Starting /dee2/code/volunteer_pipeline.sh SRR7166193 current disk space = 3106002255872 free memory = 1579468796 SRR7166193 SRAfilesize 43c14676b8f875385f94c93b176031d5 SRR7166193.sra SRR7166193.sra file validated SRR7166193 is paired end SRR7166193 is conventional basespace SRR7166193 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166193_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.975 33.0 32.0 34.0 30.0 34.0 2 32.141 33.0 33.0 34.0 29.0 34.0 3 32.153 33.0 32.0 34.0 30.0 34.0 4 32.02425 33.0 32.0 34.0 30.0 34.0 5 32.31875 33.0 33.0 34.0 31.0 34.0 6 36.19425 38.0 37.0 38.0 33.0 38.0 7 36.71125 38.0 37.0 38.0 34.0 38.0 8 36.85475 38.0 38.0 38.0 35.0 38.0 9 36.9485 38.0 38.0 38.0 35.0 38.0 10-14 36.94665 38.0 38.0 38.0 35.4 38.0 15-19 36.82725 38.0 38.0 38.0 34.8 38.0 20-24 36.88095 38.0 38.0 38.0 35.0 38.0 25-29 36.6586 38.0 38.0 38.0 34.2 38.0 30-34 36.562149999999995 38.0 38.0 38.0 34.0 38.0 35-39 36.34285 38.0 37.4 38.0 33.2 38.0 40-44 36.20360000000001 38.0 37.0 38.0 33.2 38.0 45-49 36.216499999999996 38.0 37.0 38.0 33.2 38.0 50-54 36.01345 38.0 37.0 38.0 31.8 38.0 55-59 35.750750000000004 38.0 37.0 38.0 29.8 38.0 60-64 35.81015 38.0 36.8 38.0 30.6 38.0 65-69 35.5721 38.0 36.0 38.0 29.6 38.0 70-74 35.583549999999995 38.0 36.0 38.0 29.0 38.0 75-79 34.9673 38.0 35.8 38.0 27.6 38.0 80-84 34.7565 38.0 35.2 38.0 27.4 38.0 85-89 34.7714 38.0 35.0 38.0 27.0 38.0 90-94 34.581849999999996 38.0 34.8 38.0 25.8 38.0 95-99 34.2548 38.0 34.0 38.0 24.6 38.0 100-104 34.082350000000005 38.0 34.0 38.0 23.8 38.0 105-109 33.575900000000004 37.4 33.8 38.0 19.4 38.0 110-114 33.1241 37.0 32.6 38.0 15.0 38.0 115-119 32.47325000000001 37.0 31.0 38.0 15.0 38.0 120-124 32.077 36.8 30.4 38.0 15.0 38.0 125-129 31.516150000000003 36.2 30.4 38.0 14.6 38.0 130-134 29.602050000000002 34.2 24.4 38.0 13.2 38.0 135-139 28.55045 33.0 21.8 38.0 12.2 38.0 140-144 27.612949999999994 33.0 19.0 38.0 2.0 38.0 145-149 25.219950000000004 33.0 8.6 38.0 2.0 38.0 150-151 19.11125 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 3.0 14 0.0 15 2.0 16 1.0 17 7.0 18 6.0 19 9.0 20 10.0 21 20.0 22 33.0 23 29.0 24 35.0 25 67.0 26 62.0 27 87.0 28 82.0 29 114.0 30 158.0 31 193.0 32 229.0 33 339.0 34 456.0 35 578.0 36 866.0 37 610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.4575459813555 16.301335348954396 10.985134794658604 36.2559838750315 2 19.15 25.55 37.025000000000006 18.275 3 18.25 31.025000000000002 25.624999999999996 25.1 4 21.825 38.224999999999994 19.675 20.275000000000002 5 19.975 38.475 22.15 19.400000000000002 6 15.024999999999999 36.449999999999996 26.275 22.25 7 11.875 20.4 46.325 21.4 8 16.650000000000002 20.674999999999997 29.2 33.475 9 18.775 22.35 29.725 29.15 10-14 19.29 30.2 26.21 24.3 15-19 19.27 29.74 27.68 23.31 20-24 19.805 29.53 27.505000000000003 23.16 25-29 19.095000000000002 29.54 27.994999999999997 23.369999999999997 30-34 19.17 29.15 28.349999999999998 23.330000000000002 35-39 19.43 29.335 28.32 22.915 40-44 19.34 29.365000000000002 28.025 23.27 45-49 19.195 29.14 28.199999999999996 23.465 50-54 19.45 29.115000000000002 27.834999999999997 23.599999999999998 55-59 18.945 