Starting /dee2/code/volunteer_pipeline.sh SRR7166197 current disk space = 3106275610624 free memory = 1460520628 SRR7166197 SRAfilesize a38fc8c251c8168f49e6f6ebfa18266d SRR7166197.sra SRR7166197.sra file validated SRR7166197 is paired end SRR7166197 is conventional basespace SRR7166197 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166197_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9795 33.0 32.0 34.0 31.0 34.0 2 32.2415 33.0 33.0 34.0 29.0 34.0 3 32.26475 33.0 33.0 34.0 30.0 34.0 4 32.175 33.0 32.0 34.0 31.0 34.0 5 32.4625 33.0 33.0 34.0 31.0 34.0 6 36.29 38.0 37.0 38.0 33.0 38.0 7 36.7425 38.0 37.0 38.0 34.0 38.0 8 36.89625 38.0 38.0 38.0 35.0 38.0 9 37.004 38.0 38.0 38.0 35.0 38.0 10-14 36.98365 38.0 38.0 38.0 35.4 38.0 15-19 36.9443 38.0 38.0 38.0 35.2 38.0 20-24 36.971849999999996 38.0 38.0 38.0 35.4 38.0 25-29 36.7324 38.0 38.0 38.0 34.2 38.0 30-34 36.6161 38.0 38.0 38.0 34.0 38.0 35-39 36.41805000000001 38.0 37.2 38.0 33.8 38.0 40-44 36.314800000000005 38.0 37.2 38.0 33.4 38.0 45-49 36.1845 38.0 37.0 38.0 33.0 38.0 50-54 36.04405 38.0 37.0 38.0 32.2 38.0 55-59 35.87665 38.0 37.0 38.0 31.0 38.0 60-64 35.900600000000004 38.0 36.8 38.0 31.2 38.0 65-69 35.65765 38.0 36.4 38.0 29.8 38.0 70-74 35.64905 38.0 36.0 38.0 29.8 38.0 75-79 34.932 38.0 35.6 38.0 27.8 38.0 80-84 34.7317 38.0 35.4 38.0 27.0 38.0 85-89 34.98635 38.0 35.2 38.0 28.0 38.0 90-94 34.7594 38.0 34.8 38.0 26.6 38.0 95-99 34.3611 38.0 34.0 38.0 25.0 38.0 100-104 34.177899999999994 38.0 34.0 38.0 24.2 38.0 105-109 33.60995 37.6 33.8 38.0 19.4 38.0 110-114 33.387699999999995 37.0 33.2 38.0 17.8 38.0 115-119 32.7684 37.0 31.0 38.0 15.0 38.0 120-124 32.4061 36.8 30.6 38.0 15.0 38.0 125-129 31.605349999999998 36.8 30.4 38.0 14.8 38.0 130-134 29.756999999999998 34.2 24.6 38.0 13.4 38.0 135-139 28.571800000000003 33.0 21.6 38.0 12.2 38.0 140-144 27.862350000000003 33.0 20.8 38.0 2.0 38.0 145-149 25.4858 33.0 10.6 38.0 2.0 38.0 150-151 19.21525 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 2.0 14 2.0 15 0.0 16 1.0 17 4.0 18 4.0 19 4.0 20 12.0 21 13.0 22 29.0 23 36.0 24 46.0 25 60.0 26 48.0 27 79.0 28 87.0 29 120.0 30 148.0 31 190.0 32 237.0 33 332.0 34 422.0 35 619.0 36 877.0 37 626.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.3590391908976 19.97471554993679 10.720606826801516 32.94563843236409 2 19.375 25.900000000000002 36.7 18.025 3 17.625 32.725 28.499999999999996 21.15 4 20.549999999999997 36.575 22.875 20.0 5 19.975 38.074999999999996 22.650000000000002 19.3 6 16.375 35.949999999999996 24.675 23.0 7 11.75 20.1 46.725 21.425 8 16.675 22.7 27.35 33.275 9 16.925 21.975 31.8 29.299999999999997 10-14 19.035 29.92 27.400000000000002 23.645 15-19 19.23 28.975 28.33 23.465 20-24 19.045 29.445 28.194999999999997 23.315 25-29 18.96 30.259999999999998 28.15 22.63 30-34 19.5 30.240000000000002 27.365000000000002 22.895 35-39 19.439999999999998 29.175 28.275 23.11 40-44 19.61 28.865000000000002 28.48 23.044999999999998 45-49 19.605 29.21 27.92 23.265 50-54 18.905 29.625 27.83 23.64 55-59 19.295 29.375 28.24 23.09 60-64 18.96 29.465000000000003 27.905 23.669999999999998 65-69 19.42 28.994999999999997 28.03 