Starting /dee2/code/volunteer_pipeline.sh SRR7166192 current disk space = 3107777286144 free memory = 1448544560 SRR7166192 SRAfilesize fcf90358aaa283a5270a6f208cdc6117 SRR7166192.sra SRR7166192.sra file validated SRR7166192 is paired end SRR7166192 is conventional basespace SRR7166192 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166192_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.98175 30.0 18.0 32.0 18.0 33.0 2 31.7435 33.0 32.0 33.0 27.0 33.0 3 32.0965 33.0 33.0 33.0 29.0 34.0 4 32.682 33.0 33.0 34.0 31.0 34.0 5 32.7405 33.0 33.0 34.0 32.0 34.0 6 36.84625 38.0 37.0 38.0 35.0 38.0 7 37.36975 38.0 38.0 38.0 37.0 38.0 8 37.394 38.0 38.0 38.0 37.0 38.0 9 37.49525 38.0 38.0 38.0 37.0 38.0 10-14 37.503750000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.507 38.0 38.0 38.0 37.0 38.0 20-24 37.509100000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.4546 38.0 38.0 38.0 37.0 38.0 30-34 37.4385 38.0 38.0 38.0 37.0 38.0 35-39 37.42435 38.0 38.0 38.0 37.0 38.0 40-44 37.3979 38.0 38.0 38.0 37.0 38.0 45-49 37.40005000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.116 38.0 38.0 38.0 36.6 38.0 55-59 36.47435 38.0 38.0 38.0 35.6 38.0 60-64 36.81565 38.0 38.0 38.0 35.6 38.0 65-69 37.05765 38.0 38.0 38.0 36.0 38.0 70-74 37.10615 38.0 38.0 38.0 36.0 38.0 75-79 36.9798 38.0 38.0 38.0 36.0 38.0 80-84 36.90259999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.80425 38.0 38.0 38.0 35.2 38.0 90-94 36.70915 38.0 38.0 38.0 34.4 38.0 95-99 36.62075 38.0 38.0 38.0 34.2 38.0 100-104 36.57215000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.1896 38.0 37.8 38.0 33.6 38.0 110-114 36.234249999999996 38.0 37.4 38.0 33.4 38.0 115-119 36.0754 38.0 37.0 38.0 33.0 38.0 120-124 35.90995 38.0 37.0 38.0 32.2 38.0 125-129 35.796299999999995 38.0 36.8 38.0 31.4 38.0 130-134 35.58265 38.0 36.0 38.0 31.2 38.0 135-139 35.26055 38.0 36.0 38.0 30.0 38.0 140-144 34.9443 38.0 36.0 38.0 28.2 38.0 145-149 34.41475 38.0 35.0 38.0 26.2 38.0 150-151 31.355375000000002 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 3.0 22 3.0 23 5.0 24 10.0 25 10.0 26 20.0 27 22.0 28 18.0 29 36.0 30 51.0 31 65.0 32 60.0 33 105.0 34 168.0 35 279.0 36 655.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.8051948051948 17.87012987012987 12.545454545454545 36.77922077922078 2 19.950000000000003 25.8 36.775000000000006 17.474999999999998 3 16.1 31.75 27.224999999999998 24.925 4 20.65 38.224999999999994 20.4 20.724999999999998 5 19.96497373029772 38.62897172879659 23.942957217913435 17.463097322992244 6 16.3 36.375 26.55 20.775 7 12.75 19.7 46.0 21.55 8 18.25 19.2 29.075 33.475 9 17.2 22.5 30.325000000000003 29.975 10-14 19.395 29.21 27.01 24.385 15-19 20.32 28.21 27.36 24.11 20-24 19.61 28.625 28.025 23.74 25-29 19.205 29.225 28.02 23.549999999999997 30-34 19.625981299064954 28.73143657182859 28.10140507025351 23.541177058852945 35-39 19.81 28.935 27.950000000000003 23.305 40-44 20.225 29.03 27.389999999999997 23.355 45-49 19.925 28.84 27.700000000000003 23.535 50-54 20.309905921416714 28.621019268501286 27.37334607838205 23.695728731699955 55-59 20.272824809686814 29.25969447708578 27.318244520512952 23.149236192714454 60-64 20.115781525295745 28.809463881198088 27.047571104958468 24.027183488547696 65-69 20.36749611976168 28.493466179342114 27.447053522255043 23.691984178641164 70-74 20.205000000000002 