Starting /dee2/code/volunteer_pipeline.sh SRR7166198 current disk space = 3105011146752 free memory = 1580008768 SRR7166198 SRAfilesize 7d3ba116ba143f8521ff95c8403c49fa SRR7166198.sra SRR7166198.sra file validated SRR7166198 is paired end SRR7166198 is conventional basespace SRR7166198 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166198_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.966 33.0 32.0 34.0 30.0 34.0 2 32.129 33.0 33.0 34.0 29.0 34.0 3 32.26025 33.0 33.0 34.0 29.0 34.0 4 32.1085 33.0 33.0 34.0 29.0 34.0 5 32.16775 33.0 33.0 34.0 30.0 34.0 6 36.51125 38.0 37.0 38.0 34.0 38.0 7 36.7495 38.0 37.0 38.0 34.0 38.0 8 36.9885 38.0 38.0 38.0 35.0 38.0 9 36.72 38.0 38.0 38.0 34.0 38.0 10-14 37.0452 38.0 38.0 38.0 35.8 38.0 15-19 36.98035 38.0 38.0 38.0 35.6 38.0 20-24 36.997550000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.74335 38.0 38.0 38.0 34.6 38.0 30-34 36.170249999999996 38.0 37.2 38.0 32.4 38.0 35-39 36.08605 38.0 37.0 38.0 31.6 38.0 40-44 36.0287 38.0 37.0 38.0 32.0 38.0 45-49 35.9269 38.0 37.0 38.0 31.2 38.0 50-54 35.48729999999999 38.0 36.2 38.0 28.4 38.0 55-59 35.40475 38.0 36.0 38.0 28.8 38.0 60-64 35.22025 38.0 35.8 38.0 28.4 38.0 65-69 35.381350000000005 38.0 36.0 38.0 28.8 38.0 70-74 35.18425 38.0 35.8 38.0 28.6 38.0 75-79 34.59585 38.0 35.4 38.0 26.6 38.0 80-84 34.357150000000004 38.0 35.2 38.0 25.2 38.0 85-89 34.16885 38.0 34.2 38.0 22.8 38.0 90-94 34.3585 38.0 34.4 38.0 24.8 38.0 95-99 34.1144 38.0 34.0 38.0 22.6 38.0 100-104 33.49015 37.4 33.6 38.0 16.6 38.0 105-109 32.931 37.2 32.6 38.0 15.0 38.0 110-114 32.27285 37.0 31.0 38.0 15.0 38.0 115-119 32.004599999999996 37.0 30.2 38.0 15.0 38.0 120-124 31.409699999999997 36.2 28.8 38.0 15.0 38.0 125-129 30.23155 35.2 25.2 38.0 14.0 38.0 130-134 28.676250000000003 34.0 22.4 38.0 13.0 38.0 135-139 27.620150000000002 33.0 19.6 38.0 4.2 38.0 140-144 26.26865 33.0 13.8 38.0 2.0 38.0 145-149 24.42175 32.2 8.2 38.0 2.0 38.0 150-151 18.443875 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 2.0 13 3.0 14 3.0 15 3.0 16 11.0 17 5.0 18 14.0 19 24.0 20 24.0 21 18.0 22 30.0 23 42.0 24 43.0 25 56.0 26 83.0 27 103.0 28 108.0 29 134.0 30 176.0 31 195.0 32 225.0 33 334.0 34 404.0 35 564.0 36 857.0 37 536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.770280515542076 17.867071013393986 11.726055092241596 33.63659337882234 2 19.8 25.4 37.175000000000004 17.625 3 16.575 32.2 27.025 24.2 4 20.95 38.074999999999996 22.8 18.175 5 21.475 38.074999999999996 22.725 17.724999999999998 6 16.950000000000003 36.675000000000004 23.400000000000002 22.975 7 12.625 22.125 43.875 21.375 8 18.425 20.625 28.95 32.0 9 17.275 21.349999999999998 30.825000000000003 30.55 10-14 19.335 30.785 26.33 23.549999999999997 15-19 19.035 29.56 27.575 23.830000000000002 20-24 19.595000000000002 29.630000000000003 27.860000000000003 22.915 25-29 19.125 29.38 27.73 23.765 30-34 20.055 29.195 27.91 22.84 35-39 20.285 29.599999999999998 27.54 22.575 40-44 19.675 29.675 27.66 22.99 45-49 19.365 28.87 28.455000000000002 23.31 50-54 19.56 29.515 27.584999999999997 23.34 55-59 19.485 29.395 28.025 23.095 60-64 19.78 28.910000000000004 28.050000000000004 23.26 65-69 19.735 29.445 27.595 23.225 70-74 19.951911035415517 29.42443520512949 27.535941491759758 