Starting /dee2/code/volunteer_pipeline.sh SRR7166199 current disk space = 3104493895680 free memory = 1578741996 SRR7166199 SRAfilesize 2c8f37b277fcdf8cde89e19c564ab6f0 SRR7166199.sra SRR7166199.sra file validated SRR7166199 is paired end SRR7166199 is conventional basespace SRR7166199 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166199_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.50725 33.0 32.0 33.0 27.0 34.0 2 31.99675 33.0 31.0 34.0 28.0 34.0 3 31.904 33.0 31.0 34.0 28.0 34.0 4 32.2545 33.0 33.0 34.0 31.0 34.0 5 32.25125 33.0 33.0 34.0 31.0 34.0 6 36.44475 38.0 37.0 38.0 34.0 38.0 7 36.825 38.0 37.0 38.0 34.0 38.0 8 37.019 38.0 38.0 38.0 35.0 38.0 9 36.9935 38.0 38.0 38.0 35.0 38.0 10-14 36.779 38.0 38.0 38.0 34.4 38.0 15-19 36.601350000000004 38.0 38.0 38.0 34.0 38.0 20-24 36.72695 38.0 38.0 38.0 34.2 38.0 25-29 36.3852 38.0 37.2 38.0 33.4 38.0 30-34 36.125150000000005 38.0 37.0 38.0 31.8 38.0 35-39 35.9631 38.0 37.0 38.0 30.8 38.0 40-44 35.928599999999996 38.0 37.0 38.0 31.0 38.0 45-49 35.78795 38.0 36.6 38.0 30.2 38.0 50-54 35.72095 38.0 36.6 38.0 29.6 38.0 55-59 35.5815 38.0 36.2 38.0 29.0 38.0 60-64 35.27595 38.0 36.0 38.0 28.4 38.0 65-69 35.33695 38.0 36.0 38.0 28.4 38.0 70-74 35.2258 38.0 36.0 38.0 28.6 38.0 75-79 34.49905 38.0 34.8 38.0 26.2 38.0 80-84 34.1864 38.0 34.8 38.0 23.2 38.0 85-89 34.13185 38.0 34.2 38.0 24.0 38.0 90-94 34.46320000000001 38.0 34.2 38.0 25.4 38.0 95-99 33.7673 37.4 33.6 38.0 20.2 38.0 100-104 33.13365 37.0 32.4 38.0 15.0 38.0 105-109 32.878 37.0 31.4 38.0 15.0 38.0 110-114 31.96075 36.4 28.8 38.0 15.0 38.0 115-119 32.24495 37.0 29.8 38.0 15.0 38.0 120-124 31.3467 36.0 27.4 38.0 15.0 38.0 125-129 31.109550000000002 35.6 27.4 38.0 14.6 38.0 130-134 29.63995 35.0 23.6 38.0 13.2 38.0 135-139 28.3627 33.4 20.6 38.0 10.8 38.0 140-144 26.845499999999998 33.4 15.8 38.0 2.0 38.0 145-149 24.9608 31.8 10.8 38.0 2.0 38.0 150-151 18.587625 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 1.0 11 0.0 12 0.0 13 3.0 14 1.0 15 2.0 16 3.0 17 3.0 18 5.0 19 10.0 20 20.0 21 12.0 22 35.0 23 45.0 24 44.0 25 59.0 26 106.0 27 92.0 28 118.0 29 151.0 30 187.0 31 187.0 32 270.0 33 324.0 34 379.0 35 594.0 36 826.0 37 520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.46233832107532 18.28556936342886 9.104742581790514 33.1473497337053 2 19.775000000000002 24.95 36.9 18.375 3 18.075 31.25 25.900000000000002 24.775 4 21.325 36.525 21.975 20.175 5 20.65 38.625 22.525000000000002 18.2 6 16.150000000000002 38.625 24.175 21.05 7 12.325 20.275000000000002 45.6 21.8 8 17.1 21.4 28.875 32.625 9 16.650000000000002 22.05 31.724999999999998 29.575000000000003 10-14 18.92 29.86 27.02 24.2 15-19 19.105 28.98 27.93 23.985 20-24 19.545 29.14 28.23 23.085 25-29 19.285 29.509999999999998 27.985 23.22 30-34 19.665 29.24 27.810000000000002 23.285 35-39 19.655 29.544999999999998 27.54 23.26 40-44 19.695 29.409999999999997 27.935 22.96 45-49 19.445 29.2 28.02 23.335 50-54 20.015 29.549999999999997 27.655 22.78 55-59 19.71 29.599999999999998 27.029999999999998 23.66 60-64 20.325 29.465000000000003 27.435 22.775000000000002 65-69 19.705000000000002 29.57 27.495000000000005 23.23 70-74 19.83669789109853 28.422581776286126 28.117016480488903 23.623703852126436 75-79 19.634587001883048 29.299200977148963 27.802941625528018 23.26327039543997 