Starting /dee2/code/volunteer_pipeline.sh SRR7166195 current disk space = 3106467127296 free memory = 1477892236 SRR7166195 SRAfilesize 8878fab739dd9f8505451ade9a955d3d SRR7166195.sra SRR7166195.sra file validated SRR7166195 is paired end SRR7166195 is conventional basespace SRR7166195 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166195_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.812 33.0 32.0 34.0 30.0 34.0 2 32.20725 33.0 33.0 34.0 29.0 34.0 3 32.23475 33.0 33.0 34.0 30.0 34.0 4 32.2225 33.0 33.0 34.0 31.0 34.0 5 32.4195 33.0 33.0 34.0 31.0 34.0 6 36.36275 38.0 37.0 38.0 33.0 38.0 7 36.76975 38.0 37.0 38.0 35.0 38.0 8 36.9315 38.0 38.0 38.0 35.0 38.0 9 36.93375 38.0 38.0 38.0 35.0 38.0 10-14 36.96515 38.0 38.0 38.0 35.2 38.0 15-19 36.902699999999996 38.0 38.0 38.0 35.0 38.0 20-24 36.9664 38.0 38.0 38.0 35.2 38.0 25-29 36.729949999999995 38.0 38.0 38.0 34.4 38.0 30-34 36.5332 38.0 38.0 38.0 34.0 38.0 35-39 36.4036 38.0 37.6 38.0 33.6 38.0 40-44 36.25025 38.0 37.2 38.0 33.2 38.0 45-49 36.214600000000004 38.0 37.0 38.0 33.0 38.0 50-54 36.070100000000004 38.0 37.0 38.0 32.6 38.0 55-59 35.802949999999996 38.0 36.8 38.0 30.6 38.0 60-64 35.842600000000004 38.0 36.8 38.0 30.6 38.0 65-69 35.571099999999994 38.0 36.0 38.0 29.4 38.0 70-74 35.637600000000006 38.0 36.2 38.0 29.8 38.0 75-79 34.80005 38.0 35.8 38.0 27.4 38.0 80-84 34.611000000000004 38.0 35.2 38.0 26.4 38.0 85-89 34.874700000000004 38.0 35.0 38.0 27.0 38.0 90-94 34.680949999999996 38.0 35.0 38.0 26.4 38.0 95-99 34.3988 38.0 34.0 38.0 25.0 38.0 100-104 34.126099999999994 38.0 34.0 38.0 22.4 38.0 105-109 33.54019999999999 37.2 33.6 38.0 17.8 38.0 110-114 33.28825 37.0 32.8 38.0 16.6 38.0 115-119 32.543499999999995 37.0 31.0 38.0 15.0 38.0 120-124 32.2973 37.0 30.6 38.0 15.0 38.0 125-129 31.559499999999996 36.8 30.4 38.0 14.6 38.0 130-134 29.76865 34.4 24.4 38.0 13.2 38.0 135-139 28.49475 33.0 21.8 38.0 12.2 38.0 140-144 27.7432 33.0 20.0 38.0 2.0 38.0 145-149 25.2714 33.0 8.8 38.0 2.0 38.0 150-151 19.397875 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 6.0 19 5.0 20 20.0 21 24.0 22 23.0 23 31.0 24 39.0 25 44.0 26 67.0 27 71.0 28 89.0 29 124.0 30 165.0 31 197.0 32 226.0 33 324.0 34 453.0 35 631.0 36 858.0 37 594.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.14699162223915 19.928915968519927 9.291698400609292 31.632394008631632 2 18.325 25.924999999999997 37.625 18.125 3 16.900000000000002 31.95 27.875 23.275000000000002 4 21.825 37.025000000000006 21.85 19.3 5 20.225 37.95 22.875 18.95 6 16.8 36.35 24.7 22.15 7 12.375 20.150000000000002 46.625 20.849999999999998 8 18.125 20.275000000000002 29.225 32.375 9 17.8 21.099999999999998 31.175000000000004 29.925 10-14 18.9 29.945 27.015 24.14 15-19 19.689999999999998 28.92 27.700000000000003 23.69 20-24 19.830000000000002 28.565 28.26 23.345 25-29 19.18 28.79 28.325 23.705000000000002 30-34 19.67 29.23 27.87 23.23 35-39 19.84 29.42 27.605 23.135 40-44 20.175 28.625 27.975 23.225 45-49 19.485 29.09 27.72 23.705000000000002 50-54 19.515 29.299999999999997 27.584999999999997 23.599999999999998 55-59 