-94 36.68825 38.0 38.0 38.0 34.8 38.0 95-99 36.5727 38.0 38.0 38.0 34.0 38.0 100-104 36.621849999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.20725 38.0 38.0 38.0 33.8 38.0 110-114 36.2504 38.0 37.6 38.0 33.6 38.0 115-119 36.0603 38.0 37.2 38.0 33.0 38.0 120-124 36.01455 38.0 37.0 38.0 32.8 38.0 125-129 35.83055 38.0 37.0 38.0 32.0 38.0 130-134 35.59395 38.0 36.4 38.0 31.2 38.0 135-139 35.35655 38.0 36.0 38.0 30.6 38.0 140-144 34.97885 38.0 36.0 38.0 28.6 38.0 145-149 34.5827 38.0 35.4 38.0 28.0 38.0 150-151 31.25125 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 2.0 16 3.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 4.0 23 10.0 24 5.0 25 15.0 26 12.0 27 19.0 28 29.0 29 27.0 30 48.0 31 51.0 32 71.0 33 102.0 34 158.0 35 297.0 36 564.0 37 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.24577373211964 18.95968790637191 10.273081924577374 31.52145643693108 2 18.55 24.925 39.025 17.5 3 16.875 32.0 28.299999999999997 22.825 4 21.4 35.875 23.875 18.85 5 19.959979989995 38.61930965482742 22.98649324662331 18.434217108554275 6 15.475 37.4 25.95 21.175 7 12.375 19.675 46.325 21.625 8 17.4 21.975 29.15 31.474999999999998 9 17.775 21.775 31.25 29.2 10-14 19.139999999999997 30.245 26.36 24.255 15-19 19.85 28.975 28.065 23.11 20-24 19.495 29.409999999999997 27.765 23.330000000000002 25-29 19.98 29.165000000000003 28.060000000000002 22.795 30-34 19.645000000000003 29.175 28.144999999999996 23.035 35-39 20.18 28.76 27.57 23.49 40-44 20.085 29.425 27.27 23.22 45-49 19.994999999999997 29.375 27.150000000000002 23.48 50-54 19.808708784293984 29.056128869871635 27.15831865089353 23.97684369494085 55-59 20.339937541596274 28.720626631853786 27.445860850867764 23.49357497568218 60-64 19.85597743982274 28.562795850538826 27.792325511129018 23.788901198509414 65-69 20.253291284977724 29.06342293637683 26.900936076487962 23.782349702157482 70-74 20.495 29.09 27.98 22.435 75-79 20.26 29.459999999999997 27.46 22.82 80-84 20.19 28.89 27.500000000000004 23.419999999999998 85-89 19.96 28.62 28.115000000000002 23.305 90-94 20.294999999999998 28.74 27.52 23.445 95-99 20.325 28.785 27.495000000000005 23.395 100-104 19.905948271549352 28.890889989494223 27.660213117214465 23.542948621741957 105-109 20.583941605839414 28.175182481751825 27.671784545683366 23.5690913667254 110-114 20.13808975834292 28.83874518436984 28.058237854605494 22.964927202681743 115-119 20.2614706471649 28.616509717491486 27.39430975756361 23.727709877780004 120-124 20.350087521880468 28.892223055763942 27.206801700425103 23.550887721930483 125-129 20.705000000000002 28.565 27.325 23.405 130-134 20.505000000000003 28.715000000000003 27.275 23.505000000000003 135-139 20.215 29.065 27.575 23.145 140-144 20.75 28.87 26.08 24.3 145-149 20.89 28.93 26.455000000000002 23.724999999999998 150-151 21.28725269221137 28.625093914350114 25.945404457801153 24.142248935637365 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 2.0 22 3.5 23 3.5 24 4.0 25 5.0 26 3.0 27 7.5 28 14.0 29 17.0 30 23.0 31 32.5 32 46.5 33 58.0 34 79.5 35 100.0 36 105.5 37 125.5 38 155.0 39 180.0 40 204.0 41 233.0 42 251.0 43 259.5 44 250.0 45 247.0 46 249.5 47 233.0 48 214.5 49 180.5 50 142.0 51 122.0 52 108.5 53 83.0 54 58.0 55 44.0 56 32.0 57 25.0 58 22.5 59 16.0 60 12.0 61 9.0 62 8.0 63 5.0 64 4.0 65 4.0 66 2.5 67 3.0 68 2.