Starting /dee2/code/volunteer_pipeline.sh SRR7166194 current disk space = 3106862792704 free memory = 1578888348 SRR7166194 SRAfilesize 711f371502ee86c954b16b655edfafcc SRR7166194.sra SRR7166194.sra file validated SRR7166194 is paired end SRR7166194 is conventional basespace SRR7166194 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166194_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.65925 33.0 30.0 33.0 18.0 34.0 2 31.8895 33.0 31.0 33.0 28.0 34.0 3 31.6185 33.0 31.0 33.0 29.0 34.0 4 30.73075 32.0 31.0 33.0 27.0 33.0 5 32.3255 33.0 33.0 33.0 32.0 33.0 6 36.35275 38.0 37.0 38.0 34.0 38.0 7 37.29075 38.0 38.0 38.0 36.0 38.0 8 37.4425 38.0 38.0 38.0 37.0 38.0 9 37.60225 38.0 38.0 38.0 38.0 38.0 10-14 37.588350000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.56895 38.0 38.0 38.0 38.0 38.0 20-24 37.60170000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.57675 38.0 38.0 38.0 38.0 38.0 30-34 37.56215 38.0 38.0 38.0 38.0 38.0 35-39 37.527300000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.4292 38.0 38.0 38.0 37.0 38.0 45-49 37.4544 38.0 38.0 38.0 37.0 38.0 50-54 37.44605 38.0 38.0 38.0 37.2 38.0 55-59 37.15435 38.0 38.0 38.0 36.8 38.0 60-64 37.271249999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.29615 38.0 38.0 38.0 37.0 38.0 70-74 37.26635 38.0 38.0 38.0 36.8 38.0 75-79 37.16335 38.0 38.0 38.0 36.4 38.0 80-84 37.1212 38.0 38.0 38.0 36.0 38.0 85-89 36.9904 38.0 38.0 38.0 36.0 38.0 90-94 36.789249999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.86045 38.0 38.0 38.0 35.0 38.0 100-104 36.723549999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.54905 38.0 38.0 38.0 34.0 38.0 110-114 36.5157 38.0 38.0 38.0 34.0 38.0 115-119 36.355549999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.1462 38.0 37.6 38.0 33.6 38.0 125-129 35.9284 38.0 37.0 38.0 33.0 38.0 130-134 35.767399999999995 38.0 36.6 38.0 32.8 38.0 135-139 35.532650000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.26205 38.0 36.0 38.0 30.6 38.0 145-149 34.798899999999996 38.0 35.8 38.0 28.6 38.0 150-151 31.526874999999997 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 4.0 19 0.0 20 3.0 21 2.0 22 5.0 23 3.0 24 7.0 25 7.0 26 13.0 27 18.0 28 22.0 29 21.0 30 38.0 31 38.0 32 56.0 33 96.0 34 115.0 35 259.0 36 595.0 37 2694.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.608228980322004 17.37797086634296 10.810120112445693 31.203680040889342 2 20.424999999999997 24.725 36.825 18.025 3 17.599999999999998 30.525000000000002 27.575 24.3 4 23.425 35.9 22.475 18.2 5 20.836463811670423 37.29025795141497 22.58953168044077 19.28374655647383 6 17.825 36.575 24.925 20.674999999999997 7 13.775 19.400000000000002 45.925 20.9 8 19.25 21.0 27.825 31.924999999999997 9 18.025 22.425 31.45 28.1 10-14 20.755000000000003 29.509999999999998 25.979999999999997 23.755000000000003 15-19 21.095 28.87 27.47 22.564999999999998 20-24 21.085 28.625 27.634999999999998 22.655 25-29 20.47 28.945 27.700000000000003 22.884999999999998 30-34 20.51 29.38 27.04 23.07 35-39 20.915 28.63 27.42 23.035 40-44 20.825 28.87 27.57 22.735 45-49 