Starting /dee2/code/volunteer_pipeline.sh SRR7166201 current disk space = 3104356499456 free memory = 1293778100 SRR7166201 SRAfilesize 3e0fdb89a18911f695b27c43449ce511 SRR7166201.sra SRR7166201.sra file validated SRR7166201 is paired end SRR7166201 is conventional basespace SRR7166201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7555 33.0 32.0 34.0 30.0 34.0 2 32.09 33.0 33.0 34.0 29.0 34.0 3 32.3095 33.0 33.0 34.0 29.0 34.0 4 32.1785 33.0 33.0 34.0 29.0 34.0 5 32.20625 33.0 33.0 34.0 31.0 34.0 6 36.61225 38.0 37.0 38.0 34.0 38.0 7 36.9515 38.0 38.0 38.0 35.0 38.0 8 37.14375 38.0 38.0 38.0 36.0 38.0 9 36.828 38.0 38.0 38.0 35.0 38.0 10-14 37.0727 38.0 38.0 38.0 35.8 38.0 15-19 37.111749999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.11155 38.0 38.0 38.0 36.0 38.0 25-29 36.8656 38.0 38.0 38.0 35.0 38.0 30-34 36.39445 38.0 37.4 38.0 33.6 38.0 35-39 36.362249999999996 38.0 37.2 38.0 33.2 38.0 40-44 36.2592 38.0 37.0 38.0 33.0 38.0 45-49 36.08265 38.0 37.0 38.0 32.2 38.0 50-54 35.741400000000006 38.0 36.6 38.0 30.2 38.0 55-59 35.6448 38.0 36.2 38.0 29.6 38.0 60-64 35.440099999999994 38.0 36.0 38.0 28.8 38.0 65-69 35.54275 38.0 36.0 38.0 29.4 38.0 70-74 35.379599999999996 38.0 36.2 38.0 29.2 38.0 75-79 34.54875 38.0 35.8 38.0 26.0 38.0 80-84 34.249900000000004 38.0 35.0 38.0 25.2 38.0 85-89 34.32505 38.0 34.2 38.0 25.0 38.0 90-94 34.55575 38.0 34.6 38.0 26.0 38.0 95-99 34.28625 38.0 34.4 38.0 24.8 38.0 100-104 33.74594999999999 37.8 33.8 38.0 18.6 38.0 105-109 33.19175 37.4 32.6 38.0 17.8 38.0 110-114 32.377399999999994 37.0 30.6 38.0 15.0 38.0 115-119 32.326699999999995 37.0 31.0 38.0 15.0 38.0 120-124 31.666549999999994 36.4 29.6 38.0 15.0 38.0 125-129 30.393349999999998 35.2 25.6 38.0 14.4 38.0 130-134 28.721350000000008 33.6 23.0 38.0 13.0 38.0 135-139 27.523149999999998 33.0 19.6 38.0 6.4 38.0 140-144 26.399900000000002 33.0 14.0 38.0 2.0 38.0 145-149 24.076750000000004 31.8 6.4 38.0 2.0 38.0 150-151 18.2845 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 5.0 15 6.0 16 2.0 17 5.0 18 7.0 19 10.0 20 9.0 21 22.0 22 25.0 23 36.0 24 52.0 25 60.0 26 68.0 27 91.0 28 113.0 29 138.0 30 139.0 31 208.0 32 252.0 33 369.0 34 476.0 35 661.0 36 855.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.322744599745874 17.35705209656925 9.682337992376112 34.63786531130877 2 18.975 25.575 37.775 17.675 3 16.675 30.8 27.150000000000002 25.374999999999996 4 21.675 37.7 20.875 19.75 5 19.7 37.8 23.925 18.575 6 15.024999999999999 36.875 25.825 22.275 7 12.475 20.424999999999997 45.95 21.15 8 17.8 20.200000000000003 29.475 32.525 9 17.8 21.099999999999998 30.45 30.65 10-14 19.08 30.104999999999997 26.55 24.265 15-19 19.375 29.04 27.639999999999997 23.945 20-24 20.035 29.065 27.42 23.48 25-29 19.84 28.884999999999998 28.33 22.945 30-34 19.075 28.939999999999998 28.660000000000004 23.325000000000003 35-39 19.54 29.095 27.265 24.099999999999998 40-44 19.62 29.755 27.61 23.015 45-49 19.595000000000002 29.65 27.48 23.275000000000002 