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.675 55-59 2.335 60-64 0.7100000000000001 65-69 0.11499999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.675 110-114 0.065 115-119 0.18 120-124 0.025 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 3.9625000000000004 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166191 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166191_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.967 33.0 33.0 34.0 32.0 34.0 2 32.92325 33.0 33.0 34.0 32.0 34.0 3 32.99925 34.0 33.0 34.0 32.0 34.0 4 33.031 34.0 33.0 34.0 32.0 34.0 5 32.982 34.0 33.0 34.0 32.0 34.0 6 37.14125 38.0 38.0 38.0 36.0 38.0 7 37.23625 38.0 38.0 38.0 37.0 38.0 8 37.16825 38.0 38.0 38.0 37.0 38.0 9 37.18075 38.0 38.0 38.0 37.0 38.0 10-14 37.17065 38.0 38.0 38.0 37.0 38.0 15-19 37.13105 38.0 38.0 38.0 36.8 38.0 20-24 37.12235 38.0 38.0 38.0 36.8 38.0 25-29 37.058899999999994 38.0 38.0 38.0 36.8 38.0 30-34 37.028099999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.93645 38.0 38.0 38.0 36.0 38.0 40-44 36.902 38.0 38.0 38.0 36.0 38.0 45-49 36.79445 38.0 38.0 38.0 35.4 38.0 50-54 36.673950000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.673 38.0 38.0 38.0 34.8 38.0 60-64 36.6726 38.0 38.0 38.0 34.8 38.0 65-69 36.6139 38.0 38.0 38.0 34.8 38.0 70-74 36.48905 38.0 38.0 38.0 34.0 38.0 75-79 36.3746 38.0 38.0 38.0 34.0 38.0 80-84 36.282 38.0 38.0 38.0 34.0 38.0 85-89 36.21635 38.0 38.0 38.0 33.8 38.0 90-94 36.03035 38.0 37.6 38.0 33.2 38.0 95-99 35.80715 38.0 37.2 38.0 31.6 38.0 100-104 35.7745 38.0 37.0 38.0 32.0 38.0 105-109 35.640100000000004 38.0 37.0 38.0 31.0 38.0 110-114 35.3977 38.0 36.8 38.0 29.8 38.0 115-119 35.0967 38.0 36.0 38.0 28.2 38.0 120-124 34.821749999999994 38.0 35.8 38.0 27.4 38.0 125-129 34.5423 38.0 35.0 38.0 26.2 38.0 130-134 34.149899999999995 38.0 35.0 38.0 23.4 38.0 135-139 33.89625 38.0 35.0 38.0 22.6 38.0 140-144 33.32035 38.0 34.0 38.0 17.2 38.0 145-149 32.37345 38.0 33.8 38.0 11.4 38.0 150-151 27.871000000000002 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 1.0 12 4.0 13 2.0 14 3.0 15 2.0 16 7.0 17 6.0 18 5.0 19 8.0 20 15.0 21 7.0 22 8.0 23 15.0 24 11.0 25 18.0 26 21.0 27 23.0 28 36.0 29 45.0 30 46.0 31 59.0 32 88.0 33 137.0 34 199.0 35 328.0 36 696.0 37 2192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.1 17.05 14.149999999999999 26.700000000000003 2 22.975 23.075000000000003 36.075 17.875 3 19.400000000000002 27.950000000000003 32.800000000000004 19.85 4 24.325 34.125 22.075 19.475 5 23.799999999999997 37.325 21.349999999999998 17.525 6 17.958979489744873 38.169084542271136 24.61230615307654 19.259629814907452 7 18.37959489872468 15.57889472368092 44.461115278819705 21.580395098774694 8 20.580145036259065 22.380595148787197 27.581895473868467 29.457364341085274 9 22.255563890972745 24.306076519129782 27.906976744186046 25.531382845711427 10-14 22.98574643660915 28.70217554388597 27.031757939484873 21.280320080020005 15-19 23.69092273068267 27.81695423855964 28.132033008252062 20.360090022505624 20-24 23.036911073321996 28.218465539661896 27.80334100230069 20.941282384715414 25-29 23.0803861737782 28.127657445850634 