23.087712267695238 75-79 20.259648055175212 29.103909934580862 27.22247578477611 23.41396622546782 80-84 19.695813622259525 29.019787374739302 27.961747799989826 23.322651203011343 85-89 19.8399599899975 29.072268067016754 28.232058014503625 22.85571392848212 90-94 19.877981697254587 29.324398659798973 27.759163874581187 23.038455768365253 95-99 19.64 29.830000000000002 27.57 22.96 100-104 20.46 29.345 27.265 22.93 105-109 19.759999999999998 30.035 26.91 23.294999999999998 110-114 20.28 29.555 27.384999999999998 22.78 115-119 20.22 29.69 26.68 23.41 120-124 20.28934721665999 28.939727673207848 27.51802162595114 23.25290348418102 125-129 20.714715316760223 29.245188452285486 27.21531676022454 22.82477947072975 130-134 20.750316856780735 29.7743979721166 26.5297845373891 22.94550063371356 135-139 20.977862557100547 30.274584609206368 26.153305556949952 22.594247276743136 140-144 21.58 29.825000000000003 26.334999999999997 22.259999999999998 145-149 21.28777923784494 28.535328009703832 26.584453654098855 23.59243909835237 150-151 21.770754953599198 27.35139202407825 26.63656884875846 24.241284173564086 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 2.0 19 1.5 20 0.5 21 0.0 22 2.0 23 2.5 24 1.5 25 2.5 26 7.5 27 11.5 28 16.5 29 23.0 30 31.5 31 40.0 32 52.0 33 61.5 34 64.5 35 87.0 36 116.0 37 141.0 38 164.5 39 187.5 40 214.0 41 233.5 42 247.5 43 257.5 44 276.5 45 273.5 46 238.0 47 228.5 48 211.5 49 163.0 50 140.5 51 119.5 52 91.0 53 80.0 54 56.0 55 34.5 56 31.5 57 27.0 58 17.0 59 10.5 60 6.5 61 4.5 62 4.5 63 2.5 64 2.0 65 2.5 66 1.0 67 1.5 68 2.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.185 75-79 1.405 80-84 1.7049999999999998 85-89 0.025 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.12 125-129 0.24 130-134 1.375 135-139 0.395 140-144 0.0 145-149 1.0699999999999998 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64726631393297 98.875 2 0.327538422776518 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCGGTATCTCGTAT 19 0.475 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9625 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.824999999999999 0.0 0.0 0.0 0.0 128-129 5.362500000000001 0.0 0.0 0.0 0.0 130-131 5.8875 0.0 0.0 0.0 0.0 132-133 6.550000000000001 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.95 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166198 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166198_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58975 33.0 33.0 34.0 32.0 34.0 2 32.64425 33.0 33.0 34.0 32.0 34.0 3 32.53475 33.0 33.0 34.0 31.0 34.0 4 32.4065 33.0 33.0 34.0 31.0 34.0 5 32.53775 33.0 33.0 34.0 32.0 34.0 6 36.575 38.0 38.0 38.0 34.0 38.0 7 36.5735 38.0 38.0 38.0 35.0 38.0 8 36.5985 38.0 38.0 38.0 35.0 38.0 9 36.5835 38.0 38.0 38.0 35.0 38.0 10-14 36.49925 38.0 38.0 38.0 34.2 38.0 15-19 36.16685 38.0 38.0 38.0 32.8 38.0 20-24 36.098749999999995 38.0 38.0 38.0 33.0 38.0 25-29 36.1914 38.0 38.0 38.0 33.2 38.0 30-34 36.244299999999996 38.0 38.0 38.0 33.8 38.0 35-39 35.803450000000005 38.0 37.4 38.0 30.6 38.0 40-44 35.96695 38.0 37.6 38.0 31.4 38.0 45-49 35.456599999999995 38.0 37.0 38.0 28.8 38.0 50-54 35.626999999999995 38.0 37.0 38.0 29.6 38.0 55-59 35.53345 38.0 37.0 38.0 29.4 38.0 60-64 35.5748 38.0 37.0 38.0 