Starting /dee2/code/volunteer_pipeline.sh SRR7166200 current disk space = 3104330391552 free memory = 1577705856 SRR7166200 SRAfilesize e696f12f4180004855b0dfd4004e9a62 SRR7166200.sra SRR7166200.sra file validated SRR7166200 is paired end SRR7166200 is conventional basespace SRR7166200 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166200_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4695 33.0 32.0 34.0 27.0 34.0 2 31.983 33.0 31.0 34.0 28.0 34.0 3 31.8475 33.0 31.0 34.0 28.0 34.0 4 32.143 33.0 32.0 34.0 30.0 34.0 5 32.231 33.0 33.0 34.0 30.0 34.0 6 36.4475 38.0 37.0 38.0 34.0 38.0 7 36.8275 38.0 37.0 38.0 35.0 38.0 8 36.92225 38.0 38.0 38.0 35.0 38.0 9 36.896 38.0 38.0 38.0 35.0 38.0 10-14 36.760749999999994 38.0 38.0 38.0 34.6 38.0 15-19 36.680899999999994 38.0 38.0 38.0 34.2 38.0 20-24 36.79585 38.0 38.0 38.0 34.8 38.0 25-29 36.52300000000001 38.0 38.0 38.0 34.0 38.0 30-34 36.379549999999995 38.0 37.6 38.0 33.4 38.0 35-39 36.2098 38.0 37.0 38.0 33.0 38.0 40-44 36.139300000000006 38.0 37.0 38.0 31.6 38.0 45-49 36.0569 38.0 37.0 38.0 31.2 38.0 50-54 35.94725 38.0 37.0 38.0 31.4 38.0 55-59 35.84135 38.0 37.0 38.0 30.2 38.0 60-64 35.61025 38.0 36.4 38.0 29.0 38.0 65-69 35.67305 38.0 36.6 38.0 29.0 38.0 70-74 35.496950000000005 38.0 36.0 38.0 29.0 38.0 75-79 34.6911 38.0 35.8 38.0 26.8 38.0 80-84 34.4156 38.0 35.4 38.0 25.6 38.0 85-89 34.4944 38.0 34.6 38.0 25.8 38.0 90-94 34.9062 38.0 35.6 38.0 27.2 38.0 95-99 34.10045 38.0 34.2 38.0 21.0 38.0 100-104 33.738800000000005 38.0 33.8 38.0 19.8 38.0 105-109 33.531150000000004 37.4 33.4 38.0 17.8 38.0 110-114 32.54175 37.0 31.0 38.0 15.0 38.0 115-119 32.8504 37.0 31.4 38.0 15.0 38.0 120-124 32.026300000000006 36.8 30.0 38.0 15.0 38.0 125-129 31.849399999999996 36.6 30.4 38.0 15.0 38.0 130-134 30.427249999999997 35.4 25.8 38.0 14.0 38.0 135-139 29.204150000000006 33.8 23.4 38.0 13.2 38.0 140-144 27.86315 33.8 20.0 38.0 2.0 38.0 145-149 26.246199999999998 33.0 11.6 38.0 2.0 38.0 150-151 20.583875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 3.0 11 2.0 12 0.0 13 2.0 14 2.0 15 1.0 16 5.0 17 5.0 18 6.0 19 8.0 20 14.0 21 19.0 22 27.0 23 30.0 24 44.0 25 60.0 26 70.0 27 100.0 28 111.0 29 107.0 30 151.0 31 200.0 32 215.0 33 283.0 34 360.0 35 522.0 36 873.0 37 778.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.60010149708196 17.026135498604415 12.357269728495305 35.01649327581832 2 19.25 25.124999999999996 38.15 17.474999999999998 3 17.224999999999998 31.574999999999996 27.525 23.674999999999997 4 21.8 36.775000000000006 22.650000000000002 18.775 5 21.175 37.2 23.175 18.45 6 15.775 36.825 26.0 21.4 7 12.55 19.775000000000002 47.599999999999994 20.075000000000003 8 18.5 21.0 27.35 33.15 9 17.775 23.05 30.75 28.425 10-14 19.259999999999998 30.095 26.76 23.885 15-19 19.205 29.225 27.800000000000004 23.77 20-24 19.395 29.020000000000003 28.035 23.549999999999997 25-29 19.725 29.73 27.595 22.95 30-34 19.255 29.805 27.79 23.150000000000002 35-39 19.89 29.349999999999998 27.82 22.939999999999998 40-44 19.5 29.39 28.28 22.830000000000002 45-49 19.71 28.854999999999997 27.800000000000004 23.635 50-54 19.85 28.73 27.800000000000004 23.62 55-59 19.470000000000002 29.37 28.165000000000003 22.994999999999997 60-64 19.78 29.404999999999998 27.88 22.935 65-69 19.73 28.58 28.09 23.599999999999998 70-74 19.083625438157238 29.25388082123185 28.262393590385575 23.400100150225338 75-79 19.67764969907171 