27.877544895202846 20.914411485168323 30-34 22.370066529938473 28.1426641988895 28.47281276574459 21.014456505427443 35-39 22.980341153519085 28.017607923565606 28.252713721174526 20.749337201740783 40-44 23.30315610463662 28.22487870754764 27.77472115240334 20.697244035412393 45-49 22.819127651060427 28.436374549819927 28.416366546618647 20.328131252501 50-54 22.971485742871437 27.988994497248626 28.189094547273637 20.850425212606304 55-59 23.645640538242212 27.547396328347755 27.882547146215796 20.924415987194237 60-64 22.87529388224701 28.14766644990246 28.362763243459554 20.614276424390976 65-69 23.254301720688275 28.12124849939976 28.051220488195277 20.573229291716686 70-74 23.121560780390197 27.428714357178592 28.534267133566782 20.915457728864432 75-79 23.14657328664332 27.888944472236116 28.38419209604802 20.580290145072535 80-84 22.916458229114557 28.81940970485243 27.863931965982992 20.400200100050025 85-89 23.47673836918459 28.91445722861431 27.613806903451728 19.994997498749374 90-94 23.336668334167083 27.933966983491747 28.194097048524263 20.535267633816908 95-99 23.07153576788394 28.58929464732366 27.793896948474238 20.54527263631816 100-104 23.676838419209606 28.039019509754876 27.988994497248626 20.295147573786892 105-109 24.117058529264632 27.888944472236116 27.86893446723362 20.125062531265634 110-114 23.601800900450225 28.519259629814908 27.963981990995496 19.91495747873937 115-119 24.338121215154395 27.966568239827836 28.051649066613283 19.643661478404482 120-124 24.345562840983032 28.139546523850044 28.01441513589269 19.500475499274238 125-129 24.214528717230337 27.831699019411648 28.281969181508902 19.67180308184911 130-134 24.29093091891351 28.01260567255265 27.537391826321844 20.159071582211997 135-139 24.338518481468512 29.0401640574201 27.18951633071575 19.431801130395638 140-144 24.718651528034812 28.800080028009805 26.689341269444306 19.791927174511077 145-149 25.280112044817926 27.981192476990795 27.3609443777511 19.37775110044018 150-151 25.065633204150515 28.27853481685211 27.11588948618577 19.5399424928116 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 8.5 27 8.0 28 6.5 29 10.5 30 17.5 31 29.0 32 34.5 33 40.5 34 48.0 35 65.0 36 93.0 37 117.0 38 134.0 39 165.5 40 215.5 41 239.0 42 245.5 43 262.5 44 275.0 45 276.5 46 279.5 47 255.5 48 225.0 49 189.0 50 142.5 51 124.5 52 107.5 53 96.0 54 71.0 55 44.5 56 37.5 57 26.0 58 20.5 59 19.0 60 18.0 61 14.0 62 7.0 63 5.5 64 3.0 65 1.5 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.03 25-29 0.045 30-34 0.045 35-39 0.045 40-44 0.034999999999999996 45-49 0.04 50-54 0.05 55-59 0.045 60-64 0.045 65-69 0.04 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.095 120-124 0.105 125-129 0.06 130-134 0.045 135-139 0.034999999999999996 140-144 0.034999999999999996 145-149 0.04 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54716981132076 98.925 2 0.3270440251572327 0.65 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.449999999999999 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.7125 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGAT 10 0.0068519996 144.85 1 TCCAAAG 10 0.0068519996 144.85 7 CCGGTTC 10 0.0068519996 144.85 9 >>END_MODULE Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026057 spots for SRR7166191.sra Written 1026057 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra Read 1026047 spots for SRR7166191.sra Written 1026047 spots for SRR7166191.sra SRR ids: ['SRR7166191.