23.555 70-74 19.65294794219133 29.40441066159924 27.554133119967993 23.38850827624144 75-79 19.39860281461982 29.16371367824238 28.034828389187 23.402855117950793 80-84 19.696816061650782 28.736564591360782 28.07239910768607 23.494220239302376 85-89 19.85 28.84 28.244999999999997 23.064999999999998 90-94 19.33 28.895 28.410000000000004 23.365 95-99 19.875 29.294999999999998 27.405 23.425 100-104 19.79 28.675 27.98 23.555 105-109 19.495 29.28 28.005000000000003 23.22 110-114 20.115 28.77 27.79 23.325000000000003 115-119 20.365 28.665000000000003 27.71 23.26 120-124 19.610785932262743 29.20606333483416 27.995397468607734 23.187753264295363 125-129 20.99814972245837 28.5042756413462 27.499124868730306 22.99844976746512 130-134 20.7356344973332 29.027875616383213 26.652913354131023 23.583576532152563 135-139 20.49344409968972 29.121209088179363 26.974276849164248 23.41106996296667 140-144 20.948616600790515 28.35342972932406 27.502876869965476 23.19507679991995 145-149 20.42218210990774 28.299237866024868 27.095868431608505 24.182711592458887 150-151 20.999874702418243 28.317253477007892 26.913920561333164 23.768951259240698 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 1.5 18 1.0 19 1.0 20 1.5 21 3.0 22 2.5 23 2.5 24 4.5 25 7.0 26 8.5 27 8.5 28 15.0 29 20.5 30 31.5 31 40.5 32 45.5 33 62.5 34 76.5 35 92.0 36 120.5 37 140.5 38 159.0 39 200.0 40 232.0 41 247.0 42 247.0 43 249.5 44 259.0 45 264.0 46 257.0 47 228.5 48 200.0 49 166.5 50 134.0 51 117.0 52 91.5 53 64.0 54 49.0 55 40.5 56 32.0 57 20.5 58 14.5 59 10.5 60 6.0 61 6.0 62 5.5 63 2.0 64 1.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 1.23 80-84 1.38 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.055 125-129 0.015 130-134 0.63 135-139 0.09 140-144 0.065 145-149 0.27999999999999997 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.362500000000001 0.0 0.0 0.0 0.0 138-139 7.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166197 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166197_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51625 33.0 33.0 34.0 32.0 34.0 2 32.5905 33.0 33.0 34.0 32.0 34.0 3 32.64975 33.0 33.0 34.0 32.0 34.0 4 32.514 33.0 33.0 34.0 32.0 34.0 5 32.53 33.0 33.0 34.0 32.0 34.0 6 36.5945 38.0 38.0 38.0 35.0 38.0 7 36.58625 38.0 38.0 38.0 35.0 38.0 8 36.61525 38.0 38.0 38.0 35.0 38.0 9 36.53075 38.0 38.0 38.0 34.0 38.0 10-14 36.485499999999995 38.0 38.0 38.0 34.4 38.0 15-19 36.449200000000005 38.0 38.0 38.0 34.0 38.0 20-24 36.28625 38.0 38.0 38.0 33.4 38.0 25-29 36.373450000000005 38.0 38.0 38.0 34.2 38.0 30-34 36.33555 38.0 38.0 38.0 34.2 38.0 35-39 36.187799999999996 38.0 38.0 38.0 33.4 38.0 40-44 36.0065 38.0 38.0 38.0 32.8 38.0 45-49 35.85855 38.0 37.6 38.0 31.8 38.0 50-54 35.861599999999996 38.0 37.2 38.0 31.6 38.0 55-59 35.8738 38.0 37.2 38.0 31.6 38.0 60-64 35.780350000000006 38.0 37.0 38.0 31.4 38.0 65-69 35.68445 38.0 37.0 38.0 30.4 38.0 70-74 35.557399999999994 38.0 37.0 38.0 30.2 38.0 75-79 35.3432 38.0 36.6 38.0 29.4 38.0 80-84 35.0827 38.0 36.0 38.0 28.2 38.0 85-89 34.9577 38.0 36.0 38.0 27.6 38.0 90-94 34.72965 38.0 35.8 38.0 26.4 38.0 95-99 34.70385 38.0 35.8 38.0 26.4 