29.067632357441596 27.85881872896052 23.395899214526167 80-84 19.6329993866285 28.910243304027805 28.199754651400532 23.25700265794316 85-89 19.6 28.705000000000002 28.549999999999997 23.145 90-94 19.384999999999998 29.189999999999998 28.294999999999998 23.13 95-99 20.53 28.349999999999998 27.839999999999996 23.28 100-104 19.445 29.220000000000002 27.395000000000003 23.94 105-109 20.34 28.73 27.79 23.14 110-114 20.21 28.389999999999997 27.634999999999998 23.765 115-119 19.56 28.825 27.96 23.655 120-124 20.436130839251774 28.92367710313094 27.508252475742722 23.131939581874562 125-129 20.298343094558742 28.57285878760575 27.676828352605497 23.451969765230015 130-134 20.622568093385212 28.525948759411797 27.434433271009144 23.417049876193847 135-139 20.372409650615676 28.711582741015118 26.764440884973475 24.151566723395735 140-144 20.406121836550966 28.108432529758925 27.648294488346504 23.8371511453436 145-149 19.89169132026275 29.002657574086143 27.006969864112722 24.098681241538383 150-151 20.896456742206084 27.331914360836358 27.657443345436334 24.11418555152122 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 4.5 24 6.5 25 6.0 26 8.5 27 10.0 28 16.5 29 19.5 30 20.5 31 34.0 32 50.5 33 68.0 34 80.5 35 88.0 36 106.5 37 128.0 38 157.0 39 186.5 40 220.0 41 248.5 42 251.0 43 262.0 44 255.0 45 245.0 46 254.5 47 244.5 48 218.0 49 187.5 50 155.5 51 117.5 52 83.5 53 68.5 54 55.0 55 37.0 56 28.0 57 21.5 58 12.5 59 5.5 60 7.0 61 6.0 62 2.5 63 3.0 64 2.5 65 1.5 66 3.0 67 2.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.15 75-79 1.97 80-84 2.18 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.11499999999999999 130-134 1.055 135-139 0.11 140-144 0.03 145-149 0.28500000000000003 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.612500000000001 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.5625 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAACT 10 0.006910676 144.4375 2 GAATTGA 10 0.006910676 144.4375 4 >>END_MODULE SRR7166200 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166200_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40875 33.0 33.0 34.0 31.0 34.0 2 32.47875 33.0 33.0 34.0 31.0 34.0 3 32.4565 33.0 33.0 34.0 31.0 34.0 4 32.4395 33.0 33.0 34.0 31.0 34.0 5 32.483 33.0 33.0 34.0 32.0 34.0 6 36.42625 38.0 38.0 38.0 33.0 38.0 7 36.5645 38.0 38.0 38.0 34.0 38.0 8 36.45575 38.0 38.0 38.0 34.0 38.0 9 36.46975 38.0 38.0 38.0 34.0 38.0 10-14 36.35535 38.0 38.0 38.0 33.2 38.0 15-19 36.29715 38.0 38.0 38.0 33.0 38.0 20-24 36.17775 38.0 38.0 38.0 32.8 38.0 25-29 36.2668 38.0 38.0 38.0 33.4 38.0 30-34 36.2788 38.0 38.0 38.0 33.0 38.0 35-39 36.1047 38.0 37.8 38.0 32.2 38.0 40-44 35.87585 38.0 37.0 38.0 30.4 38.0 45-49 35.8072 38.0 37.0 38.0 30.0 38.0 50-54 35.64855 38.0 37.0 38.0 29.4 38.0 55-59 35.76565 38.0 37.0 38.0 30.0 38.0 60-64 35.578649999999996 38.0 36.8 38.0 29.6 38.0 65-69 35.52545 38.0 37.0 38.0 29.0 38.0 70-74 35.36295 38.0 36.6 38.0 28.8 38.0 75-79 35.26095 38.0 36.2 38.0 28.4 38.0 80-84 35.30115 38.0 36.8 38.0 29.0 38.0 85-89 34.981700000000004 38.0 36.0 38.0 27.0 38.0 90-94 34.7968 38.0 36.0 38.0 26.0 38.0 95-99 34.2945 38.0 34.8 38.0 22.4 38.0 100-104 34.15115 38.0 34.8 38.0 23.4 38.0 105-109 34.17960000000001 38.0 34.8 38.0 23.4 38.0 110-114 33.8123 38.0 34.0 38.0 20.6 38.0 115-119 33.383950000000006 38.0 33.8 38.0 17.4 38.0 120-124 32.740399999999994 38.0 32.8 38.0 15.0 38.0 125-129 32.02864999999999 