20.830000000000002 28.994999999999997 27.634999999999998 22.54 50-54 20.24 29.375 27.884999999999998 22.5 55-59 20.728516804185954 28.914268464479775 27.168444355001004 23.188770376333267 60-64 20.63547660745559 28.98173630222667 27.105328996747563 23.27745809357018 65-69 20.325 29.220000000000002 27.685 22.770000000000003 70-74 20.935000000000002 28.910000000000004 27.165 22.99 75-79 20.895 28.985 27.68 22.439999999999998 80-84 20.25 28.785 27.905 23.06 85-89 20.69 28.804999999999996 27.245 23.26 90-94 20.775 28.475 27.515 23.235 95-99 20.68 28.54 27.63 23.150000000000002 100-104 20.847720562478106 28.854526347395286 27.08802482109793 23.209728269028673 105-109 21.257634925403025 28.837488735355965 27.1452888755382 22.759587463702815 110-114 22.09 28.860000000000003 26.405 22.645 115-119 21.740000000000002 28.925 26.979999999999997 22.355 120-124 21.355 29.165000000000003 26.19 23.29 125-129 21.425 29.020000000000003 26.46 23.095 130-134 21.895 28.17 27.065 22.869999999999997 135-139 21.275 28.744999999999997 26.784999999999997 23.195 140-144 21.490000000000002 28.27 26.640000000000004 23.599999999999998 145-149 21.505 28.560000000000002 26.32 23.615 150-151 20.906359539308962 28.44266399599399 26.4271407110666 24.223835753630446 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 7.0 27 9.0 28 10.5 29 14.0 30 20.5 31 30.5 32 40.0 33 49.0 34 57.0 35 80.0 36 100.0 37 124.0 38 151.5 39 167.0 40 203.0 41 231.5 42 254.5 43 266.5 44 266.0 45 264.0 46 245.5 47 234.0 48 212.5 49 183.5 50 155.5 51 126.0 52 107.5 53 89.5 54 71.5 55 55.5 56 39.5 57 27.5 58 23.5 59 19.5 60 12.5 61 10.5 62 6.5 63 3.5 64 4.0 65 3.0 66 3.5 67 4.5 68 3.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.62 60-64 0.075 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.13 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.1625 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.7125 0.0 0.0 0.0 0.0 126-127 6.45 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.762499999999999 0.0 0.0 0.0 0.0 132-133 8.4125 0.0 0.0 0.0 0.0 134-135 9.0 0.0 0.0 0.0 0.0 136-137 9.7125 0.0 0.0 0.0 0.0 138-139 10.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATC 10 0.0068484643 144.875 2 AAAATCT 10 0.0068484643 144.875 3 CGACTTT 10 0.0068484643 144.875 8 >>END_MODULE SRR7166194 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166194_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9065 33.0 33.0 34.0 32.0 34.0 2 33.04625 33.0 33.0 34.0 32.0 34.0 3 33.07225 34.0 33.0 34.0 32.0 34.0 4 33.041 34.0 33.0 34.0 32.0 34.0 5 33.0245 34.0 33.0 34.0 32.0 34.0 6 37.22925 38.0 38.0 38.0 37.0 38.0 7 37.2445 38.0 38.0 38.0 37.0 38.0 8 37.2435 38.0 38.0 38.0 37.0 38.0 9 37.2315 38.0 38.0 38.0 37.0 38.0 10-14 37.231849999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.198800000000006 38.0 38.0 38.0 36.8 38.0 20-24 37.14155 38.0 38.0 38.0 37.0 38.0 25-29 37.101150000000004 38.0 38.0 38.0 36.4 38.0 30-34 37.0612 38.0 38.0 38.0 36.4 38.0 35-39 37.02255 38.0 38.0 38.0 36.0 38.0 40-44 36.98345 38.0 38.0 38.0 36.0 38.0 45-49 36.89905 38.0 38.0 38.0 35.8 38.0 50-54 36.65145 