80-84 20.050981391791996 28.733112413968904 28.13153199082335 23.084374203415752 85-89 19.18 29.439999999999998 27.57 23.810000000000002 90-94 19.75 28.625 28.26 23.365 95-99 19.759999999999998 29.01 27.54 23.69 100-104 20.02 28.935 27.67 23.375 105-109 19.725 29.5 27.505000000000003 23.27 110-114 19.895 29.13 27.815 23.16 115-119 20.39 29.455 26.76 23.395 120-124 21.13845538215286 27.696078431372552 27.696078431372552 23.46938775510204 125-129 21.13959543360705 28.564990987382334 27.67374324053675 22.621670338473862 130-134 20.90932053548876 28.744632482950237 27.09270017681233 23.253346804748674 135-139 20.658757571206888 28.733042999449367 26.650648245482305 23.95755118386144 140-144 21.04447001150518 28.51283077384823 26.73703166424891 23.70566755039768 145-149 21.679795293763483 27.951432441924638 26.672018463699764 23.69675380061211 150-151 21.40262993112085 27.20100187852223 26.988102692548527 24.40826549780839 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 2.5 23 2.5 24 3.5 25 4.0 26 6.5 27 12.0 28 16.5 29 17.5 30 26.0 31 37.5 32 47.0 33 52.5 34 66.5 35 85.0 36 100.0 37 121.5 38 151.5 39 178.5 40 208.5 41 246.5 42 270.5 43 278.5 44 273.5 45 286.5 46 272.5 47 226.5 48 206.0 49 188.0 50 151.5 51 109.5 52 86.0 53 72.0 54 51.5 55 33.5 56 24.5 57 18.5 58 15.5 59 11.0 60 9.0 61 8.5 62 4.0 63 2.5 64 2.5 65 1.5 66 0.5 67 0.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.185 75-79 1.755 80-84 1.925 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.13999999999999999 130-134 1.0250000000000001 135-139 0.11499999999999999 140-144 0.045 145-149 0.345 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3375 0.0 0.0 0.0 0.0 110-111 2.6500000000000004 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.85 0.0 0.0 0.0 0.0 118-119 4.3 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.25 0.0 0.0 0.0 0.0 124-125 5.7625 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.3875 0.0 0.0 0.0 0.0 132-133 7.975 0.0 0.0 0.0 0.0 134-135 8.524999999999999 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166199 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166199_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47225 33.0 33.0 34.0 31.0 34.0 2 32.44275 33.0 33.0 34.0 31.0 34.0 3 32.5125 33.0 33.0 34.0 31.0 34.0 4 32.45175 33.0 33.0 34.0 31.0 34.0 5 32.5555 33.0 33.0 34.0 32.0 34.0 6 36.562 38.0 38.0 38.0 34.0 38.0 7 36.43375 38.0 38.0 38.0 34.0 38.0 8 36.506 38.0 38.0 38.0 34.0 38.0 9 36.4855 38.0 38.0 38.0 34.0 38.0 10-14 36.4565 38.0 38.0 38.0 33.8 38.0 15-19 36.38815 38.0 38.0 38.0 33.6 38.0 20-24 36.174850000000006 38.0 38.0 38.0 32.2 38.0 25-29 36.266999999999996 38.0 38.0 38.0 33.2 38.0 30-34 36.2761 38.0 38.0 38.0 33.4 38.0 35-39 36.119299999999996 38.0 37.8 38.0 32.6 38.0 40-44 35.99665 38.0 37.0 38.0 31.4 38.0 45-49 35.75465 38.0 37.0 38.0 30.0 38.0 50-54 35.60205 38.0 37.0 38.0 29.2 38.0 55-59 35.8047 38.0 37.0 38.0 30.2 38.0 60-64 35.65565 38.0 37.0 38.0 29.4 38.0 65-69 35.563250000000004 38.0 37.0 38.0 29.0 38.0 70-74 35.4027 38.0 36.8 38.0 28.8 38.0 75-79 35.23745 38.0 36.2 38.0 28.0 38.0 80-84 35.2198 38.0 36.0 38.0 28.6 38.0 85-89 34.998 38.0 36.0 38.0 27.2 38.0 90-94 34.794799999999995 38.0 36.0 38.0 26.2 38.0 95-99 34.27995 38.0 34.8 38.0 22.6 38.0 100-104 34.148250000000004 38.0 34.2 38.0 23.2 38.0 