Starting /dee2/code/volunteer_pipeline.sh SRR7166196 current disk space = 3106952400896 free memory = 1449469296 SRR7166196 SRAfilesize f6b63c357489b994616ac1215f53d757 SRR7166196.sra SRR7166196.sra file validated SRR7166196 is paired end SRR7166196 is conventional basespace SRR7166196 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166196_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.8935 32.0 28.0 33.0 18.0 34.0 2 32.24325 33.0 31.0 33.0 29.0 34.0 3 32.4285 33.0 33.0 33.0 31.0 34.0 4 32.91825 33.0 33.0 34.0 32.0 34.0 5 33.02925 33.0 33.0 34.0 32.0 34.0 6 36.75925 38.0 37.0 38.0 34.0 38.0 7 37.274 38.0 38.0 38.0 36.0 38.0 8 37.33425 38.0 38.0 38.0 37.0 38.0 9 37.43475 38.0 38.0 38.0 37.0 38.0 10-14 37.491150000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.552749999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.50855 38.0 38.0 38.0 37.0 38.0 25-29 37.4699 38.0 38.0 38.0 37.0 38.0 30-34 37.4578 38.0 38.0 38.0 37.0 38.0 35-39 37.42399999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.369949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.368 38.0 38.0 38.0 37.0 38.0 50-54 37.15285 38.0 38.0 38.0 36.6 38.0 55-59 36.89025 38.0 38.0 38.0 36.0 38.0 60-64 37.0406 38.0 38.0 38.0 36.0 38.0 65-69 37.15205 38.0 38.0 38.0 36.2 38.0 70-74 37.06925 38.0 38.0 38.0 36.0 38.0 75-79 36.953050000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.76155 38.0 38.0 38.0 35.0 38.0 85-89 36.5771 38.0 38.0 38.0 34.4 38.0 90-94 36.6004 38.0 38.0 38.0 34.6 38.0 95-99 36.41435 38.0 38.0 38.0 34.0 38.0 100-104 36.33275 38.0 38.0 38.0 34.0 38.0 105-109 36.067400000000006 38.0 37.4 38.0 33.4 38.0 110-114 36.1527 38.0 37.4 38.0 33.2 38.0 115-119 35.7798 38.0 37.0 38.0 31.6 38.0 120-124 35.4933 38.0 36.6 38.0 30.4 38.0 125-129 35.5011 38.0 36.2 38.0 30.4 38.0 130-134 35.2115 38.0 36.0 38.0 28.6 38.0 135-139 34.86125 38.0 35.6 38.0 27.8 38.0 140-144 34.503 38.0 35.0 38.0 26.2 38.0 145-149 34.0713 38.0 35.0 38.0 24.2 38.0 150-151 30.797875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 2.0 20 7.0 21 3.0 22 8.0 23 11.0 24 8.0 25 9.0 26 18.0 27 22.0 28 31.0 29 38.0 30 34.0 31 57.0 32 75.0 33 97.0 34 161.0 35 297.0 36 689.0 37 2424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.28681177976953 18.104993597951342 12.496798975672215 33.11139564660691 2 19.3 25.6 37.025000000000006 18.075 3 18.075 30.95 28.225 22.75 4 21.3 36.75 22.1 19.85 5 20.330082520630157 37.83445861465366 22.50562640660165 19.32983245811453 6 15.875 36.4 26.1 21.625 7 13.200000000000001 18.95 47.325 20.525 8 18.05 20.175 29.575000000000003 32.2 9 18.05 22.325 31.525 28.1 10-14 19.32 29.67 26.979999999999997 24.03 15-19 19.814999999999998 28.53 28.410000000000004 23.244999999999997 20-24 19.575 28.78 27.744999999999997 23.9 25-29 19.8 29.065 28.249999999999996 22.884999999999998 30-34 19.42 28.765 28.060000000000002 23.755000000000003 35-39 19.085 29.439999999999998 27.88 23.595 40-44 20.03 28.994999999999997 27.689999999999998 23.285 45-49 19.91 29.025000000000002 27.560000000000002 23.505000000000003 50-54 19.514028056112224 28.797595190380758 28.036072144288575 23.652304609218437 55-59 19.680072664883685 28.89438361003179 28.192965635565425 23.232578089519098 60-64 19.643393769407993 28.909145547430633 28.02764699989983 23.419813683261545 65-69 20.25 28.575 27.825 23.35 70-74 20.59 28.455000000000002 28.035 22.919999999999998 