38.0 38.0 38.0 34.8 38.0 55-59 36.67755 38.0 38.0 38.0 35.0 38.0 60-64 36.60455 38.0 38.0 38.0 34.6 38.0 65-69 36.53825 38.0 38.0 38.0 34.4 38.0 70-74 36.4307 38.0 38.0 38.0 34.0 38.0 75-79 36.33605 38.0 38.0 38.0 34.0 38.0 80-84 36.18525 38.0 37.6 38.0 33.4 38.0 85-89 36.030950000000004 38.0 37.0 38.0 33.0 38.0 90-94 35.91355 38.0 37.0 38.0 32.0 38.0 95-99 35.657 38.0 36.8 38.0 30.2 38.0 100-104 35.560199999999995 38.0 37.0 38.0 29.8 38.0 105-109 35.29995 38.0 36.0 38.0 28.8 38.0 110-114 35.10145 38.0 36.0 38.0 28.2 38.0 115-119 34.784800000000004 38.0 35.2 38.0 26.8 38.0 120-124 34.47295 38.0 35.0 38.0 24.6 38.0 125-129 34.2158 38.0 35.0 38.0 23.6 38.0 130-134 33.526700000000005 38.0 34.0 38.0 19.0 38.0 135-139 33.1221 38.0 34.0 38.0 16.2 38.0 140-144 32.1716 37.0 32.8 38.0 14.2 38.0 145-149 30.72285 36.4 31.0 38.0 8.6 38.0 150-151 25.7695 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 2.0 5 1.0 6 1.0 7 1.0 8 3.0 9 0.0 10 2.0 11 0.0 12 2.0 13 3.0 14 1.0 15 2.0 16 3.0 17 5.0 18 5.0 19 5.0 20 8.0 21 9.0 22 17.0 23 15.0 24 18.0 25 21.0 26 24.0 27 34.0 28 42.0 29 43.0 30 67.0 31 81.0 32 108.0 33 155.0 34 231.0 35 387.0 36 922.0 37 1777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.9 15.75 13.625000000000002 28.725 2 23.25 22.375 36.1 18.275 3 19.25 26.450000000000003 32.550000000000004 21.75 4 23.375 35.75 21.075 19.8 5 22.325 37.75 22.0 17.925 6 18.0 37.0 25.324999999999996 19.675 7 15.9 14.825 47.25 22.025 8 20.424999999999997 21.075 28.249999999999996 30.25 9 22.05 24.125 28.975 24.85 10-14 22.384999999999998 28.59 27.08 21.945 15-19 22.685 27.415 28.515 21.385 20-24 22.32 27.595 28.854999999999997 21.23 25-29 22.564999999999998 27.845 28.410000000000004 21.18 30-34 22.61 27.935 28.16 21.295 35-39 22.134999999999998 27.744999999999997 28.21 21.91 40-44 22.82 27.425 28.48 21.275 45-49 22.45 27.235 29.03 21.285 50-54 22.675 27.27 28.455000000000002 21.6 55-59 22.865 28.03 27.975 21.13 60-64 22.705000000000002 28.115000000000002 28.225 20.955 65-69 22.835 27.37 28.744999999999997 21.05 70-74 22.95 27.555000000000003 28.549999999999997 20.945 75-79 23.085 27.355 28.685 20.875 80-84 22.595000000000002 27.525 28.560000000000002 21.32 85-89 23.44 27.465 28.51 20.585 90-94 22.795 27.48 28.854999999999997 20.87 95-99 23.385 28.27 27.985 20.36 100-104 23.05 27.485 28.410000000000004 21.055 105-109 23.51 27.750000000000004 28.265 20.474999999999998 110-114 23.36 28.24 28.15 20.25 115-119 23.155 28.294999999999998 27.794999999999998 20.755000000000003 120-124 23.544999999999998 28.28 27.775 20.4 125-129 23.68 27.82 27.810000000000002 20.69 130-134 24.42 27.339999999999996 27.889999999999997 20.349999999999998 135-139 24.044999999999998 27.21 27.810000000000002 20.935000000000002 140-144 24.845 27.76 27.060000000000002 20.335 145-149 25.290000000000003 27.560000000000002 27.11 20.04 150-151 25.600600600600597 27.652652652652655 27.314814814814813 19.43193193193193 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 3.0 24 1.5 25 2.0 26 4.0 27 6.0 28 11.0 29 16.5 30 20.5 31 23.5 32 25.5 33 34.0 34 49.0 35 68.5 36 90.0 37 