37.0 31.0 38.0 15.0 38.0 130-134 31.1863 36.6 29.6 38.0 13.6 38.0 135-139 30.28345 36.0 27.2 38.0 13.2 38.0 140-144 29.507749999999998 35.8 26.0 38.0 4.2 38.0 145-149 27.196199999999997 33.4 17.0 38.0 2.0 38.0 150-151 21.80125 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 3.0 5 3.0 6 1.0 7 3.0 8 0.0 9 1.0 10 1.0 11 4.0 12 4.0 13 6.0 14 5.0 15 9.0 16 3.0 17 11.0 18 15.0 19 4.0 20 17.0 21 20.0 22 30.0 23 32.0 24 45.0 25 54.0 26 76.0 27 49.0 28 85.0 29 88.0 30 111.0 31 128.0 32 175.0 33 230.0 34 285.0 35 401.0 36 780.0 37 1306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.074999999999996 14.649999999999999 16.175 31.1 2 23.736868434217108 24.937468734367183 35.56778389194598 15.757878939469736 3 20.080020005001252 27.831957989497376 31.707926981745437 20.38009502375594 4 22.116587440580435 36.42732049036778 22.191643732799598 19.264448336252187 5 22.811405702851424 38.06903451725863 22.236118059029515 16.883441720860432 6 17.45 38.2 26.1 18.25 7 16.975 15.325 47.75 19.950000000000003 8 21.005251312828207 21.605401350337583 27.506876719179797 29.882470617654416 9 21.085542771385693 23.761880940470235 28.639319659829916 26.513256628314156 10-14 22.545636409102276 29.097274318579647 27.47686921730433 20.880220055013755 15-19 22.076103805190257 28.511425571278565 28.366418320916047 21.04605230261513 20-24 22.13 29.235 28.37 20.265 25-29 22.400000000000002 27.87 29.435 20.294999999999998 30-34 22.57 28.360000000000003 28.945 20.125 35-39 22.489497899579916 28.240648129625924 28.595719143828767 20.674134826965393 40-44 22.855 28.055000000000003 28.73 20.36 45-49 22.86 28.265 29.125 19.75 50-54 22.32 28.265 29.075 20.34 55-59 23.141157057852894 27.91139556977849 28.931446572328618 20.01600080004 60-64 22.625 27.810000000000002 28.945 20.62 65-69 23.53 28.175 28.749999999999996 19.545 70-74 22.99 28.365000000000002 28.660000000000004 19.985 75-79 23.015 28.660000000000004 28.565 19.759999999999998 80-84 22.940735183795947 27.89697424356089 28.91722930732683 20.24506126531633 85-89 23.44617230861543 27.521376068803438 28.941447072353615 20.091004550227513 90-94 23.213482022303346 28.3842576386458 28.919337900685104 19.482922438365755 95-99 22.427849747411592 28.600010003501225 28.6600310108538 20.31210923823338 100-104 23.300145094311304 27.59293540801521 28.703657377295244 20.403262120378248 105-109 23.60270202651989 27.74080560420315 28.596447335501622 20.06004503377533 110-114 23.18739054290718 27.94095571678759 28.89166875156367 19.979984988741556 115-119 23.84215264579374 27.96338901670501 28.513554066219864 19.680904271281385 120-124 23.78356753513027 27.89418412761914 28.539280892133824 19.782967445116768 125-129 24.13 28.28 28.389999999999997 19.2 130-134 24.305 28.54 28.04 19.115 135-139 24.279999999999998 28.595 28.115000000000002 19.009999999999998 140-144 24.610000000000003 27.97 28.52 18.9 145-149 24.92 28.405 27.825 18.85 150-151 25.4375 28.449999999999996 27.8625 18.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 2.0 21 1.5 22 1.5 23 3.5 24 3.5 25 5.0 26 8.0 27 10.5 28 12.5 29 14.0 30 19.0 31 30.5 32 37.5 33 46.0 34 60.0 35 86.5 36 110.5 37 132.0 38 170.5 39 200.5 40 216.5 41 219.0 42 240.0 43 265.5 44 279.0 45 288.5 46 273.5 47 232.5 48 207.0 49 197.0 50 160.0 51 120.0 52 99.0 53 74.5 54 49.0 55 35.5 56 22.5 57 14.0 58 10.0 59 11.0 60 8.0 61 3.0 62 4.0 63 3.0 64 2.0 65 1.5 66 0.