28.544999999999998 27.944999999999997 23.305 75-79 20.0 28.999999999999996 27.04 23.96 80-84 19.79 28.84 27.725 23.645 85-89 19.925 28.82 27.61 23.645 90-94 19.994999999999997 28.865000000000002 28.17 22.97 95-99 20.21 28.244999999999997 27.639999999999997 23.905 100-104 20.24816130484815 28.45349477160154 27.46785410516836 23.83048981838195 105-109 20.41658281344335 28.833769370094586 27.43006641175287 23.319581404709197 110-114 20.62252914977731 28.609317920232197 28.06885852975029 22.699294400240206 115-119 20.605180101197334 29.26707078803667 27.13791894193678 22.98983016882922 120-124 20.86521630407602 28.152038009502377 27.426856714178545 23.55588897224306 125-129 20.62 28.34 27.295 23.745 130-134 20.655 29.404999999999998 26.33 23.61 135-139 20.669999999999998 28.515 27.075 23.74 140-144 21.44 28.060000000000002 26.945000000000004 23.555 145-149 20.95 28.48 26.58 23.990000000000002 150-151 20.047583270723766 28.61257200100175 27.598297019784624 23.741547708489858 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 1.5 24 2.0 25 3.5 26 6.5 27 6.5 28 9.0 29 16.0 30 23.0 31 25.5 32 26.5 33 53.0 34 71.5 35 78.0 36 108.0 37 136.5 38 154.0 39 172.0 40 206.5 41 222.5 42 231.0 43 259.0 44 264.5 45 250.5 46 249.0 47 254.0 48 234.0 49 199.5 50 171.0 51 143.5 52 109.5 53 78.0 54 58.5 55 45.0 56 35.0 57 27.0 58 19.0 59 9.5 60 7.5 61 8.5 62 6.5 63 4.0 64 1.5 65 2.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.615 55-59 2.1350000000000002 60-64 0.675 65-69 0.135 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.62 110-114 0.08499999999999999 115-119 0.19499999999999998 120-124 0.025 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.199999999999999 0.0 0.0 0.0 0.0 138-139 7.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTATTA 10 0.0066386363 146.3671 145 CCTATCA 10 0.0068963906 144.5375 5 GCCTATC 10 0.0068963906 144.5375 4 >>END_MODULE SRR7166192 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166192_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97125 33.0 33.0 34.0 32.0 34.0 2 33.0245 34.0 33.0 34.0 32.0 34.0 3 33.14025 34.0 33.0 34.0 32.0 34.0 4 33.0735 34.0 33.0 34.0 33.0 34.0 5 33.04025 34.0 33.0 34.0 33.0 34.0 6 37.299 38.0 38.0 38.0 37.0 38.0 7 37.33775 38.0 38.0 38.0 37.0 38.0 8 37.23875 38.0 38.0 38.0 37.0 38.0 9 37.25425 38.0 38.0 38.0 37.0 38.0 10-14 37.26395 38.0 38.0 38.0 37.0 38.0 15-19 37.206050000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.1808 38.0 38.0 38.0 37.0 38.0 25-29 37.13195 38.0 38.0 38.0 36.8 38.0 30-34 37.081849999999996 38.0 38.0 38.0 36.6 38.0 35-39 37.052749999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.98325 38.0 38.0 38.0 36.0 38.0 45-49 36.8817 38.0 38.0 38.0 35.8 38.0 50-54 36.75915 38.0 38.0 38.0 35.4 38.0 55-59 36.75415 38.0 38.0 38.0 35.2 38.0 60-64 36.82040000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.793000000000006 38.0 38.0 38.0 35.0 38.0 70-74 36.62265000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.509249999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.48295 38.0 38.0 38.0 34.0 38.0 85-89 36.359500000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.28960000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.057249999999996 38.0 37.4 38.0 33.2 38.0 100-104 35.98295 38.0 37.0 38.0 33.0 38.0 105-109 35.83225 38.0 37.0 38.0 32.6 38.0 110-114 35.64575 38.0 37.0 38.0 31.4 38.0 115-119 35.38195 38.0 36.4 38.0 29.8 38.0 120-124 35.1163 38.0 36.0 38.0 28.2 38.0 125-129 34.881449999999994 38.0 36.0 38.0 27.8 38.0 130-134 34.462900000000005 38.0 35.0 38.0 25.2 38.0 135-139 34.25845 38.0 35.0 38.0 24.0 38.0 140-144 33.66915 38.0 34.6 38.0 21.8 38.0 145-149 32.81505 38.0 34.0 38.0 14.2 38.0 150-151 28.684375000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 3.