105.5 38 137.0 39 165.5 40 195.0 41 231.0 42 254.5 43 273.0 44 286.0 45 266.5 46 252.5 47 250.0 48 234.5 49 205.0 50 165.0 51 135.0 52 111.5 53 89.5 54 65.5 55 54.0 56 42.5 57 30.5 58 23.5 59 18.5 60 12.5 61 10.0 62 9.0 63 7.5 64 3.5 65 1.0 66 1.0 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 3.9625000000000004 0.0 0.0 0.0 0.0 120-121 4.362500000000001 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.9 0.0 0.0 0.0 0.0 130-131 7.5 0.0 0.0 0.0 0.0 132-133 8.0875 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.3625 0.0 0.0 0.0 0.0 138-139 10.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683576 spots for SRR7166194.sra Written 683576 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra Read 683559 spots for SRR7166194.sra Written 683559 spots for SRR7166194.sra SRR ids: ['SRR7166194.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4d5cl6zw SRR7166194.sra spots: 13671197 blocks: [[1, 683559], [683560, 1367118], [1367119, 2050677], [2050678, 2734236], [2734237, 3417795], [3417796, 4101354], [4101355, 4784913], [4784914, 5468472], [5468473, 6152031], [6152032, 6835590], [6835591, 7519149], [7519150, 8202708], [8202709, 8886267], [8886268, 9569826], [9569827, 10253385], [10253386, 10936944], [10936945, 11620503], [11620504, 12304062], [12304063, 12987621], [12987622, 13671197]] SRR7166194 file size 4611019 SRR7166194 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166194 SRR7166194_1.fastq SRR7166194_2.fastq Input file: SRR7166194_1.fastq Paired file: SRR7166194_2.fastq trimmed: SRR7166194-trimmed-pair1.fastq, SRR7166194-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 23:25:19 2025 >> started Fri Feb 14 23:25:35 2025 >> done (16.046s) 13671197 read pairs processed; of these: 10312 ( 0.08%) short read pairs filtered out after trimming by size control 9239 ( 0.07%) empty read pairs filtered out after trimming by size control 13651646 (99.86%) read pairs available; of these: 6981530 (51.14%) trimmed read pairs available after processing 6670116 (48.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 8 0.00% 24 8 0.00% 25 9 0.00% 26 9 0.00% 27 2 0.00% 28 6 0.00% 29 11 0.00% 30 10 0.00% 31 8 0.00% 32 10 0.00% 33 9 0.00% 34 3 0.00% 35 9 0.00% 36 9 0.00% 37 7 0.00% 38 14 0.00% 39 10 0.00% 40 14 0.00% 41 15 0.00% 42 14 0.00% 43 33 0.00% 44 30 0.00% 45 12 0.00% 46 24 0.00% 47 39 0.00% 48 37 0.00% 49 35 0.00% 50 53 0.00% 51 54 0.00% 52 52 0.00% 53 74 0.00% 54 98 0.00% 55 80 0.00% 56 95 0.00% 57 112 0.00% 58 135 0.00% 59 188 0.00% 60 189 0.00% 61 216 0.00% 62 265 0.00% 63 257 0.00% 64 287 0.00% 65 369 0.00% 66 364 0.00% 67 415 0.00% 68 554 0.00% 69 594 0.00% 70 671 0.00% 71 821 0.01% 72 979 0.01% 73 1148 0.01% 74 1308 0.01% 75 1483 0.01% 76 1553 0.01% 77 1783 0.01% 78 1931 0.01% 79 2193 0.02% 80 2471 0.02% 81 2860 0.02% 82 3343 0.02% 83 3848 0.03% 84 4646 0.03% 85 5233 0.04% 86 5693 0.04% 87 6116 0.04% 88 6506 0.05% 89 7086 0.05% 90 7832 0.06% 91 8458 0.06% 92 9445 0.07% 93 10445 0.08% 94 11165 0.08% 95 11807 0.09% 96 12562 0.09% 97 13212 0.10% 98 13898 0.10% 99 15057 0.11% 100 15413 0.11% 101 16872 