29.904999999999998 28.165000000000003 22.985 60-64 19.375 29.29 27.92 23.415 65-69 19.400000000000002 28.799999999999997 28.110000000000003 23.69 70-74 19.50390078015603 29.295859171834365 27.845569113822766 23.35467093418684 75-79 19.587160593519734 29.120823660038358 28.126577167659235 23.16543857878268 80-84 19.87568223165555 28.769961592884574 27.799676571659592 23.55467960380028 85-89 19.470000000000002 29.299999999999997 28.365000000000002 22.865 90-94 19.845 29.01 27.845 23.3 95-99 19.615 28.815 28.025 23.544999999999998 100-104 19.73 28.315 27.750000000000004 24.205 105-109 19.715 28.675 28.205000000000002 23.405 110-114 20.01 28.76 27.639999999999997 23.59 115-119 19.855 28.02 27.950000000000003 24.175 120-124 20.592355413247947 29.047428457074243 27.46147688613168 22.898739243546128 125-129 20.059011802360473 28.855771154230847 28.080616123224644 23.00460092018404 130-134 19.91455139482282 28.68559939683338 27.19276200050264 24.207087207841166 135-139 19.87789010109098 28.2854569112201 27.759983985587027 24.07666900210189 140-144 20.304212949064347 27.979585709996996 28.13969778845192 23.57650355248674 145-149 20.276913815591453 28.448881308317446 27.360288953546704 23.913915922544398 150-151 21.098157201955622 26.902344239689107 27.779867117964148 24.219631440391122 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.5 25 4.0 26 6.5 27 10.5 28 14.5 29 23.5 30 30.0 31 34.5 32 48.0 33 56.0 34 68.0 35 85.5 36 107.0 37 146.0 38 169.5 39 187.0 40 216.0 41 238.0 42 262.0 43 286.5 44 278.0 45 248.0 46 230.5 47 229.5 48 210.0 49 174.0 50 140.0 51 118.0 52 100.5 53 72.0 54 50.5 55 39.5 56 30.5 57 18.5 58 15.0 59 10.5 60 5.0 61 5.0 62 6.0 63 5.0 64 2.0 65 0.5 66 1.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 0.9299999999999999 80-84 1.06 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06 125-129 0.02 130-134 0.525 135-139 0.09 140-144 0.06999999999999999 145-149 0.33 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.0250000000000004 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.137499999999999 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.0125 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAT 10 0.006882143 144.6375 9 TCAGCGT 10 0.006882143 144.6375 7 ACTCAGC 10 0.006882143 144.6375 5 >>END_MODULE SRR7166193 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166193_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.418 33.0 33.0 34.0 32.0 34.0 2 32.4625 33.0 33.0 34.0 32.0 34.0 3 32.603 33.0 33.0 34.0 32.0 34.0 4 32.5205 33.0 33.0 34.0 32.0 34.0 5 32.48575 33.0 33.0 34.0 31.0 34.0 6 36.5625 38.0 38.0 38.0 34.0 38.0 7 36.559 38.0 38.0 38.0 34.0 38.0 8 36.73125 38.0 38.0 38.0 35.0 38.0 9 36.6355 38.0 38.0 38.0 35.0 38.0 10-14 36.444700000000005 38.0 38.0 38.0 34.4 38.0 15-19 36.351800000000004 38.0 38.0 38.0 34.0 38.0 20-24 36.14425 38.0 38.0 38.0 33.4 38.0 25-29 36.2874 38.0 38.0 38.0 34.0 38.0 30-34 36.251349999999995 38.0 38.0 38.0 33.8 38.0 35-39 36.09105 38.0 38.0 38.0 32.8 38.0 40-44 35.973 38.0 38.0 38.0 32.2 38.0 45-49 35.768550000000005 38.0 37.0 38.0 31.0 38.0 50-54 35.7479 38.0 37.0 38.0 31.0 38.0 55-59 35.65975 38.0 37.0 