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eocf2_i5 SRR7166191.sra spots: 20520950 blocks: [[1, 1026047], [1026048, 2052094], [2052095, 3078141], [3078142, 4104188], [4104189, 5130235], [5130236, 6156282], [6156283, 7182329], [7182330, 8208376], [8208377, 9234423], [9234424, 10260470], [10260471, 11286517], [11286518, 12312564], [12312565, 13338611], [13338612, 14364658], [14364659, 15390705], [15390706, 16416752], [16416753, 17442799], [17442800, 18468846], [18468847, 19494893], [19494894, 20520950]] SRR7166191 file size 6932176 SRR7166191 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166191 SRR7166191_1.fastq SRR7166191_2.fastq Input file: SRR7166191_1.fastq Paired file: SRR7166191_2.fastq trimmed: SRR7166191-trimmed-pair1.fastq, SRR7166191-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 00:27:27 2025 >> started Sat Feb 15 00:27:49 2025 >> done (21.285s) 20520950 read pairs processed; of these: 19454 ( 0.09%) short read pairs filtered out after trimming by size control 13667 ( 0.07%) empty read pairs filtered out after trimming by size control 20487829 (99.84%) read pairs available; of these: 9537805 (46.55%) trimmed read pairs available after processing 10950024 (53.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 12 0.00% 20 11 0.00% 21 11 0.00% 22 16 0.00% 23 9 0.00% 24 9 0.00% 25 6 0.00% 26 11 0.00% 27 10 0.00% 28 17 0.00% 29 18 0.00% 30 15 0.00% 31 12 0.00% 32 5 0.00% 33 13 0.00% 34 15 0.00% 35 13 0.00% 36 16 0.00% 37 17 0.00% 38 20 0.00% 39 19 0.00% 40 30 0.00% 41 18 0.00% 42 16 0.00% 43 27 0.00% 44 36 0.00% 45 31 0.00% 46 41 0.00% 47 47 0.00% 48 71 0.00% 49 80 0.00% 50 84 0.00% 51 97 0.00% 52 99 0.00% 53 116 0.00% 54 125 0.00% 55 137 0.00% 56 150 0.00% 57 194 0.00% 58 217 0.00% 59 240 0.00% 60 303 0.00% 61 339 0.00% 62 382 0.00% 63 465 0.00% 64 526 0.00% 65 498 0.00% 66 609 0.00% 67 677 0.00% 68 802 0.00% 69 902 0.00% 70 1060 0.01% 71 1247 0.01% 72 1439 0.01% 73 1633 0.01% 74 1866 0.01% 75 2076 0.01% 76 2346 0.01% 77 2433 0.01% 78 2763 0.01% 79 3221 0.02% 80 3631 0.02% 81 4065 0.02% 82 4820 0.02% 83 5754 0.03% 84 7540 0.04% 85 7630 0.04% 86 8016 0.04% 87 8610 0.04% 88 9177 0.04% 89 9672 0.05% 90 10515 0.05% 91 11610 0.06% 92 12702 0.06% 93 14364 0.07% 94 15064 0.07% 95 15949 0.08% 96 16869 0.08% 97 17184 0.08% 98 17822 0.09% 99 19800 0.10% 100 20101 0.10% 101 21608 0.11% 102 23043 0.11% 103 24926 0.12% 104 26659 0.13% 105 28240 0.14% 106 29196 0.14% 107 29854 0.15% 108 30895 0.15% 109 31826 0.16% 110 32544 0.16% 111 34769 0.17% 112 37255 0.18% 113 40326 0.20% 114 41892 0.20% 115 44624 0.22% 116 45857 0.22% 117 46820 0.23% 118 48069 0.23% 119 49357 0.24% 120 50185 0.24% 121 52534 0.26% 122 55129 0.27% 123 58148 0.28% 124 61588 0.30% 125 64617 0.32% 126 66864 0.33% 127 68219 0.33% 128 69626 0.34% 129 71574 0.35% 130 73762 0.36% 131 76563 0.37% 132 81159 0.40% 133 84666 0.41% 134 89315 0.44% 135 94602 0.46% 136 98979 0.48% 137 104170 0.51% 138 109044 0.53% 139 114695 0.56% 140 120842 0.59% 141 130377 0.64% 142 141475 