105-109 34.13955 38.0 34.4 38.0 23.4 38.0 110-114 33.75575 38.0 34.0 38.0 19.8 38.0 115-119 33.15775 38.0 33.6 38.0 15.0 38.0 120-124 32.4634 37.2 31.8 38.0 15.0 38.0 125-129 31.787599999999998 37.0 30.6 38.0 15.0 38.0 130-134 30.850900000000003 35.8 28.6 38.0 13.2 38.0 135-139 30.11915 35.8 26.0 38.0 13.2 38.0 140-144 29.220550000000003 35.4 25.0 38.0 4.2 38.0 145-149 26.3726 33.0 12.4 38.0 2.0 38.0 150-151 20.9415 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 4.0 5 2.0 6 2.0 7 2.0 8 2.0 9 1.0 10 2.0 11 4.0 12 2.0 13 6.0 14 2.0 15 8.0 16 5.0 17 4.0 18 7.0 19 20.0 20 16.0 21 12.0 22 26.0 23 28.0 24 46.0 25 47.0 26 74.0 27 73.0 28 86.0 29 111.0 30 117.0 31 155.0 32 196.0 33 234.0 34 299.0 35 410.0 36 759.0 37 1225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.5 17.775 13.325000000000001 27.400000000000002 2 23.43085771442861 24.256064016004 36.03400850212553 16.27906976744186 3 20.38009502375594 25.731432858214554 33.28332083020755 20.605151287821954 4 23.53088272068017 35.20880220055014 21.880470117529384 19.379844961240313 5 22.655663915978995 38.33458364591148 21.655413853463365 17.35433858464616 6 18.275 38.975 24.6 18.15 7 17.025000000000002 15.25 45.9 21.825 8 19.650000000000002 20.474999999999998 28.375 31.5 9 20.955238809702426 24.381095273818453 29.732433108277068 24.93123280820205 10-14 22.223333500025003 28.764314647197082 27.679151872780917 21.333199979997 15-19 23.0 27.834999999999997 28.335 20.830000000000002 20-24 22.975 27.750000000000004 28.79 20.485 25-29 22.259999999999998 28.470000000000002 28.415000000000003 20.855 30-34 22.869999999999997 27.665 28.77 20.695 35-39 22.62113105655283 27.991399569978498 28.761438071903594 20.626031301565078 40-44 23.125 28.28 28.64 19.955000000000002 45-49 22.805 28.51 28.415000000000003 20.27 50-54 22.365 28.78 28.845 20.01 55-59 23.426171308565426 27.2063603180159 28.666433321666084 20.701035051752587 60-64 22.86 28.544999999999998 28.79 19.805 65-69 23.43 28.225 28.749999999999996 19.595000000000002 70-74 23.355 27.834999999999997 28.78 20.03 75-79 23.69 27.77 28.605000000000004 19.935 80-84 23.02730273027303 28.24282428242824 28.90789078907891 19.82198219821982 85-89 22.90114505725286 27.78638931946597 29.06145307265363 20.251012550627532 90-94 22.74 28.325 29.160000000000004 19.775000000000002 95-99 23.373506025903886 28.679301895284294 28.164224633695056 19.782967445116768 100-104 24.016004001000248 27.721930482620653 28.582145536384097 19.679919979995 105-109 23.74593648412103 27.7569392348087 28.86721680420105 19.629907476869217 110-114 23.48087021755439 27.84196049012253 29.077269317329336 19.599899974993747 115-119 24.586229311465573 27.69638481924096 27.886394319715986 19.83099154957748 120-124 24.647464746474647 27.61776177617762 28.65286528652865 19.08190819081908 125-129 24.815 27.935 27.92 19.33 130-134 25.045 28.185 27.73 19.040000000000003 135-139 25.115 27.625 28.000000000000004 19.259999999999998 140-144 25.185000000000002 27.67 27.79 19.355 145-149 26.13 28.08 27.265 18.525 150-151 25.887500000000003 28.3125 27.762500000000003 18.