19.91 28.310000000000002 28.32 23.46 60-64 19.605 28.744999999999997 28.165000000000003 23.485 65-69 20.080000000000002 28.73 27.36 23.830000000000002 70-74 19.898979795959193 28.940788157631523 27.970594118823765 23.189637927585515 75-79 20.164692726071266 28.495908097392363 27.79443907894068 23.54496009759569 80-84 19.459431945434186 28.62669245647969 28.31110658658251 23.602769011503614 85-89 20.145 28.59 28.084999999999997 23.18 90-94 20.03 28.84 27.615000000000002 23.515 95-99 19.855 28.4 28.115000000000002 23.630000000000003 100-104 20.31 28.54 27.715 23.435 105-109 20.04 28.994999999999997 27.67 23.294999999999998 110-114 19.925 28.95 27.845 23.28 115-119 20.169999999999998 28.675 27.96 23.195 120-124 20.428171268507402 28.801520608243298 27.526010404161667 23.244297719087633 125-129 19.913982796559313 29.095819163832765 27.350470094018803 23.63972794558912 130-134 20.58645707376058 28.65276098347441 26.904474002418375 23.856307940346635 135-139 20.48638911128903 28.582866293034424 26.726381104883906 24.204363490792634 140-144 20.860430215107552 28.179089544772385 27.363681840920464 23.5967983991996 145-149 21.108827510150885 28.66309088174846 26.90360419068625 23.324477417414407 150-151 21.8311623246493 26.715931863727455 26.903807615230463 24.549098196392784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.5 21 2.0 22 1.0 23 2.0 24 3.0 25 5.5 26 8.5 27 10.5 28 12.5 29 13.5 30 22.0 31 30.5 32 43.5 33 57.5 34 60.5 35 81.5 36 100.5 37 114.0 38 146.5 39 173.5 40 194.5 41 221.0 42 257.0 43 282.5 44 294.0 45 292.0 46 276.5 47 246.0 48 211.5 49 193.0 50 170.5 51 120.5 52 84.5 53 70.0 54 53.5 55 42.0 56 28.5 57 19.0 58 11.0 59 11.5 60 8.0 61 3.5 62 5.5 63 4.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.02 75-79 1.635 80-84 1.77 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.02 130-134 0.76 135-139 0.08 140-144 0.05 145-149 0.255 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.4875 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166195 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166195_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.554 33.0 33.0 34.0 32.0 34.0 2 32.51275 33.0 33.0 34.0 31.0 34.0 3 32.6805 33.0 33.0 34.0 32.0 34.0 4 32.52025 33.0 33.0 34.0 32.0 34.0 5 32.595 33.0 33.0 34.0 32.0 34.0 6 36.7445 38.0 38.0 38.0 35.0 38.0 7 36.80075 38.0 38.0 38.0 36.0 38.0 8 36.81225 38.0 38.0 38.0 35.0 38.0 9 36.678 38.0 38.0 38.0 35.0 38.0 10-14 36.55625 38.0 38.0 38.0 34.6 38.0 15-19 36.45469999999999 38.0 38.0 38.0 34.0 38.0 20-24 36.2248 38.0 38.0 38.0 33.0 38.0 25-29 36.35265 38.0 38.0 38.0 34.0 38.0 30-34 36.31224999999999 38.0 38.0 38.0 33.8 38.0 35-39 36.209900000000005 38.0 38.0 38.0 33.6 38.0 40-44 36.08515 38.0 38.0 38.0 33.4 38.0 45-49 35.9131 38.0 37.2 38.0 32.6 38.0 50-54 35.87120000000001 38.0 37.6 38.0 32.2 38.0 55-59 35.8345 38.0 37.4 38.0 31.6 38.0 60-64 35.8865 38.0 37.2 38.0 32.0 38.0 65-69 35.693799999999996 38.0 37.0 38.0 30.2 38.0 70-74 35.50545 38.0 37.0 38.0 29.0 38.0 75-79 35.395849999999996 38.0 36.6 38.0 29.2 38.0 80-84 35.1441 38.0 36.4 38.0 29.0 