29.8 38.0 65-69 35.14855 38.0 36.6 38.0 28.0 38.0 70-74 35.29205 38.0 37.0 38.0 29.0 38.0 75-79 35.031749999999995 38.0 36.2 38.0 27.4 38.0 80-84 34.7353 38.0 36.0 38.0 26.0 38.0 85-89 34.95435 38.0 36.2 38.0 28.0 38.0 90-94 34.75575 38.0 36.0 38.0 26.4 38.0 95-99 34.50815 38.0 35.6 38.0 25.6 38.0 100-104 33.938900000000004 38.0 34.4 38.0 19.8 38.0 105-109 33.8429 38.0 34.2 38.0 21.0 38.0 110-114 33.39065 38.0 34.0 38.0 15.0 38.0 115-119 33.163599999999995 38.0 33.6 38.0 15.0 38.0 120-124 32.29865 37.6 32.4 38.0 15.0 38.0 125-129 31.428050000000002 36.8 30.2 38.0 14.2 38.0 130-134 30.49875 35.8 27.4 38.0 13.0 38.0 135-139 29.749199999999995 35.4 26.4 38.0 8.6 38.0 140-144 28.429449999999996 34.2 21.6 38.0 2.0 38.0 145-149 26.437649999999998 33.4 13.0 38.0 2.0 38.0 150-151 20.321 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 9.0 4 6.0 5 2.0 6 1.0 7 1.0 8 2.0 9 3.0 10 7.0 11 6.0 12 9.0 13 4.0 14 5.0 15 7.0 16 11.0 17 12.0 18 18.0 19 14.0 20 19.0 21 28.0 22 27.0 23 27.0 24 37.0 25 40.0 26 47.0 27 71.0 28 100.0 29 93.0 30 137.0 31 143.0 32 170.0 33 207.0 34 298.0 35 427.0 36 771.0 37 1231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225 15.75 14.625 29.4 2 22.95 23.125 36.3 17.625 3 19.525000000000002 25.85 34.35 20.275000000000002 4 24.0 33.775 22.375 19.85 5 23.799999999999997 36.675000000000004 22.025 17.5 6 18.35 37.8 23.974999999999998 19.875 7 16.7 16.475 46.6 20.225 8 20.8 21.775 27.325 30.099999999999998 9 23.005751437859466 23.20580145036259 28.732183045761438 25.056264066016503 10-14 22.405 28.494999999999997 27.97 21.13 15-19 22.62 28.175 28.79 20.415 20-24 22.835 27.97 28.48 20.715 25-29 22.8 28.720000000000002 28.494999999999997 19.985 30-34 22.74 27.325 29.5 20.435 35-39 22.925 28.605000000000004 28.12 20.349999999999998 40-44 23.11615580779039 28.401420071003553 28.761438071903594 19.720986049302468 45-49 22.57 28.03 29.409999999999997 19.99 50-54 22.86 28.055000000000003 28.835 20.25 55-59 23.335 27.99 28.34 20.335 60-64 23.03 27.644999999999996 29.09 20.235 65-69 23.0 27.37 29.24 20.39 70-74 23.04 28.26 28.470000000000002 20.23 75-79 23.200000000000003 28.410000000000004 28.76 19.63 80-84 22.575 28.29 29.435 19.7 85-89 23.380000000000003 27.810000000000002 28.935 19.875 90-94 23.39 27.92 28.665000000000003 20.025000000000002 95-99 23.235 28.38 28.395 19.99 100-104 23.54235423542354 27.747774777477748 29.117911791179118 19.591959195919593 105-109 23.923373180613215 27.74971239933977 28.715050267593657 19.61186415245336 110-114 23.893584037605642 27.759163874581187 28.244236635495323 20.103015452317848 115-119 23.919999999999998 28.565 27.889999999999997 19.625 120-124 23.84119205960298 28.621431071553577 28.221411070553525 19.315965798289913 125-129 23.87 27.88 27.96 20.29 130-134 24.305 28.035 27.92 19.74 135-139 24.474999999999998 28.24 28.000000000000004 19.285 140-144 25.074999999999996 28.09 27.515 19.32 145-149 25.759999999999998 27.785 27.48 18.975 150-151 26.200000000000003 26.637499999999996 28.050000000000004 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 0.5 21 2.0 22 2.5 23 2.0 24 2.5 25 3.0 26 4.0 27 7.5 28 10.0 29 14.0 30 14.0 31 18.0 32 36.0 33 55.5 34 60.0 35 71.5 36 104.5 37 139.5 38 160.5 39 179.5 40 225.0 41 249.0 42 256.0 43 270.5 44 282.0 45 290.0 46 264.0 47 231.5 48 213.0 49 180.5 50 141.0 51 114.5 52 101.5 53 79.0 54 60.5 55 45.5 56 27.0 57 18.0 58 13.0 59 13.5 60 13.0 61 9.0 62 4.0 63 2.