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 3.0 25 3.5 26 4.0 27 7.0 28 9.5 29 12.5 30 20.5 31 28.5 32 37.0 33 48.5 34 63.5 35 77.5 36 97.5 37 113.5 38 146.5 39 182.5 40 218.0 41 254.5 42 271.0 43 286.0 44 284.5 45 279.0 46 269.5 47 247.0 48 198.5 49 160.0 50 154.0 51 132.5 52 94.0 53 67.5 54 60.0 55 47.5 56 30.5 57 20.0 58 12.5 59 12.5 60 10.5 61 8.5 62 7.0 63 2.0 64 2.0 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.015 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3267152550892184 0.65 3 0.10052777079668257 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.9000000000000004 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.925000000000001 0.0 0.0 0.0 0.0 122-123 5.324999999999999 0.0 0.0 0.0 0.0 124-125 5.862500000000001 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.7 0.0 0.0 0.0 0.0 132-133 8.275 0.0 0.0 0.0 0.0 134-135 8.850000000000001 0.0 0.0 0.0 0.0 136-137 9.6 0.0 0.0 0.0 0.0 138-139 10.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCAC 10 0.006830828 145.0 4 AATCACT 20 3.5877043E-4 108.75 5 >>END_MODULE Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854801 spots for SRR7166199.sra Written 854801 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra Read 854788 spots for SRR7166199.sra Written 854788 spots for SRR7166199.sra SRR ids: ['SRR7166199.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y9zxnael SRR7166199.sra spots: 17095773 blocks: [[1, 854788], [854789, 1709576], [1709577, 2564364], [2564365, 3419152], [3419153, 4273940], [4273941, 5128728], [5128729, 5983516], [5983517, 6838304], [6838305, 7693092], [7693093, 8547880], [8547881, 9402668], [9402669, 10257456], [10257457, 11112244], [11112245, 11967032], [11967033, 12821820], [12821821, 13676608], [13676609, 14531396], [14531397, 15386184], [15386185, 16240972], [16240973, 17095773]] SRR7166199 file size 5771496 SRR7166199 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166199 SRR7166199_1.fastq SRR7166199_2.fastq Input file: SRR7166199_1.fastq Paired file: SRR7166199_2.fastq trimmed: SRR7166199-trimmed-pair1.fastq, SRR7166199-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 01:19:50 2025 >> started Sat Feb 15 01:20:09 2025 >> done (18.964s) 17095773 read pairs processed; of these: 21843 ( 0.13%) short read pairs filtered out after trimming by size control 19250 ( 0.11%) empty read pairs filtered out after trimming by size control 17054680 (99.76%) read pairs available; of these: 11767230 (69.00%) trimmed read pairs available after processing 5287450 (31.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 10 0.00% 21 5 0.00% 22 12 0.00% 23 13 0.00% 24 10 0.00% 25 9 0.00% 26 10 0.00% 27 3 0.00% 28 18 0.00% 29 13 0.00% 30 8 0.00% 31 6 0.00% 32 10 0.00% 33 23 0.00% 34 22 0.00% 35 17 0.00% 36 29 0.00% 37 22 0.00% 38 21 0.00% 39 27 0.00% 40 36 0.00% 41 30 0.00% 42 36 0.00% 43 56 0.00% 44 55 0.00% 45 56 0.00% 46 46 0.00% 47 65 0.00% 48 78 0.00% 49 108 0.00% 50 114 0.00% 51 129 0.00% 52 120 0.00% 53 156 0.00% 54 169 0.00% 55 242 0.00% 56 229 0.00% 57 275 0.00% 58 312 0.00% 59 369 0.00% 60 444 0.00% 61 476 0.00% 62 502 0.00% 63 608 0.00% 64 635 0.00% 65 763 0.00% 66 820 0.00% 67 966 0.01% 68 1033 0.01% 69 1238 0.01% 70 1383 0.01% 71 1641 0.01% 72 1912 0.01% 73 2215 0.01% 74 2314 0.01% 75 2680 0.02% 76 2846 0.02% 77 3144 0.02% 78 3487 0.02% 79 3927 0.02% 80 4456 0.03% 81 5137 0.03% 82 5866 0.03% 83 6692 0.04% 84 8002 0.05% 85 8802 0.05% 86 9163 0.05% 87 10025 0.06% 88 10664 0.06% 89 11368 0.07% 90 12262 0.07% 91 13344 0.08% 92 14792 0.09% 93 15996 