38.0 30.2 38.0 60-64 35.689049999999995 38.0 37.0 38.0 30.2 38.0 65-69 35.5937 38.0 37.0 38.0 29.8 38.0 70-74 35.41055 38.0 37.0 38.0 29.0 38.0 75-79 35.232899999999994 38.0 36.6 38.0 28.4 38.0 80-84 34.95269999999999 38.0 36.0 38.0 27.8 38.0 85-89 34.8303 38.0 36.0 38.0 26.6 38.0 90-94 34.66525 38.0 35.6 38.0 26.4 38.0 95-99 34.4688 38.0 35.0 38.0 25.0 38.0 100-104 34.057900000000004 38.0 34.4 38.0 21.4 38.0 105-109 33.98694999999999 38.0 34.6 38.0 21.4 38.0 110-114 33.574799999999996 38.0 34.0 38.0 16.2 38.0 115-119 33.15435 38.0 34.0 38.0 15.0 38.0 120-124 32.70685 38.0 32.4 38.0 15.0 38.0 125-129 32.1126 37.4 31.2 38.0 15.0 38.0 130-134 31.31415 36.6 30.6 38.0 13.0 38.0 135-139 30.39825 36.0 28.6 38.0 12.8 38.0 140-144 29.099100000000004 36.0 24.8 38.0 2.0 38.0 145-149 26.78915 33.2 14.6 38.0 2.0 38.0 150-151 21.491125 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 6.0 5 1.0 6 3.0 7 0.0 8 2.0 9 1.0 10 1.0 11 5.0 12 2.0 13 9.0 14 3.0 15 5.0 16 7.0 17 9.0 18 9.0 19 17.0 20 18.0 21 21.0 22 23.0 23 29.0 24 36.0 25 42.0 26 51.0 27 50.0 28 81.0 29 104.0 30 119.0 31 142.0 32 161.0 33 215.0 34 303.0 35 484.0 36 782.0 37 1234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.6 14.7 14.649999999999999 32.05 2 22.900000000000002 25.55 35.925000000000004 15.625 3 20.125 27.224999999999998 30.325000000000003 22.325 4 24.875 36.925000000000004 19.925 18.275 5 22.075 40.575 21.2 16.150000000000002 6 17.825 38.025 25.05 19.1 7 16.5 15.299999999999999 47.099999999999994 21.099999999999998 8 20.599999999999998 21.425 28.975 28.999999999999996 9 23.5 22.675 28.9 24.925 10-14 22.295 29.45 27.3 20.955 15-19 23.01 27.800000000000004 28.38 20.810000000000002 20-24 22.535 28.59 28.395 20.48 25-29 22.59 29.025000000000002 28.305000000000003 20.080000000000002 30-34 22.925 28.125 28.799999999999997 20.150000000000002 35-39 22.715 27.985 28.715000000000003 20.585 40-44 22.900000000000002 27.589999999999996 28.79 20.72 45-49 22.27 28.285 29.01 20.435 50-54 22.75 27.650000000000002 29.285 20.315 55-59 22.32 28.325 28.87 20.485 60-64 22.445 27.855 29.18 20.52 65-69 23.015 28.005000000000003 29.14 19.84 70-74 23.415 28.18 28.71 19.695 75-79 23.5 27.975 28.444999999999997 20.080000000000002 80-84 22.945 28.549999999999997 28.194999999999997 20.31 85-89 23.45 28.549999999999997 28.560000000000002 19.439999999999998 90-94 22.755 28.735 28.299999999999997 20.21 95-99 22.939999999999998 28.134999999999998 28.999999999999996 19.925 100-104 23.505000000000003 28.13 27.825 20.54 105-109 23.945 28.144999999999996 28.660000000000004 19.25 110-114 23.265 28.58 28.475 19.68 115-119 23.544999999999998 28.7 28.165000000000003 19.59 120-124 23.705000000000002 28.15 28.345 19.8 125-129 24.55 28.275 27.97 19.205 130-134 23.855 28.144999999999996 28.57 19.43 135-139 24.575 28.09 28.37 18.965 140-144 24.4 28.035 28.449999999999996 19.115 145-149 24.990000000000002 28.435 27.405 19.17 150-151 25.837500000000002 27.3375 28.075 18.