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.034999999999999996 110-114 0.015 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69788519637463 99.0 2 0.25176233635448136 0.5 3 0.0 0.0 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTATAGCGGTGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.512499999999999 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 5.987500000000001 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACACT 10 0.006830828 145.0 1 >>END_MODULE Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681866 spots for SRR7166198.sra Written 681866 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra Read 681859 spots for SRR7166198.sra Written 681859 spots for SRR7166198.sra SRR ids: ['SRR7166198.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wmicw14i SRR7166198.sra spots: 13637187 blocks: [[1, 681859], [681860, 1363718], [1363719, 2045577], [2045578, 2727436], [2727437, 3409295], [3409296, 4091154], [4091155, 4773013], [4773014, 5454872], [5454873, 6136731], [6136732, 6818590], [6818591, 7500449], [7500450, 8182308], [8182309, 8864167], [8864168, 9546026], [9546027, 10227885], [10227886, 10909744], [10909745, 11591603], [11591604, 12273462], [12273463, 12955321], [12955322, 13637187]] SRR7166198 file size 4599494 SRR7166198 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166198 SRR7166198_1.fastq SRR7166198_2.fastq Input file: SRR7166198_1.fastq Paired file: SRR7166198_2.fastq trimmed: SRR7166198-trimmed-pair1.fastq, SRR7166198-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 00:48:30 2025 >> started Sat Feb 15 00:48:44 2025 >> done (14.613s) 13637187 read pairs processed; of these: 14263 ( 0.10%) short read pairs filtered out after trimming by size control 82033 ( 0.60%) empty read pairs filtered out after trimming by size control 13540891 (99.29%) read pairs available; of these: 8851704 (65.37%) trimmed read pairs available after processing 4689187 (34.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 12 0.00% 21 3 0.00% 22 8 0.00% 23 10 0.00% 24 7 0.00% 25 8 0.00% 26 7 0.00% 27 3 0.00% 28 10 0.00% 29 11 0.00% 30 9 0.00% 31 11 0.00% 32 10 0.00% 33 14 0.00% 34 7 0.00% 35 12 0.00% 36 17 0.00% 37 15 0.00% 38 26 0.00% 39 23 0.00% 40 28 0.00% 41 26 0.00% 42 25 0.00% 43 22 0.00% 44 34 0.00% 45 43 0.00% 46 61 0.00% 47 46 0.00% 48 70 0.00% 49 61 0.00% 50 90 0.00% 51 77 0.00% 52 97 0.00% 53 101 0.00% 54 104 0.00% 55 166 0.00% 56 171 0.00% 57 210 0.00% 58 214 0.00% 59 258 0.00% 60 321 0.00% 61 347 0.00% 62 353 0.00% 63 465 0.00% 64 564 0.00% 65 584 0.00% 66 621 0.00% 67 723 0.01% 68 871 0.01% 69 929 0.01% 70 1114 0.01% 71 1254 0.01% 72 1564 0.01% 73 1510 0.01% 74 1773 0.01% 75 1800 0.01% 76 2008 0.01% 77 2095 0.02% 78 2200 0.02% 79 2453 0.02% 80 2780 0.02% 81 3174 0.02% 82 3601 0.03% 83 4001 0.03% 84 5033 0.04% 85 5654 0.04% 86 5900 0.04% 87 6560 0.05% 88 7198 0.05% 89 7473 0.06% 90 8477 0.06% 91 9934 0.07% 92 10536 0.08% 93 11299 0.08% 94 11684 0.09% 95 12113 0.09% 96 12682 0.09% 97 14047 0.10% 98 14643 0.11% 99 16519 0.12% 100 17232 0.13% 101 17965 0.13% 102 18818 0.14% 103 19608 