0.09% 94 17056 0.10% 95 17792 0.10% 96 18726 0.11% 97 19596 0.11% 98 20178 0.12% 99 22024 0.13% 100 23763 0.14% 101 25141 0.15% 102 26420 0.15% 103 28338 0.17% 104 29994 0.18% 105 31688 0.19% 106 32214 0.19% 107 33001 0.19% 108 34001 0.20% 109 36064 0.21% 110 37703 0.22% 111 40299 0.24% 112 42446 0.25% 113 45314 0.27% 114 48503 0.28% 115 50507 0.30% 116 51812 0.30% 117 54174 0.32% 118 56007 0.33% 119 58250 0.34% 120 60406 0.35% 121 63636 0.37% 122 66302 0.39% 123 70554 0.41% 124 75532 0.44% 125 79318 0.47% 126 83252 0.49% 127 86689 0.51% 128 90553 0.53% 129 94683 0.56% 130 99472 0.58% 131 106011 0.62% 132 113043 0.66% 133 122076 0.72% 134 130839 0.77% 135 142245 0.83% 136 148257 0.87% 137 154707 0.91% 138 166704 0.98% 139 183736 1.08% 140 206885 1.21% 141 204297 1.20% 142 224703 1.32% 143 249526 1.46% 144 289283 1.70% 145 345912 2.03% 146 431833 2.53% 147 567038 3.32% 148 776845 4.56% 149 1331998 7.81% 150 3927296 23.03% 151 5287450 31.00% 17054680 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=18 prefix-density=0.40 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=26.47 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.2 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=26.23 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7166199 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 01:21:27 Started mapping on | Feb 15 01:21:28 Finished on | Feb 15 01:23:44 Mapping speed, Million of reads per hour | 451.45 Number of input reads | 17054680 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15845613 Uniquely mapped reads % | 92.91% Average mapped length | 287.72 Number of splices: Total | 14802522 Number of splices: Annotated (sjdb) | 14492026 Number of splices: GT/AG | 14556755 Number of splices: GC/AG | 190785 Number of splices: AT/AC | 11905 Number of splices: Non-canonical | 43077 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390216 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 33183 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 839578 839578 839578 N_multimapping 390216 390216 390216 N_noFeature 653055 15599203 815213 N_ambiguous 168985 1053 84017 UnstrandedReadsAssigned:15023573 PositiveStrandReadsAssigned:245357 NegativeStrandReadsAssigned:14946383 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7166199 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166199-trimmed-pair1.fastq SRR7166199-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,054,680 reads, 14,892,908 reads pseudoaligned [quant] estimated average fragment length: 226.617 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7166199.ke.tsv 34699 SRR7166199.se.tsv 87100 total ==> SRR7166199.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.38 1297.51 49.2592 Potri.005G024800.1.v4.1 1035 809.383 379 31.8635 Potri.004G059700.1.v4.1 961 735.383 37 3.42371 Potri.007G009000.2.v4.1 1416 1190.38 0 0 Potri.003G141000.2.v4.1 2943 2717.38 600.396 15.0347 Potri.016G087400.1.v4.1 270 90.6236 1125.64 845.218 Potri.015G069301.1.v4.1 564 342.861 0 0 Potri.010G195200.1.v4.1 1773 1547.38 575 25.2859 Potri.012G127500.1.v4.1 977 751.383 9585 868.039 ==> SRR7166199.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 572 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 479 SRR7166199 completed mapping pipeline successfully