0.12% 102 17846 0.13% 103 19209 0.14% 104 20512 0.15% 105 22038 0.16% 106 22677 0.17% 107 23243 0.17% 108 24140 0.18% 109 24942 0.18% 110 26084 0.19% 111 27571 0.20% 112 29535 0.22% 113 30598 0.22% 114 32875 0.24% 115 34337 0.25% 116 35189 0.26% 117 36103 0.26% 118 37239 0.27% 119 37819 0.28% 120 38914 0.29% 121 40526 0.30% 122 42154 0.31% 123 44563 0.33% 124 46799 0.34% 125 48771 0.36% 126 50908 0.37% 127 52326 0.38% 128 53191 0.39% 129 54840 0.40% 130 55990 0.41% 131 58362 0.43% 132 61919 0.45% 133 64721 0.47% 134 68403 0.50% 135 71462 0.52% 136 75212 0.55% 137 78840 0.58% 138 82397 0.60% 139 86461 0.63% 140 90681 0.66% 141 98697 0.72% 142 106823 0.78% 143 118749 0.87% 144 135347 0.99% 145 157593 1.15% 146 188972 1.38% 147 247254 1.81% 148 357450 2.62% 149 660589 4.84% 150 2927954 21.45% 151 6670116 48.86% 13651646 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=27.11 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.7 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=34 prefix-density=0.45 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=37.67 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166194 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:26:41 Started mapping on | Feb 14 23:26:41 Finished on | Feb 14 23:28:44 Mapping speed, Million of reads per hour | 399.56 Number of input reads | 13651646 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12588179 Uniquely mapped reads % | 92.21% Average mapped length | 291.36 Number of splices: Total | 11899559 Number of splices: Annotated (sjdb) | 11662405 Number of splices: GT/AG | 11699426 Number of splices: GC/AG | 155011 Number of splices: AT/AC | 9325 Number of splices: Non-canonical | 35797 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330669 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 41892 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742092 742092 742092 N_multimapping 330669 330669 330669 N_noFeature 444725 12428744 545459 N_ambiguous 121522 1107 61995 UnstrandedReadsAssigned:12021932 PositiveStrandReadsAssigned:158328 NegativeStrandReadsAssigned:11980725 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166194 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166194-trimmed-pair1.fastq SRR7166194-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,651,646 reads, 11,934,186 reads pseudoaligned [quant] estimated average fragment length: 222.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7166194.ke.tsv 34699 SRR7166194.se.tsv 87100 total ==> SRR7166194.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.22 1212 58.0409 Potri.005G024800.1.v4.1 1035 813.217 262 27.7131 Potri.004G059700.1.v4.1 961 739.227 17 1.97816 Potri.007G009000.2.v4.1 1416 1194.22 0 0 Potri.003G141000.2.v4.1 2943 2721.22 441 13.9401 Potri.016G087400.1.v4.1 270 89.801 673 644.65 Potri.015G069301.1.v4.1 564 346.105 0 0 Potri.010G195200.1.v4.1 1773 1551.22 457 25.3416 Potri.012G127500.1.v4.1 977 755.222 14239 1621.79 ==> SRR7166194.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 630 SRR7166194 completed mapping pipeline successfully