38.0 100-104 34.1879 38.0 34.8 38.0 23.2 38.0 105-109 34.0654 38.0 34.6 38.0 21.4 38.0 110-114 33.86409999999999 38.0 34.0 38.0 21.4 38.0 115-119 33.27745 38.0 33.8 38.0 15.0 38.0 120-124 32.9878 38.0 33.0 38.0 15.0 38.0 125-129 32.3107 37.4 31.6 38.0 15.0 38.0 130-134 31.444399999999995 36.8 31.0 38.0 13.4 38.0 135-139 30.441300000000002 36.0 29.0 38.0 12.6 38.0 140-144 29.20675 36.0 25.6 38.0 2.0 38.0 145-149 26.892400000000002 33.2 14.6 38.0 2.0 38.0 150-151 21.278875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 9.0 4 2.0 5 6.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 1.0 12 3.0 13 3.0 14 7.0 15 7.0 16 11.0 17 7.0 18 9.0 19 16.0 20 20.0 21 19.0 22 14.0 23 25.0 24 36.0 25 48.0 26 46.0 27 55.0 28 64.0 29 90.0 30 104.0 31 132.0 32 190.0 33 216.0 34 288.0 35 475.0 36 862.0 37 1213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.54527263631816 16.05802901450725 14.48224112056028 28.91445722861431 2 24.712356178089045 22.911455727863935 35.967983991996 16.408204102051023 3 19.884942471235618 25.41270635317659 34.04202101050525 20.66033016508254 4 22.641981486114584 35.50162621966475 21.290968226169625 20.565424068051037 5 22.416812609457093 39.70477858393796 20.01501125844383 17.86339754816112 6 18.2 38.224999999999994 23.45 20.125 7 17.175 15.375 45.6 21.85 8 20.424999999999997 21.9 26.625 31.05 9 21.7 24.474999999999998 28.075 25.75 10-14 22.555 28.494999999999997 27.18 21.77 15-19 22.994999999999997 28.425 27.925 20.655 20-24 22.515 28.735 28.205000000000002 20.544999999999998 25-29 22.975 28.075 28.87 20.080000000000002 30-34 22.475 28.515 28.01 21.0 35-39 22.712271227122713 27.567756775677566 29.082908290829085 20.637063706370636 40-44 22.765 28.01 28.83 20.395 45-49 22.375 28.08 28.7 20.845 50-54 22.759999999999998 28.044999999999998 28.28 20.915 55-59 23.215 27.544999999999998 28.99 20.25 60-64 22.84 28.17 28.67 20.32 65-69 23.1 28.34 28.705000000000002 19.855 70-74 23.425 27.485 28.985 20.105 75-79 23.325000000000003 28.21 28.215 20.25 80-84 23.285 28.04 29.195 19.48 85-89 23.419999999999998 28.365000000000002 28.349999999999998 19.865 90-94 23.105 27.33 29.335 20.23 95-99 23.82 28.144999999999996 28.15 19.885 100-104 23.960990247561888 27.846961740435113 28.767191797949486 19.424856214053513 105-109 23.057292969727293 27.540655491618715 29.39704778583938 20.00500375281461 110-114 23.692107632289687 28.653596078823647 28.283485045513657 19.370811243373012 115-119 23.325000000000003 28.46 28.735 19.48 120-124 24.279999999999998 27.85 28.634999999999998 19.235 125-129 24.145 28.355000000000004 28.12 19.38 130-134 24.765 27.939999999999998 28.410000000000004 18.884999999999998 135-139 24.47 28.48 27.82 19.23 140-144 25.490000000000002 28.155 27.88 18.475 145-149 25.97 28.215 27.334999999999997 18.48 150-151 25.3 27.275 28.4375 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 0.5 24 2.0 25 3.0 26 6.0 27 10.5 28 9.5 29 14.0 30 20.0 31 21.0 32 36.0 33 45.0 34 48.5 35 64.5 36 85.0 37 124.0 38 158.5 39 171.5 40 195.5 41 230.5 42 265.0 43 273.5 44 270.0 45 287.5 46 277.0 47 260.5 48 242.5 49 204.0 50 161.5 51 124.5 52 102.5 53 75.0 54 56.0 55 42.0 56 24.5 57 19.5 58 16.0 59 11.0 60 8.0 61 5.0 62 6.5 63 5.5 64 2.0 65 1.0 66 0.5 67 2.