38.0 85-89 35.0385 38.0 36.0 38.0 28.2 38.0 90-94 34.75615 38.0 36.0 38.0 26.6 38.0 95-99 34.6609 38.0 36.0 38.0 26.2 38.0 100-104 34.24715 38.0 35.0 38.0 22.2 38.0 105-109 34.11 38.0 34.6 38.0 22.6 38.0 110-114 33.9226 38.0 34.0 38.0 22.6 38.0 115-119 33.4337 38.0 34.0 38.0 15.0 38.0 120-124 33.0646 38.0 33.0 38.0 15.0 38.0 125-129 32.487649999999995 37.8 31.6 38.0 15.0 38.0 130-134 31.6522 37.0 31.0 38.0 13.8 38.0 135-139 30.5822 36.0 29.0 38.0 12.8 38.0 140-144 29.437649999999998 36.0 26.6 38.0 3.8 38.0 145-149 27.164299999999997 34.0 16.6 38.0 2.0 38.0 150-151 21.564124999999997 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 4.0 5 5.0 6 0.0 7 3.0 8 0.0 9 4.0 10 1.0 11 7.0 12 3.0 13 3.0 14 4.0 15 4.0 16 8.0 17 5.0 18 8.0 19 17.0 20 16.0 21 21.0 22 22.0 23 27.0 24 26.0 25 47.0 26 51.0 27 50.0 28 80.0 29 104.0 30 94.0 31 107.0 32 178.0 33 218.0 34 287.0 35 432.0 36 814.0 37 1328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.775 15.85 13.05 27.325 2 21.875 24.45 36.225 17.45 3 20.0 26.224999999999998 32.725 21.05 4 23.517638228671505 35.851888916687514 22.016512384288216 18.613960470352765 5 22.86715036277208 38.47885914435827 21.1408556417313 17.513134851138354 6 17.2 37.95 24.85 20.0 7 16.75 15.275 46.75 21.224999999999998 8 20.9 21.75 27.925 29.425 9 22.85 23.400000000000002 28.125 25.624999999999996 10-14 22.935 28.555000000000003 27.675 20.835 15-19 22.945 27.85 28.694999999999997 20.51 20-24 22.84 28.560000000000002 28.27 20.330000000000002 25-29 22.84 27.975 29.015 20.169999999999998 30-34 22.925 28.005000000000003 28.144999999999996 20.925 35-39 22.661133056652833 28.88644432221611 28.186409320466023 20.266013300665033 40-44 22.64 28.975 28.095 20.29 45-49 23.169999999999998 28.275 28.675 19.88 50-54 22.915 28.044999999999998 28.28 20.76 55-59 23.535 28.49 28.595 19.38 60-64 23.11 27.93 28.849999999999998 20.11 65-69 22.825 27.905 28.599999999999998 20.669999999999998 70-74 23.23 27.98 28.405 20.385 75-79 23.195 27.54 29.12 20.145 80-84 23.200000000000003 28.33 28.235 20.235 85-89 23.26 28.110000000000003 28.315 20.315 90-94 23.119999999999997 27.77 29.020000000000003 20.09 95-99 23.080000000000002 28.389999999999997 28.1 20.43 100-104 23.78356753513027 28.00920138020703 28.55428314247137 19.65294794219133 105-109 23.387540655491616 28.506379784838632 28.61646234676007 19.489617212909682 110-114 23.026151307565378 28.461423071153558 28.55642782139107 19.955997799889992 115-119 24.425 27.439999999999998 28.43 19.705000000000002 120-124 23.62 27.894999999999996 28.67 19.814999999999998 125-129 24.11 28.235 27.810000000000002 19.845 130-134 24.175 27.445000000000004 28.470000000000002 19.91 135-139 24.759999999999998 27.755000000000003 28.075 19.41 140-144 25.1 27.810000000000002 27.634999999999998 19.455 145-149 25.685000000000002 28.29 26.895000000000003 19.13 150-151 26.6125 27.55 27.800000000000004 18.