0.69% 143 154563 0.75% 144 178641 0.87% 145 209861 1.02% 146 255514 1.25% 147 331086 1.62% 148 487464 2.38% 149 901396 4.40% 150 4144770 20.23% 151 10950024 53.45% 20487829 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.5 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=221.74 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=14.2 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=34 prefix-density=0.31 prefix-fanout=2.1 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=138.60 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=17.7 sequence=TGGTGGTGGTGGAGTCTGTGGTTTGTCCGAAGCCAAGGAGATTGGGACTTTTAAATCCTCCTCTTAATGAACAAATCAGACCTCTAAGATTGCCTGTCAATCACCATGCGGAGATGGCAGATTCGAAAGCCGGGGCAGAGCTGCTAGACATAATTCTTACTAAGGGAGGTTATGGTGGGGACAAACCCGGTTTCCAGGTGGCATCATCACCACCATTTTACTGTGGATCACCACCATGTAGGGTATCAAATCCTGTAATCCAAGATGCTCGATTTGGTAATGAAAAAATAACCCCATTATCTCCTGCGCCACCATCCCCACCACCATCCTCATCATCTGCACGTAAAGGAGGAGGTTGTGTCCGAATGAAGTTTGGGCACACGCCAGCTGCAGTAAGGATTGAAGGGTTTGATTGTCTCCGCAGAGATGGGCGAAACTGTAGCATCTCCGCTGTGGCATGAACATTGAATTGGTGAAACCTTCAATGCAGCAAATTTTTGATTATATAAGA SRR7166191 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 00:28:48 Started mapping on | Feb 15 00:28:49 Finished on | Feb 15 00:33:02 Mapping speed, Million of reads per hour | 291.53 Number of input reads | 20487829 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18266593 Uniquely mapped reads % | 89.16% Average mapped length | 292.30 Number of splices: Total | 16648258 Number of splices: Annotated (sjdb) | 16248931 Number of splices: GT/AG | 16350143 Number of splices: GC/AG | 225677 Number of splices: AT/AC | 16207 Number of splices: Non-canonical | 56231 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.28 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431177 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 74099 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.27% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1806704 1806704 1806704 N_multimapping 431177 431177 431177 N_noFeature 763660 18042919 898450 N_ambiguous 199651 1891 109449 UnstrandedReadsAssigned:17303282 PositiveStrandReadsAssigned:221783 NegativeStrandReadsAssigned:17258694 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166191 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166191-trimmed-pair1.fastq SRR7166191-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,487,829 reads, 17,182,943 reads pseudoaligned [quant] estimated average fragment length: 235.153 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR7166191.ke.tsv 34699 SRR7166191.se.tsv 87100 total ==> SRR7166191.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.85 1600 47.7304 Potri.005G024800.1.v4.1 1035 800.847 686 45.5834 Potri.004G059700.1.v4.1 961 726.89 4 0.292835 Potri.007G009000.2.v4.1 1416 1181.85 0 0 Potri.003G141000.2.v4.1 2943 2708.85 678.263 13.3243 Potri.016G087400.1.v4.1 270 87.1195 806.194 492.444 Potri.015G069301.1.v4.1 564 335.966 0 0 Potri.010G195200.1.v4.1 1773 1538.85 1604 55.4678 Potri.012G127500.1.v4.1 977 742.874 59406 4255.47 ==> SRR7166191.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 497 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 465 SRR7166191 completed mapping pipeline successfully