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 3.0 12 1.0 13 2.0 14 1.0 15 2.0 16 4.0 17 2.0 18 6.0 19 8.0 20 9.0 21 7.0 22 10.0 23 13.0 24 10.0 25 13.0 26 24.0 27 22.0 28 39.0 29 47.0 30 39.0 31 59.0 32 76.0 33 126.0 34 163.0 35 289.0 36 705.0 37 2305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.074999999999996 15.625 14.85 30.45 2 23.325000000000003 23.45 36.0 17.224999999999998 3 20.674999999999997 25.974999999999998 31.674999999999997 21.675 4 23.974999999999998 35.625 20.775 19.625 5 22.45 39.4 21.2 16.950000000000003 6 18.12953238309577 37.934483620905226 23.455863965991497 20.4801200300075 7 16.954238559639908 15.403850962740684 45.76144036009002 21.880470117529384 8 20.930232558139537 21.73043260815204 27.631907976994246 29.707426856714182 9 22.88072018004501 24.006001500375092 28.132033008252062 24.981245311327832 10-14 22.53063265816454 29.10227556889222 26.71167791947987 21.655413853463365 15-19 22.820705176294073 27.60690172543136 28.632158039509875 20.940235058764692 20-24 22.595648912228057 27.796949237309327 28.772193048262068 20.83520880220055 25-29 22.970742685671418 28.197049262315577 28.152038009502377 20.68017004251063 30-34 22.360590147536886 28.592148037009252 28.267066766691674 20.78019504876219 35-39 23.13078269567392 27.651912978244564 28.177044261065266 21.040260065016252 40-44 23.20080020005001 27.541885471367845 28.457114278569644 20.800200050012503 45-49 23.12578144536134 27.996999249812454 28.122030507626906 20.7551887971993 50-54 22.885721430357588 28.247061765441362 28.392098024506122 20.475118779694924 55-59 23.74593648412103 28.157039259814955 27.571892973243312 20.525131282820706 60-64 23.5008752188047 28.41210302575644 27.97199299824956 20.115028757189297 65-69 23.465866466616657 27.711927981995498 28.577144286071515 20.24506126531633 70-74 23.995998999749936 27.526881720430108 28.22705676419105 20.25006251562891 75-79 23.42585646411603 28.152038009502377 27.81695423855964 20.605151287821954 80-84 23.465866466616657 28.13703425856464 27.861965491372843 20.53513378344586 85-89 23.455863965991497 28.067016754188543 27.921980495123783 20.555138784696176 90-94 23.45086271567892 28.077019254813703 27.851962990747687 20.62015503875969 95-99 23.300825206301575 27.826956739184794 28.247061765441362 20.62515628907227 100-104 23.440860215053764 27.541885471367845 28.777194298574642 20.24006001500375 105-109 23.56089022255564 28.11702925731433 27.916979244811202 20.40510127531883 110-114 23.58089522380595 27.81695423855964 28.712178044511127 19.88997249312328 115-119 23.80595148787197 27.771942985746435 28.442110527631908 19.979994998749685 120-124 23.845961490372595 27.936984246061513 28.127031757939484 20.090022505626408 125-129 24.336084021005252 27.826956739184794 28.02700675168792 19.809952488122033 130-134 24.15603900975244 27.831957989497376 27.866966741685424 20.145036259064767 135-139 24.82120530132533 27.46686671667917 27.81695423855964 19.89497374343586 