75-79 19.77 28.76 27.935 23.535 80-84 20.145 28.565 27.445000000000004 23.845 85-89 19.919999999999998 28.384999999999998 27.800000000000004 23.895 90-94 20.365 28.915000000000003 27.150000000000002 23.57 95-99 20.27 28.67 27.525 23.535 100-104 19.900000000000002 29.770000000000003 27.279999999999998 23.05 105-109 19.580244439991986 29.1023842917251 27.609697455419756 23.707673812863153 110-114 20.29 28.68 27.785 23.244999999999997 115-119 20.31 29.020000000000003 27.415 23.255 120-124 20.26 28.525 27.305 23.91 125-129 21.05105255262763 28.376418820941048 27.096354817740888 23.476173808690433 130-134 21.115000000000002 28.825 26.775 23.285 135-139 21.076053802690133 28.8064403220161 26.856342817140856 23.26116305815291 140-144 21.025 29.275000000000002 26.640000000000004 23.06 145-149 21.224999999999998 28.84 26.174999999999997 23.76 150-151 20.857821683131174 29.448543203701387 25.884706765036892 23.808928348130546 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.5 22 1.5 23 2.5 24 6.5 25 8.0 26 11.0 27 11.5 28 11.0 29 14.5 30 18.0 31 31.0 32 41.5 33 52.0 34 62.0 35 68.5 36 101.0 37 127.0 38 146.5 39 177.5 40 219.0 41 251.0 42 252.0 43 262.5 44 276.5 45 270.5 46 253.5 47 240.0 48 217.0 49 169.5 50 134.5 51 119.5 52 103.0 53 81.0 54 58.0 55 45.5 56 38.0 57 27.0 58 19.5 59 17.5 60 10.5 61 7.0 62 6.5 63 5.0 64 5.0 65 3.0 66 2.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.2 55-59 0.915 60-64 0.16999999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.18 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.5999999999999996 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGTCT 35 0.0033397216 62.014286 145 >>END_MODULE SRR7166196 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166196_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98475 33.0 33.0 34.0 32.0 34.0 2 33.0195 33.0 33.0 34.0 32.0 34.0 3 33.10725 34.0 33.0 34.0 32.0 34.0 4 33.069 34.0 33.0 34.0 33.0 34.0 5 33.02775 34.0 33.0 34.0 32.0 34.0 6 37.2165 38.0 38.0 38.0 37.0 38.0 7 37.13 38.0 38.0 38.0 37.0 38.0 8 37.22 38.0 38.0 38.0 37.0 38.0 9 37.12225 38.0 38.0 38.0 37.0 38.0 10-14 37.23465 38.0 38.0 38.0 37.0 38.0 15-19 37.193349999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.06725 38.0 38.0 38.0 36.2 38.0 25-29 37.095400000000005 38.0 38.0 38.0 36.6 38.0 30-34 36.98350000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.9409 38.0 38.0 38.0 36.0 38.0 40-44 36.88934999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.7765 38.0 38.0 38.0 35.6 38.0 50-54 36.597699999999996 38.0 38.0 38.0 34.6 38.0 55-59 36.4568 38.0 38.0 38.0 34.2 38.0 60-64 36.5082 38.0 38.0 38.0 34.4 38.0 65-69 36.462450000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.4082 38.0 38.0 38.0 34.0 38.0 75-79 36.25985 38.0 38.0 38.0 34.0 38.0 80-84 36.15485 38.0 37.8 38.0 33.4 38.0 85-89 36.07635 38.0 37.8 38.0 33.2 38.0 90-94 35.80915 38.0 37.0 38.0 31.8 38.0 95-99 35.66545000000001 38.0 37.0 38.0 31.2 38.0 100-104 35.396950000000004 38.0 36.8 38.0 29.4 38.0 105-109 35.233999999999995 38.0 36.4 38.0 28.6 38.0 110-114 34.82465 38.0 35.8 38.0 26.6 38.0 115-119 34.69015 38.0 35.4 38.0 26.6 38.0 120-124 34.3069 38.0 35.0 38.0 23.8 38.0 125-129 34.20705 38.0 35.0 38.0 23.2 38.0 130-134 33.582499999999996 38.0 34.2 38.0 19.4 38.0 135-139 33.0378 38.0 34.0 38.0 14.8 38.0 140-144 32.65995 38.0 33.8 38.0 14.0 38.0 145-149 31.08345 37.0 31.4 38.0 8.6 38.0 150-151 26.674999999999997 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 3.0 5 1.0 6 0.0 7 4.0 8 2.0 9 3.0 10 3.0 11 0.0 12 1.0 13 6.0 14 5.0 15 1.0 16 2.0 17 5.0 18 4.0 19 9.0 20 16.0 21 11.0 22 14.0 23 17.0 24 17.0 25 30.0 26 25.0 27 37.0 28 36.0 29 53.0 30 51.0 31 70.0 32 95.0 33 159.0 34 198.0 35 355.0 36 788.0 37 1974.