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 3.5 22 4.0 23 2.0 24 4.5 25 6.5 26 9.5 27 11.5 28 11.0 29 12.5 30 16.5 31 31.0 32 41.0 33 44.0 34 61.0 35 77.0 36 90.0 37 111.5 38 140.5 39 175.5 40 225.0 41 266.5 42 273.0 43 280.5 44 283.0 45 275.0 46 262.5 47 243.0 48 212.5 49 179.5 50 152.0 51 123.0 52 94.0 53 70.0 54 55.5 55 43.0 56 30.5 57 19.5 58 14.0 59 11.0 60 8.5 61 4.5 62 3.0 63 3.5 64 4.0 65 2.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9500000000000002 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.65 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGG 10 0.006830828 145.0 9 ACACTGC 10 0.006830828 145.0 5 >>END_MODULE Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra Read 722734 spots for SRR7166193.sra Written 722734 spots for SRR7166193.sra Read 722721 spots for SRR7166193.sra Written 722721 spots for SRR7166193.sra SRR ids: ['SRR7166193.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tpa2bnx3 SRR7166193.sra spots: 14454433 blocks: [[1, 722721], [722722, 1445442], [1445443, 2168163], [2168164, 2890884], [2890885, 3613605], [3613606, 4336326], [4336327, 5059047], [5059048, 5781768], [5781769, 6504489], [6504490, 7227210], [7227211, 7949931], [7949932, 8672652], [8672653, 9395373], [9395374, 10118094], [10118095, 10840815], [10840816, 11563536], [11563537, 12286257], [12286258, 13008978], [13008979, 13731699], [13731700, 14454433]] SRR7166193 file size 4876432 SRR7166193 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166193 SRR7166193_1.fastq SRR7166193_2.fastq Input file: SRR7166193_1.fastq Paired file: SRR7166193_2.fastq trimmed: SRR7166193-trimmed-pair1.fastq, SRR7166193-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 00:14:05 2025 >> started Sat Feb 15 00:14:28 2025 >> done (22.582s) 14454433 read pairs processed; of these: 20247 ( 0.14%) short read pairs filtered out after trimming by size control 17521 ( 0.12%) empty read pairs filtered out after trimming by size control 14416665 (99.74%) read pairs available; of these: 10095224 (70.02%) trimmed read pairs available after processing 4321441 (29.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 9 0.00% 28 10 0.00% 29 10 0.00% 30 14 0.00% 31 6 0.00% 32 9 0.00% 33 15 0.00% 34 7 0.00% 35 11 0.00% 36 11 0.00% 37 15 0.00% 38 15 0.00% 39 15 0.00% 40 19 0.00% 41 20 0.00% 42 31 0.00% 43 24 0.00% 44 25 0.00% 45 27 0.00% 46 32 0.00% 47 45 0.00% 48 50 0.00% 49 48 0.00% 50 58 0.00% 51 55 0.00% 52 72 0.00% 53 83 0.00% 54 98 0.00% 55 107 0.00% 56 118 0.00% 57 116 0.00% 58 157 0.00% 59 174 0.00% 60 196 0.00% 61 196 0.00% 62 260 0.00% 63 287 0.00% 64 323 0.00% 65 344 0.00% 66 419 0.00% 67 443 0.00% 68 552 0.00% 69 620 0.00% 70 708 0.00% 71 800 0.01% 72 956 0.01% 73 1061 0.01% 74 1105 0.01% 75 1297 0.01% 76 1488 0.01% 77 1609 0.01% 78 1757 0.01% 79 2015 0.01% 80 2260 0.02% 81 2502 0.02% 82 2900 0.02% 83 3310 0.02% 84 4122 0.03% 85 4750 0.03% 86 5100 0.04% 87 5346 0.04% 88 5979 0.04% 89 5969 0.04% 90 6729 0.05% 91 7114 0.05% 92 7779 0.05% 93 8204 0.06% 94 9028 0.06% 95 9459 0.07% 96 10119 0.07% 97 10744 0.07% 98 11263 0.08% 99 12332 0.09% 100 12914 0.09% 101 13788 0.10% 102 14952 0.10% 103 15755 0.11% 104 16572 0.11% 105 17698 0.12% 106 18696 0.13% 107 19287 0.13% 108 20569 0.14% 109 21977 0.15% 110 23602 0.16% 111 24633 0.17% 112 26597 0.18% 113 28346 0.20% 114 