140-144 24.66616654163541 28.197049262315577 27.73693423355839 19.399849962490624 145-149 24.60615153788447 28.177044261065266 27.616904226056516 19.599899974993747 150-151 25.51568946118265 27.628453556694588 27.628453556694588 19.22740342542818 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 1.5 25 2.0 26 4.5 27 5.5 28 4.5 29 8.0 30 16.5 31 19.0 32 18.5 33 27.0 34 47.5 35 63.5 36 86.0 37 119.0 38 145.0 39 165.0 40 187.5 41 238.0 42 271.0 43 277.5 44 285.0 45 286.0 46 269.5 47 247.5 48 235.5 49 203.0 50 171.0 51 151.5 52 111.5 53 73.0 54 60.5 55 49.0 56 38.5 57 30.5 58 20.5 59 17.0 60 15.0 61 9.0 62 3.5 63 2.0 64 1.0 65 0.0 66 0.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.2762430939226519 0.5499999999999999 3 0.05022601707684581 0.15 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 4.012499999999999 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963993 spots for SRR7166192.sra Written 963993 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra Read 963976 spots for SRR7166192.sra Written 963976 spots for SRR7166192.sra SRR ids: ['SRR7166192.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n4uplatr SRR7166192.sra spots: 19279537 blocks: [[1, 963976], [963977, 1927952], [1927953, 2891928], [2891929, 3855904], [3855905, 4819880], [4819881, 5783856], [5783857, 6747832], [6747833, 7711808], [7711809, 8675784], [8675785, 9639760], [9639761, 10603736], [10603737, 11567712], [11567713, 12531688], [12531689, 13495664], [13495665, 14459640], [14459641, 15423616], [15423617, 16387592], [16387593, 17351568], [17351569, 18315544], [18315545, 19279537]] SRR7166192 file size 6511502 SRR7166192 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166192 SRR7166192_1.fastq SRR7166192_2.fastq Input file: SRR7166192_1.fastq Paired file: SRR7166192_2.fastq trimmed: SRR7166192-trimmed-pair1.fastq, SRR7166192-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 22:19:17 2025 >> started Fri Feb 14 22:19:53 2025 >> done (36.406s) 19279537 read pairs processed; of these: 17744 ( 0.09%) short read pairs filtered out after trimming by size control 14429 ( 0.07%) empty read pairs filtered out after trimming by size control 19247364 (99.83%) read pairs available; of these: 8835294 (45.90%) trimmed read pairs available after processing 10412070 (54.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 10 0.00% 21 2 0.00% 22 5 0.00% 23 10 0.00% 24 6 0.00% 25 13 0.00% 26 9 0.00% 27 8 0.00% 28 9 0.00% 29 6 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 11 0.00% 34 14 0.00% 35 8 0.00% 36 13 0.00% 37 18 0.00% 38 9 0.00% 39 15 0.00% 40 12 0.00% 41 29 0.00% 42 21 0.00% 43 23 0.00% 44 26 0.00% 45 39 0.00% 46 35 0.00% 47 44 0.00% 48 56 0.00% 49 66 0.00% 50 67 0.00% 51 69 0.00% 52 95 0.00% 53 95 0.00% 54 85 0.00% 55 147 0.00% 56 124 0.00% 57 178 0.00% 58 232 0.00% 59 195 0.00% 60 230 0.00% 61 297 0.00% 62 337 0.00% 63 353 0.00% 64 421 0.00% 65 425 0.00% 66 533 0.00% 67 609 0.00% 68 631 0.00% 69 829 0.00% 70 878 0.00% 71 1069 0.01% 72 1212 0.01% 73 1403 0.01% 74 1570 0.01% 75 1795 0.01% 76 2175 0.01% 77 2169 0.01% 78 2380 0.01% 79 2814 0.01% 80 3032 0.02% 81 3656 0.02% 82 4213 0.02% 83 4790 0.02% 84 6463 0.03% 85 6783 0.04% 86 7022 0.04% 87 7713 0.04% 88 8120 0.04% 89 8598 0.04% 90 9646 0.05% 91 10594 0.06% 92 11301 0.06% 93 12334 0.06% 94 13237 0.07% 95 13863 0.07% 96 14543 0.08% 