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 14.45 16.85 30.7 2 23.625 22.425 35.925000000000004 18.025 3 20.4 25.374999999999996 33.25 20.974999999999998 4 24.425 35.925000000000004 20.875 18.775 5 23.75 36.15 22.75 17.349999999999998 6 17.012759569677257 38.50387790843132 24.7935951963973 19.68976732549412 7 18.01351013259945 14.98623967975982 46.45984488366275 20.540405303977984 8 20.240180135101326 21.46609957468101 27.77082812109082 30.522892169126848 9 22.316737553164874 23.39254440830623 28.946710032524393 25.344008006004504 10-14 22.42008904006803 28.61287579410735 27.572407583412534 21.394627582412085 15-19 23.01920768307323 28.00120048019208 27.761104441776713 21.218487394957982 20-24 22.793933630311827 27.68406827168527 29.03048200610641 20.491516091896493 25-29 22.90874524714829 28.387032219331598 28.10186111667 20.60236141685011 30-34 22.406888265919104 28.52923508209852 28.594313175810974 20.469563476171405 35-39 22.59598538319067 27.87705861741002 28.492766681683936 21.034189317715374 40-44 22.815096606266895 28.601461607768545 27.790569626589246 20.792872159375314 45-49 23.264080100125156 28.36545682102628 28.010012515644554 20.360450563204004 50-54 22.8943415122684 27.621432148222336 28.898347521281924 20.58587881822734 55-59 23.507911075505707 28.244542359303026 28.084318045263366 20.1632285199279 60-64 23.43515272909364 27.971957936905355 28.072108162243364 20.520781171757637 65-69 23.383906664663762 27.890441139652495 28.326072805568074 20.39957939011567 70-74 23.17592268015424 27.953327657869696 28.799639441133756 20.071110220842307 75-79 23.148565419858798 27.735216063291773 28.416203495067847 20.700015021781585 80-84 23.383059671605928 27.983580296355626 28.063676411694033 20.569683620344414 85-89 23.123529117219967 28.4662761003455 28.53137048720645 19.878824295228082 90-94 23.460190285428144 28.037055583375064 28.477716574862296 20.025037556334503 95-99 24.009615866179196 28.016226774177394 27.961135874192415 20.013021485450995 100-104 23.177448427798918 28.374724614460245 28.660124173843382 19.78770278389746 105-109 23.947118032951074 27.758024938654913 28.01842856427463 20.276428464119384 110-114 23.911845730027547 28.454795892812424 27.853744052091162 19.77961432506887 115-119 24.1121963436013 27.44803405960431 28.64512897570749 19.794640621086902 120-124 23.669972948602343 28.113415489429915 28.038272718164514 20.178338843803225 125-129 24.232406711745554 28.87052341597796 27.362885048835462 19.534184823441024 130-134 24.43409455128205 28.054887820512818 27.82952724358974 19.681490384615387 135-139 24.819747646705387 28.26957740837172 27.50350490686962 19.407170038053277 140-144 25.122659457294482 28.48703314308601 27.010113147091218 19.380194252528288 145-149 24.95117920985429 28.71663912673376 26.74377847879425 19.588403184617693 150-151 25.769326995246434 28.29622216662497 27.032774580935705 18.901676257192896 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 3.0 23 2.5 24 5.5 25 7.0 26 4.5 27 6.5 28 9.5 29 10.5 30 21.0 31 30.0 32 30.5 33 38.0 34 56.0 35 66.0 36 88.0 37 110.5 38 146.5 39 184.5 40 191.0 41 224.0 42 256.0 43 277.0 44 286.0 45 271.5 46 256.0 47 247.0 48 230.0 49 198.0 50 165.0 51 128.0 52 102.5 53 87.0 54 61.0 55 46.0 56 36.5 57 23.0 58 19.5 59 17.0 60 9.0 61 6.0 62 8.5 63 5.0 64 2.5 65 4.5 66 3.0 67 0.5 68 1.0 69 2.5 70 1.