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.025 4 0.075 5 0.05 6 0.0 7 0.0 8 0.025 9 0.05 10-14 0.025 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.025 85-89 0.005 90-94 0.015 95-99 0.034999999999999996 100-104 0.065 105-109 0.075 110-114 0.075 115-119 0.03 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 2.0374999999999996 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.4125 0.0 0.0 0.0 0.0 120-121 3.7874999999999996 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.5875 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.8 0.0 0.0 0.0 0.0 132-133 6.325 0.0 0.0 0.0 0.0 134-135 6.8375 0.0 0.0 0.0 0.0 136-137 7.325 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTCC 10 0.006830828 145.0 3 TGCCACT 10 0.006830828 145.0 7 >>END_MODULE Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956358 spots for SRR7166200.sra Written 956358 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra Read 956352 spots for SRR7166200.sra Written 956352 spots for SRR7166200.sra SRR ids: ['SRR7166200.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_98ojz84b SRR7166200.sra spots: 19127046 blocks: [[1, 956352], [956353, 1912704], [1912705, 2869056], [2869057, 3825408], [3825409, 4781760], [4781761, 5738112], [5738113, 6694464], [6694465, 7650816], [7650817, 8607168], [8607169, 9563520], [9563521, 10519872], [10519873, 11476224], [11476225, 12432576], [12432577, 13388928], [13388929, 14345280], [14345281, 15301632], [15301633, 16257984], [16257985, 17214336], [17214337, 18170688], [18170689, 19127046]] SRR7166200 file size 6459827 SRR7166200 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166200 SRR7166200_1.fastq SRR7166200_2.fastq Input file: SRR7166200_1.fastq Paired file: SRR7166200_2.fastq trimmed: SRR7166200-trimmed-pair1.fastq, SRR7166200-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 01:32:52 2025 >> started Sat Feb 15 01:33:12 2025 >> done (20.374s) 19127046 read pairs processed; of these: 22557 ( 0.12%) short read pairs filtered out after trimming by size control 21987 ( 0.11%) empty read pairs filtered out after trimming by size control 19082502 (99.77%) read pairs available; of these: 12516394 (65.59%) trimmed read pairs available after processing 6566108 (34.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 12 0.00% 21 6 0.00% 22 7 0.00% 23 9 0.00% 24 11 0.00% 25 13 0.00% 26 17 0.00% 27 9 0.00% 28 9 0.00% 29 15 0.00% 30 14 0.00% 31 6 0.00% 32 12 0.00% 33 20 0.00% 34 19 0.00% 35 16 0.00% 36 16 0.00% 37 19 0.00% 38 21 0.00% 39 32 0.00% 40 22 0.00% 41 28 0.00% 42 22 0.00% 43 29 0.00% 44 41 0.00% 45 39 0.00% 46 48 0.00% 47 62 0.00% 48 67 0.00% 49 95 0.00% 50 88 0.00% 51 96 0.00% 52 102 0.00% 53 118 0.00% 54 128 0.00% 55 165 0.00% 56 179 0.00% 57 219 0.00% 58 245 0.00% 59 317 0.00% 60 310 0.00% 61 401 0.00% 62 437 0.00% 63 476 0.00% 64 557 0.00% 65 600 0.00% 66 680 0.00% 67 775 0.00% 68 929 0.00% 69 998 0.01% 70 1147 0.01% 71 1456 0.01% 72 1519 0.01% 73 1830 0.01% 74 1981 0.01% 75 2265 0.01% 76 2431 0.01% 77 2746 0.01% 78 2993 0.02% 79 3417 0.02% 80 3920 0.02% 81 4492 0.02% 82 5150 0.03% 83 5526 0.03% 84 7070 0.04% 85 7842 0.04% 86 8359 0.04% 87 8759 0.05% 88 9372 0.05% 89 10015 0.05% 90 10890 0.06% 91 12054 0.06% 92 12861 0.07% 93 13735 0.07% 94 14763 0.08% 95 15610 0.08% 96 16586 0.09% 97 17361 0.09% 98 18220 0.10% 99 19078 0.10% 100 20614 0.11% 101 22054 0.12% 102 23378 0.12% 103 24859 0.13% 104 26309 0.14% 105 28189 0.15% 106 29090 