97 15554 0.08% 98 16788 0.09% 99 18375 0.10% 100 18551 0.10% 101 19937 0.10% 102 21097 0.11% 103 22699 0.12% 104 23903 0.12% 105 25249 0.13% 106 26237 0.14% 107 27329 0.14% 108 28302 0.15% 109 29866 0.16% 110 31141 0.16% 111 32771 0.17% 112 34587 0.18% 113 36334 0.19% 114 38176 0.20% 115 40404 0.21% 116 41654 0.22% 117 43370 0.23% 118 44771 0.23% 119 46079 0.24% 120 46870 0.24% 121 49433 0.26% 122 51322 0.27% 123 54314 0.28% 124 56797 0.30% 125 58885 0.31% 126 61057 0.32% 127 63730 0.33% 128 64617 0.34% 129 67341 0.35% 130 69639 0.36% 131 72238 0.38% 132 75789 0.39% 133 79561 0.41% 134 83507 0.43% 135 87494 0.45% 136 91116 0.47% 137 95735 0.50% 138 100934 0.52% 139 106784 0.55% 140 113190 0.59% 141 122281 0.64% 142 133635 0.69% 143 145430 0.76% 144 166063 0.86% 145 193733 1.01% 146 234717 1.22% 147 303886 1.58% 148 445708 2.32% 149 827060 4.30% 150 3859383 20.05% 151 10412070 54.10% 19247364 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.16 fanout-score-rank=20 prefix-density=0.37 prefix-fanout=2.5 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=22.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=AATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=31 prefix-density=0.56 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=41.85 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166192 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 22:21:18 Started mapping on | Feb 14 22:21:18 Finished on | Feb 14 22:23:52 Mapping speed, Million of reads per hour | 449.94 Number of input reads | 19247364 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18268623 Uniquely mapped reads % | 94.91% Average mapped length | 292.67 Number of splices: Total | 17735124 Number of splices: Annotated (sjdb) | 17392239 Number of splices: GT/AG | 17443656 Number of splices: GC/AG | 228869 Number of splices: AT/AC | 12136 Number of splices: Non-canonical | 50463 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 475731 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 54622 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518294 518294 518294 N_multimapping 475731 475731 475731 N_noFeature 597096 18039126 736794 N_ambiguous 180083 1077 89492 UnstrandedReadsAssigned:17491444 PositiveStrandReadsAssigned:228420 NegativeStrandReadsAssigned:17442337 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166192 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166192-trimmed-pair1.fastq SRR7166192-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,247,364 reads, 17,352,650 reads pseudoaligned [quant] estimated average fragment length: 234.69 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR7166192.ke.tsv 34699 SRR7166192.se.tsv 87100 total ==> SRR7166192.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.31 1578 51.7143 Potri.005G024800.1.v4.1 1035 801.31 318 23.206 Potri.004G059700.1.v4.1 961 727.346 43 3.45702 Potri.007G009000.2.v4.1 1416 1182.31 0 0 Potri.003G141000.2.v4.1 2943 2709.31 641.177 13.8386 Potri.016G087400.1.v4.1 270 86.781 1039 700.107 Potri.015G069301.1.v4.1 564 336.765 0 0 Potri.010G195200.1.v4.1 1773 1539.31 413.835 15.7208 Potri.012G127500.1.v4.1 977 743.33 4499 353.922 ==> SRR7166192.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 515 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 330 SRR7166192 completed mapping pipeline successfully