0.14% 104 20653 0.15% 105 22962 0.17% 106 23737 0.18% 107 23898 0.18% 108 23879 0.18% 109 24277 0.18% 110 26060 0.19% 111 26997 0.20% 112 29123 0.22% 113 31228 0.23% 114 31942 0.24% 115 32065 0.24% 116 34368 0.25% 117 37974 0.28% 118 40423 0.30% 119 43343 0.32% 120 44199 0.33% 121 44885 0.33% 122 45717 0.34% 123 48212 0.36% 124 52785 0.39% 125 55733 0.41% 126 58640 0.43% 127 62397 0.46% 128 64992 0.48% 129 69792 0.52% 130 74086 0.55% 131 80027 0.59% 132 86157 0.64% 133 91156 0.67% 134 97440 0.72% 135 104301 0.77% 136 107135 0.79% 137 110991 0.82% 138 120689 0.89% 139 136606 1.01% 140 158809 1.17% 141 151388 1.12% 142 161662 1.19% 143 177979 1.31% 144 204285 1.51% 145 242641 1.79% 146 305266 2.25% 147 406993 3.01% 148 579432 4.28% 149 981100 7.25% 150 3180664 23.49% 151 4689187 34.63% 13540891 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=3.1 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=315.37 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=19.8 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=27 prefix-density=0.63 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.11 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=1.9 sequence=CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7166198 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 00:49:46 Started mapping on | Feb 15 00:49:46 Finished on | Feb 15 00:52:23 Mapping speed, Million of reads per hour | 310.49 Number of input reads | 13540891 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12321150 Uniquely mapped reads % | 90.99% Average mapped length | 289.10 Number of splices: Total | 11405136 Number of splices: Annotated (sjdb) | 11170684 Number of splices: GT/AG | 11216027 Number of splices: GC/AG | 146972 Number of splices: AT/AC | 8965 Number of splices: Non-canonical | 33172 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336965 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 30817 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.17% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897701 897701 897701 N_multimapping 336965 336965 336965 N_noFeature 499458 12124938 631489 N_ambiguous 126925 950 62106 UnstrandedReadsAssigned:11694767 PositiveStrandReadsAssigned:195262 NegativeStrandReadsAssigned:11627555 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166198 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166198-trimmed-pair1.fastq SRR7166198-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,540,891 reads, 11,583,473 reads pseudoaligned [quant] estimated average fragment length: 225.08 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7166198.ke.tsv 34699 SRR7166198.se.tsv 87100 total ==> SRR7166198.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.92 761 35.2518 Potri.005G024800.1.v4.1 1035 810.92 159 16.2937 Potri.004G059700.1.v4.1 961 736.93 30 3.38294 Potri.007G009000.2.v4.1 1416 1191.92 0 0 Potri.003G141000.2.v4.1 2943 2718.92 458.315 14.0077 Potri.016G087400.1.v4.1 270 88.0374 974 919.371 Potri.015G069301.1.v4.1 564 343.346 0 0 Potri.010G195200.1.v4.1 1773 1548.92 288.779 15.493 Potri.012G127500.1.v4.1 977 752.925 6070 669.941 ==> SRR7166198.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 274 SRR7166198 completed mapping pipeline successfully