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 4.0 24 4.0 25 4.0 26 3.5 27 2.5 28 8.5 29 14.0 30 16.5 31 20.5 32 29.5 33 42.5 34 54.5 35 74.0 36 92.5 37 119.5 38 153.0 39 186.0 40 220.5 41 236.5 42 256.5 43 282.5 44 286.0 45 282.5 46 264.5 47 239.5 48 230.0 49 202.5 50 160.5 51 129.0 52 99.0 53 70.5 54 56.5 55 45.0 56 32.0 57 24.0 58 14.0 59 6.5 60 5.0 61 4.0 62 4.0 63 4.0 64 1.0 65 0.5 66 1.5 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.075 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.1504136375031336 0.3 3 0.0250689395838556 0.075 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.675000000000001 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.575 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842131 spots for SRR7166195.sra Written 842131 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra Read 842123 spots for SRR7166195.sra Written 842123 spots for SRR7166195.sra SRR ids: ['SRR7166195.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xntw6kxt SRR7166195.sra spots: 16842468 blocks: [[1, 842123], [842124, 1684246], [1684247, 2526369], [2526370, 3368492], [3368493, 4210615], [4210616, 5052738], [5052739, 5894861], [5894862, 6736984], [6736985, 7579107], [7579108, 8421230], [8421231, 9263353], [9263354, 10105476], [10105477, 10947599], [10947600, 11789722], [11789723, 12631845], [12631846, 13473968], [13473969, 14316091], [14316092, 15158214], [15158215, 16000337], [16000338, 16842468]] SRR7166195 file size 5685659 SRR7166195 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166195 SRR7166195_1.fastq SRR7166195_2.fastq Input file: SRR7166195_1.fastq Paired file: SRR7166195_2.fastq trimmed: SRR7166195-trimmed-pair1.fastq, SRR7166195-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 23:45:42 2025 >> started Fri Feb 14 23:46:04 2025 >> done (21.785s) 16842468 read pairs processed; of these: 26491 ( 0.16%) short read pairs filtered out after trimming by size control 21995 ( 0.13%) empty read pairs filtered out after trimming by size control 16793982 (99.71%) read pairs available; of these: 11717927 (69.77%) trimmed read pairs available after processing 5076055 (30.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 9 0.00% 21 5 0.00% 22 14 0.00% 23 11 0.00% 24 9 0.00% 25 8 0.00% 26 5 0.00% 27 11 0.00% 28 8 0.00% 29 16 0.00% 30 3 0.00% 31 12 0.00% 32 9 0.00% 33 10 0.00% 34 10 0.00% 35 11 0.00% 36 21 0.00% 37 8 0.00% 38 23 0.00% 39 16 0.00% 40 20 0.00% 41 28 0.00% 42 23 0.00% 43 27 0.00% 44 29 0.00% 45 23 0.00% 46 39 0.00% 47 48 0.00% 48 43 0.00% 49 55 0.00% 50 62 0.00% 51 58 0.00% 52 74 0.00% 53 90 0.00% 54 103 0.00% 55 112 0.00% 56 138 0.00% 57 149 0.00% 58 194 0.00% 59 230 0.00% 60 231 0.00% 61 281 0.00% 62 276 0.00% 63 332 0.00% 64 383 0.00% 65 367 0.00% 66 513 0.00% 67 511 0.00% 68 657 0.00% 69 708 0.00% 70 841 0.01% 71 945 0.01% 72 1137 0.01% 73 1333 0.01% 74 1431 0.01% 75 1646 0.01% 76 1849 0.01% 77 2043 0.01% 78 2120 0.01% 79 2479 0.01% 80 2804 0.02% 81 3221 0.02% 82 3772 0.02% 83 4523 0.03% 84 5587 0.03% 85 6432 0.04% 86 6775 0.04% 87 7263 0.04% 88 7496 0.04% 89 8018 0.05% 90 8930 0.05% 91 9533 0.06% 92 10132 0.06% 93 11339 0.07% 94 12019 0.07% 95 12624 0.08% 96 13617 0.08% 97 14192 0.08% 98 15117 0.09% 99 16114 0.10% 100 17026 0.10% 101 18642 0.11% 102 19716 