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.075 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.698568198945 99.225 2 0.20095453403667418 0.4 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.05 0.0 0.0 0.0 0.0 130-131 5.45 0.0 0.0 0.0 0.0 132-133 6.0 0.0 0.0 0.0 0.0 134-135 6.675000000000001 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAAC 10 0.006830828 145.0 7 AAAACTG 10 0.006830828 145.0 9 >>END_MODULE Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773913 spots for SRR7166197.sra Written 773913 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra Read 773897 spots for SRR7166197.sra Written 773897 spots for SRR7166197.sra SRR ids: ['SRR7166197.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8aoa0zz4 SRR7166197.sra spots: 15477956 blocks: [[1, 773897], [773898, 1547794], [1547795, 2321691], [2321692, 3095588], [3095589, 3869485], [3869486, 4643382], [4643383, 5417279], [5417280, 6191176], [6191177, 6965073], [6965074, 7738970], [7738971, 8512867], [8512868, 9286764], [9286765, 10060661], [10060662, 10834558], [10834559, 11608455], [11608456, 12382352], [12382353, 13156249], [13156250, 13930146], [13930147, 14704043], [14704044, 15477956]] SRR7166197 file size 5223271 SRR7166197 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166197 SRR7166197_1.fastq SRR7166197_2.fastq Input file: SRR7166197_1.fastq Paired file: SRR7166197_2.fastq trimmed: SRR7166197-trimmed-pair1.fastq, SRR7166197-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 23:54:51 2025 >> started Fri Feb 14 23:55:11 2025 >> done (19.338s) 15477956 read pairs processed; of these: 23480 ( 0.15%) short read pairs filtered out after trimming by size control 18105 ( 0.12%) empty read pairs filtered out after trimming by size control 15436371 (99.73%) read pairs available; of these: 10830170 (70.16%) trimmed read pairs available after processing 4606201 (29.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 8 0.00% 25 7 0.00% 26 8 0.00% 27 3 0.00% 28 7 0.00% 29 12 0.00% 30 8 0.00% 31 10 0.00% 32 11 0.00% 33 12 0.00% 34 8 0.00% 35 17 0.00% 36 8 0.00% 37 19 0.00% 38 16 0.00% 39 14 0.00% 40 19 0.00% 41 22 0.00% 42 25 0.00% 43 19 0.00% 44 24 0.00% 45 28 0.00% 46 28 0.00% 47 44 0.00% 48 56 0.00% 49 55 0.00% 50 65 0.00% 51 63 0.00% 52 84 0.00% 53 74 0.00% 54 72 0.00% 55 101 0.00% 56 137 0.00% 57 145 0.00% 58 142 0.00% 59 176 0.00% 60 225 0.00% 61 245 0.00% 62 273 0.00% 63 284 0.00% 64 347 0.00% 65 383 0.00% 66 466 0.00% 67 447 0.00% 68 590 0.00% 69 636 0.00% 70 757 0.00% 71 891 0.01% 72 1055 0.01% 73 1134 0.01% 74 1386 0.01% 75 1428 0.01% 76 1583 0.01% 77 1867 0.01% 78 1947 0.01% 79 2316 0.02% 80 2524 0.02% 81 3019 0.02% 82 3576 0.02% 83 3977 0.03% 84 5221 0.03% 85 5899 0.04% 86 6164 0.04% 87 6575 0.04% 88 7005 0.05% 89 7449 0.05% 90 8157 0.05% 91 8805 0.06% 92 9901 0.06% 93 10521 0.07% 94 11321 0.07% 95 12080 0.08% 96 12762 0.08% 97 13385 0.09% 98 14152 0.09% 99 15037 0.10% 100 16472 0.11% 101 17373 0.11% 102 18908 0.12% 103 20383 0.13% 104 21542 0.14% 105 23147 0.15% 106 24258 0.16% 107 24680 0.16% 108 25865 0.17% 