0.15% 107 30494 0.16% 108 31805 0.17% 109 33114 0.17% 110 35260 0.18% 111 37234 0.20% 112 40173 0.21% 113 42494 0.22% 114 45084 0.24% 115 47251 0.25% 116 48978 0.26% 117 50925 0.27% 118 52887 0.28% 119 54772 0.29% 120 57620 0.30% 121 60447 0.32% 122 64148 0.34% 123 68409 0.36% 124 72730 0.38% 125 77390 0.41% 126 81015 0.42% 127 85040 0.45% 128 88470 0.46% 129 94110 0.49% 130 99008 0.52% 131 105376 0.55% 132 112815 0.59% 133 121173 0.63% 134 129754 0.68% 135 141049 0.74% 136 149144 0.78% 137 155923 0.82% 138 168257 0.88% 139 185676 0.97% 140 210839 1.10% 141 207313 1.09% 142 229538 1.20% 143 253884 1.33% 144 296937 1.56% 145 355770 1.86% 146 448642 2.35% 147 593818 3.11% 148 823629 4.32% 149 1447514 7.59% 150 4553979 23.86% 151 6566108 34.41% 19082502 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=35.45 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.9 sequence=ACAGCAAATACCAGCGGCCCTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTGCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTTCTTGGTACCTATTCCTCCAGGAATTACTGACCATAGTGCTCGTACGCTAGTCTAGCCTAGTAAAACCACGATCAGCCGACGGTCTGGATGCCGACGCCCG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=37 prefix-density=0.37 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=89.29 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.5 sequence=TTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166200 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 01:34:33 Started mapping on | Feb 15 01:34:33 Finished on | Feb 15 01:37:21 Mapping speed, Million of reads per hour | 408.91 Number of input reads | 19082502 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17595856 Uniquely mapped reads % | 92.21% Average mapped length | 289.57 Number of splices: Total | 15611800 Number of splices: Annotated (sjdb) | 15241455 Number of splices: GT/AG | 15333618 Number of splices: GC/AG | 210983 Number of splices: AT/AC | 13602 Number of splices: Non-canonical | 53597 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510345 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 44750 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 998552 998552 998552 N_multimapping 510345 510345 510345 N_noFeature 792848 17346994 958820 N_ambiguous 198273 1902 113925 UnstrandedReadsAssigned:16604735 PositiveStrandReadsAssigned:246960 NegativeStrandReadsAssigned:16523111 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7166200 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166200-trimmed-pair1.fastq SRR7166200-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,082,502 reads, 16,490,013 reads pseudoaligned [quant] estimated average fragment length: 240.441 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR7166200.ke.tsv 34699 SRR7166200.se.tsv 87100 total ==> SRR7166200.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.56 2924 105.149 Potri.005G024800.1.v4.1 1035 795.559 682 54.8287 Potri.004G059700.1.v4.1 961 721.58 18 1.59545 Potri.007G009000.2.v4.1 1416 1176.56 0 0 Potri.003G141000.2.v4.1 2943 2703.56 660.264 15.6199 Potri.016G087400.1.v4.1 270 84.8305 598 450.863 Potri.015G069301.1.v4.1 564 330.402 0 0 Potri.010G195200.1.v4.1 1773 1533.56 731.921 30.5253 Potri.012G127500.1.v4.1 977 737.574 16258 1409.8 ==> SRR7166200.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 482 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 651 SRR7166200 completed mapping pipeline successfully