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.045 15-19 0.04 20-24 0.105 25-29 0.06 30-34 0.12 35-39 0.11499999999999999 40-44 0.11 45-49 0.125 50-54 0.15 55-59 0.13999999999999999 60-64 0.15 65-69 0.145 70-74 0.155 75-79 0.145 80-84 0.12 85-89 0.145 90-94 0.15 95-99 0.165 100-104 0.13999999999999999 105-109 0.155 110-114 0.17500000000000002 115-119 0.17500000000000002 120-124 0.19 125-129 0.17500000000000002 130-134 0.16 135-139 0.13999999999999999 140-144 0.13 145-149 0.145 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 4.0125 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.449999999999999 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACT 10 0.006830828 145.0 2 >>END_MODULE Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889902 spots for SRR7166196.sra Written 889902 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra Read 889883 spots for SRR7166196.sra Written 889883 spots for SRR7166196.sra SRR ids: ['SRR7166196.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pq4u1j7u SRR7166196.sra spots: 17797679 blocks: [[1, 889883], [889884, 1779766], [1779767, 2669649], [2669650, 3559532], [3559533, 4449415], [4449416, 5339298], [5339299, 6229181], [6229182, 7119064], [7119065, 8008947], [8008948, 8898830], [8898831, 9788713], [9788714, 10678596], [10678597, 11568479], [11568480, 12458362], [12458363, 13348245], [13348246, 14238128], [14238129, 15128011], [15128012, 16017894], [16017895, 16907777], [16907778, 17797679]] SRR7166196 file size 6009349 SRR7166196 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166196 SRR7166196_1.fastq SRR7166196_2.fastq Input file: SRR7166196_1.fastq Paired file: SRR7166196_2.fastq trimmed: SRR7166196-trimmed-pair1.fastq, SRR7166196-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 23:23:55 2025 >> started Fri Feb 14 23:24:25 2025 >> done (29.370s) 17797679 read pairs processed; of these: 14111 ( 0.08%) short read pairs filtered out after trimming by size control 8661 ( 0.05%) empty read pairs filtered out after trimming by size control 17774907 (99.87%) read pairs available; of these: 8150569 (45.85%) trimmed read pairs available after processing 9624338 (54.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 6 0.00% 22 4 0.00% 23 8 0.00% 24 10 0.00% 25 7 0.00% 26 7 0.00% 27 4 0.00% 28 3 0.00% 29 3 0.00% 30 8 0.00% 31 12 0.00% 32 7 0.00% 33 8 0.00% 34 9 0.00% 35 10 0.00% 36 12 0.00% 37 9 0.00% 38 11 0.00% 39 8 0.00% 40 14 0.00% 41 11 0.00% 42 20 0.00% 43 21 0.00% 44 19 0.00% 45 15 0.00% 46 24 0.00% 47 28 0.00% 48 34 0.00% 49 32 0.00% 50 34 0.00% 51 51 0.00% 52 67 0.00% 53 66 0.00% 54 65 0.00% 55 78 0.00% 56 92 0.00% 57 96 0.00% 58 138 0.00% 59 149 0.00% 60 156 0.00% 61 179 0.00% 62 169 0.00% 63 226 0.00% 64 240 0.00% 65 270 0.00% 66 318 0.00% 67 366 0.00% 68 434 0.00% 69 532 0.00% 70 558 0.00% 71 667 0.00% 72 732 0.00% 73 866 0.00% 74 995 0.01% 75 1055 0.01% 76 1189 0.01% 77 1333 0.01% 78 1482 0.01% 79 1790 0.01% 80 2032 0.01% 81 2308 0.01% 82 2753 0.02% 83 3330 0.02% 84 4813 0.03% 85 4593 0.03% 86 4585 0.03% 87 5138 0.03% 