109 26899 0.17% 110 28764 0.19% 111 30556 0.20% 112 32724 0.21% 113 35031 0.23% 114 37607 0.24% 115 39517 0.26% 116 40977 0.27% 117 43430 0.28% 118 45032 0.29% 119 46568 0.30% 120 49130 0.32% 121 52018 0.34% 122 55239 0.36% 123 59520 0.39% 124 63884 0.41% 125 67360 0.44% 126 71541 0.46% 127 75003 0.49% 128 78474 0.51% 129 83896 0.54% 130 88608 0.57% 131 95150 0.62% 132 102730 0.67% 133 111332 0.72% 134 122205 0.79% 135 132828 0.86% 136 140180 0.91% 137 147113 0.95% 138 157877 1.02% 139 172797 1.12% 140 192228 1.25% 141 195299 1.27% 142 214562 1.39% 143 241034 1.56% 144 278033 1.80% 145 331179 2.15% 146 408945 2.65% 147 534904 3.47% 148 746669 4.84% 149 1288296 8.35% 150 3685041 23.87% 151 4606201 29.84% 15436371 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=26.27 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.2 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.65 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=39.51 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.3 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166197 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 23:56:29 Started mapping on | Feb 14 23:56:30 Finished on | Feb 14 23:59:28 Mapping speed, Million of reads per hour | 312.20 Number of input reads | 15436371 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14150872 Uniquely mapped reads % | 91.67% Average mapped length | 288.97 Number of splices: Total | 13419615 Number of splices: Annotated (sjdb) | 13161516 Number of splices: GT/AG | 13193657 Number of splices: GC/AG | 174667 Number of splices: AT/AC | 10447 Number of splices: Non-canonical | 40844 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355667 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 37137 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.65% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 951578 951578 951578 N_multimapping 355667 355667 355667 N_noFeature 501910 13973881 602609 N_ambiguous 145666 896 68967 UnstrandedReadsAssigned:13503296 PositiveStrandReadsAssigned:176095 NegativeStrandReadsAssigned:13479296 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR7166197 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166197-trimmed-pair1.fastq SRR7166197-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,436,371 reads, 13,411,670 reads pseudoaligned [quant] estimated average fragment length: 231.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7166197.ke.tsv 34699 SRR7166197.se.tsv 87100 total ==> SRR7166197.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.98 1001 40.6587 Potri.005G024800.1.v4.1 1035 804.979 217 19.5775 Potri.004G059700.1.v4.1 961 730.989 28 2.78182 Potri.007G009000.2.v4.1 1416 1185.98 0 0 Potri.003G141000.2.v4.1 2943 2712.98 479.175 12.8271 Potri.016G087400.1.v4.1 270 85.2713 914.197 778.607 Potri.015G069301.1.v4.1 564 337.312 0 0 Potri.010G195200.1.v4.1 1773 1542.98 407 19.1565 Potri.012G127500.1.v4.1 977 746.984 4471 434.685 ==> SRR7166197.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 498 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 421 SRR7166197 completed mapping pipeline successfully