30071 0.21% 115 31863 0.22% 116 33053 0.23% 117 35177 0.24% 118 37262 0.26% 119 39617 0.27% 120 42051 0.29% 121 44577 0.31% 122 47010 0.33% 123 50671 0.35% 124 54472 0.38% 125 57817 0.40% 126 61503 0.43% 127 65429 0.45% 128 69872 0.48% 129 74610 0.52% 130 80297 0.56% 131 86979 0.60% 132 93896 0.65% 133 101750 0.71% 134 111096 0.77% 135 122457 0.85% 136 129034 0.90% 137 136276 0.95% 138 147206 1.02% 139 162239 1.13% 140 182272 1.26% 141 185645 1.29% 142 204999 1.42% 143 230201 1.60% 144 264949 1.84% 145 316947 2.20% 146 392896 2.73% 147 513819 3.56% 148 717403 4.98% 149 1234661 8.56% 150 3476761 24.12% 151 4321441 29.98% 14416665 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=3.0 sequence=AAGGATCTCTCTCCTTTAACGACACCATCATTGTAAAGGAACAACTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=321.57 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=20.8 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=20 prefix-density=0.24 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=69.43 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=15.7 sequence=TTGTTGGTGATGG SRR7166193 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 00:15:51 Started mapping on | Feb 15 00:15:51 Finished on | Feb 15 00:17:42 Mapping speed, Million of reads per hour | 467.57 Number of input reads | 14416665 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13472687 Uniquely mapped reads % | 93.45% Average mapped length | 289.72 Number of splices: Total | 12503673 Number of splices: Annotated (sjdb) | 12241065 Number of splices: GT/AG | 12291664 Number of splices: GC/AG | 165186 Number of splices: AT/AC | 9951 Number of splices: Non-canonical | 36872 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.04% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341442 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 54828 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 621214 621214 621214 N_multimapping 341442 341442 341442 N_noFeature 571556 13298791 684688 N_ambiguous 132366 1069 70816 UnstrandedReadsAssigned:12768765 PositiveStrandReadsAssigned:172827 NegativeStrandReadsAssigned:12717183 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=139 echo kmer=135 SRR7166193 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166193-trimmed-pair1.fastq SRR7166193-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,416,665 reads, 12,702,660 reads pseudoaligned [quant] estimated average fragment length: 238.278 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7166193.ke.tsv 34699 SRR7166193.se.tsv 87100 total ==> SRR7166193.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.72 948 44.1351 Potri.005G024800.1.v4.1 1035 797.722 242 25.1499 Potri.004G059700.1.v4.1 961 723.732 1 0.11455 Potri.007G009000.2.v4.1 1416 1178.72 0 0 Potri.003G141000.2.v4.1 2943 2705.72 420.155 12.8736 Potri.016G087400.1.v4.1 270 79.8465 633 657.234 Potri.015G069301.1.v4.1 564 330.344 0 0 Potri.010G195200.1.v4.1 1773 1535.72 566 30.5546 Potri.012G127500.1.v4.1 977 739.722 17873 2003.09 ==> SRR7166193.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 311 SRR7166193 completed mapping pipeline successfully