0.12% 103 21271 0.13% 104 22787 0.14% 105 24401 0.15% 106 25379 0.15% 107 26039 0.16% 108 27849 0.17% 109 28468 0.17% 110 30380 0.18% 111 32398 0.19% 112 34895 0.21% 113 37417 0.22% 114 39617 0.24% 115 42070 0.25% 116 43822 0.26% 117 45711 0.27% 118 47938 0.29% 119 50042 0.30% 120 53040 0.32% 121 55633 0.33% 122 59033 0.35% 123 63744 0.38% 124 67571 0.40% 125 71846 0.43% 126 76702 0.46% 127 79954 0.48% 128 83985 0.50% 129 89706 0.53% 130 95606 0.57% 131 102751 0.61% 132 110749 0.66% 133 119357 0.71% 134 130663 0.78% 135 144022 0.86% 136 150367 0.90% 137 157390 0.94% 138 170351 1.01% 139 185741 1.11% 140 207669 1.24% 141 210327 1.25% 142 231828 1.38% 143 258686 1.54% 144 298087 1.77% 145 354889 2.11% 146 439938 2.62% 147 575120 3.42% 148 803829 4.79% 149 1394589 8.30% 150 4037517 24.04% 151 5076055 30.23% 16793982 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=89.09 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.5 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=28.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166195 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:47:06 Started mapping on | Feb 14 23:47:10 Finished on | Feb 14 23:49:27 Mapping speed, Million of reads per hour | 441.30 Number of input reads | 16793982 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15859266 Uniquely mapped reads % | 94.43% Average mapped length | 289.08 Number of splices: Total | 15090560 Number of splices: Annotated (sjdb) | 14806011 Number of splices: GT/AG | 14847814 Number of splices: GC/AG | 192491 Number of splices: AT/AC | 11260 Number of splices: Non-canonical | 38995 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430044 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 27151 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530115 530115 530115 N_multimapping 430044 430044 430044 N_noFeature 513901 15663561 637498 N_ambiguous 149256 1055 76424 UnstrandedReadsAssigned:15196109 PositiveStrandReadsAssigned:194650 NegativeStrandReadsAssigned:15145344 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR7166195 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166195-trimmed-pair1.fastq SRR7166195-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,793,982 reads, 15,063,156 reads pseudoaligned [quant] estimated average fragment length: 229.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR7166195.ke.tsv 34699 SRR7166195.se.tsv 87100 total ==> SRR7166195.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.37 1170 45.7251 Potri.005G024800.1.v4.1 1035 806.371 277 24.0223 Potri.004G059700.1.v4.1 961 732.382 51 4.86969 Potri.007G009000.2.v4.1 1416 1187.37 0 0 Potri.003G141000.2.v4.1 2943 2714.37 650.614 16.7619 Potri.016G087400.1.v4.1 270 84.2766 683.108 566.829 Potri.015G069301.1.v4.1 564 338.771 0 0 Potri.010G195200.1.v4.1 1773 1544.37 305.854 13.8494 Potri.012G127500.1.v4.1 977 748.382 3183 297.428 ==> SRR7166195.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 616 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 301 SRR7166195 completed mapping pipeline successfully