88 5576 0.03% 89 6048 0.03% 90 6616 0.04% 91 6979 0.04% 92 7712 0.04% 93 8676 0.05% 94 9470 0.05% 95 9808 0.06% 96 10496 0.06% 97 11553 0.06% 98 12282 0.07% 99 14334 0.08% 100 13884 0.08% 101 14560 0.08% 102 15686 0.09% 103 16965 0.10% 104 17932 0.10% 105 19451 0.11% 106 19880 0.11% 107 20834 0.12% 108 21822 0.12% 109 22910 0.13% 110 24155 0.14% 111 25505 0.14% 112 27213 0.15% 113 28633 0.16% 114 30487 0.17% 115 32115 0.18% 116 33350 0.19% 117 34514 0.19% 118 36118 0.20% 119 37314 0.21% 120 38472 0.22% 121 40448 0.23% 122 41568 0.23% 123 44382 0.25% 124 45685 0.26% 125 48183 0.27% 126 49969 0.28% 127 52721 0.30% 128 53369 0.30% 129 55790 0.31% 130 58217 0.33% 131 60369 0.34% 132 63214 0.36% 133 66964 0.38% 134 70082 0.39% 135 73321 0.41% 136 77496 0.44% 137 81496 0.46% 138 85967 0.48% 139 91073 0.51% 140 97371 0.55% 141 106214 0.60% 142 116432 0.66% 143 129022 0.73% 144 149281 0.84% 145 175752 0.99% 146 215412 1.21% 147 288796 1.62% 148 426999 2.40% 149 809780 4.56% 150 3789523 21.32% 151 9624338 54.15% 17774907 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=36 prefix-density=0.75 prefix-fanout=1.6 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=208.31 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.4 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=3.3 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=34.43 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166196 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:25:39 Started mapping on | Feb 14 23:25:40 Finished on | Feb 14 23:27:51 Mapping speed, Million of reads per hour | 488.47 Number of input reads | 17774907 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16803653 Uniquely mapped reads % | 94.54% Average mapped length | 293.77 Number of splices: Total | 15351591 Number of splices: Annotated (sjdb) | 14978738 Number of splices: GT/AG | 15081010 Number of splices: GC/AG | 204235 Number of splices: AT/AC | 14949 Number of splices: Non-canonical | 51397 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423477 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 69588 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 560132 560132 560132 N_multimapping 423477 423477 423477 N_noFeature 781393 16606095 903945 N_ambiguous 163155 1222 87415 UnstrandedReadsAssigned:15859105 PositiveStrandReadsAssigned:196336 NegativeStrandReadsAssigned:15812293 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166196 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166196-trimmed-pair1.fastq SRR7166196-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,774,907 reads, 15,671,309 reads pseudoaligned [quant] estimated average fragment length: 240.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR7166196.ke.tsv 34699 SRR7166196.se.tsv 87100 total ==> SRR7166196.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.22 2163 76.4452 Potri.005G024800.1.v4.1 1035 795.223 484 38.2504 Potri.004G059700.1.v4.1 961 721.274 6 0.522794 Potri.007G009000.2.v4.1 1416 1176.22 0 0 Potri.003G141000.2.v4.1 2943 2703.22 718.274 16.6989 Potri.016G087400.1.v4.1 270 83.2593 586 442.328 Potri.015G069301.1.v4.1 564 330.158 0 0 Potri.010G195200.1.v4.1 1773 1533.22 576 23.6101 Potri.012G127500.1.v4.1 977 737.259 14571 1242.08 ==> SRR7166196.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 901 SRR7166196 completed mapping pipeline successfully