50-54 19.82 29.015 27.925 23.24 55-59 19.945 28.98 28.07 23.005 60-64 19.43 28.599999999999998 28.610000000000003 23.36 65-69 19.64 28.89 28.505000000000003 22.965 70-74 19.724241664577587 29.110052644773127 27.676109300576584 23.489596390072702 75-79 19.976486223994275 28.18074937381792 28.328988396462712 23.51377600572509 80-84 20.137464095199014 28.903364792778007 27.70824784571194 23.250923266311037 85-89 19.479869967491872 28.862215553888472 28.032008002000502 23.625906476619154 90-94 19.80396079215843 28.765753150630125 27.91058211642328 23.51970394078816 95-99 19.825 28.24 28.82 23.115 100-104 19.55 29.49 27.939999999999998 23.02 105-109 19.869999999999997 28.42 27.935 23.775 110-114 20.235 28.48 27.605 23.68 115-119 20.375 28.389999999999997 27.794999999999998 23.44 120-124 20.0490711531721 28.270992939762657 27.94051374493015 23.739422162135096 125-129 20.522856139294497 28.922675498017963 26.870389884088514 23.684078478599027 130-134 20.123318385650222 29.601508357113737 26.880350591112922 23.394822666123112 135-139 20.86157553848471 28.764372144399257 26.976954360596476 23.397097956519556 140-144 20.52 28.16 27.650000000000002 23.669999999999998 145-149 21.110491919550128 28.132124221085164 26.870662140939256 23.886721718425452 150-151 21.45632284747462 26.995864143376362 26.70760746960772 24.840205539541298 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 5.0 25 7.0 26 7.0 27 7.5 28 12.5 29 17.0 30 26.0 31 35.0 32 44.0 33 57.0 34 69.5 35 89.5 36 110.0 37 119.0 38 144.5 39 183.5 40 214.5 41 228.5 42 253.0 43 281.5 44 283.5 45 275.0 46 255.0 47 228.0 48 219.5 49 195.0 50 147.0 51 125.0 52 104.0 53 72.0 54 49.0 55 40.5 56 26.5 57 17.5 58 13.5 59 6.0 60 4.0 61 5.0 62 4.0 63 3.0 64 2.5 65 2.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.27499999999999997 75-79 2.185 80-84 2.52 85-89 0.025 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.145 125-129 0.35500000000000004 130-134 1.8800000000000001 135-139 0.415 140-144 0.0 145-149 1.3050000000000002 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.2625 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.675000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62625 33.0 33.0 34.0 32.0 34.0 2 32.66625 33.0 33.0 34.0 32.0 34.0 3 32.63275 33.0 33.0 34.0 32.0 34.0 4 32.60075 33.0 33.0 34.0 32.0 34.0 5 32.711 33.0 33.0 34.0 32.0 34.0 6 36.79225 38.0 38.0 38.0 35.0 38.0 7 36.79375 38.0 38.0 38.0 35.0 38.0 8 36.7705 38.0 38.0 38.0 35.0 38.0 9 36.70575 38.0 38.0 38.0 35.0 38.0 10-14 36.56385 38.0 38.0 38.0 34.8 38.0 15-19 36.3569 38.0 38.0 38.0 33.8 38.0 20-24 36.3817 38.0 38.0 38.0 33.8 38.0 25-29 36.47355 38.0 38.0 38.0 34.0 38.0 30-34 36.48835 38.0 38.0 38.0 34.0 38.0 35-39 36.08829999999999 38.0 38.0 38.0 33.0 38.0 40-44 36.09935 38.0 38.0 38.0 33.0 38.0 45-49 35.818149999999996 38.0 37.2 38.0 31.0 38.0 50-54 35.8626 38.0 37.4 38.0 31.4 38.0 55-59 35.859300000000005 38.0 37.2 38.0 31.4 38.0 60-64 35.8168 38.0 37.2 38.0 31.8 38.0 65-69 35.5968 38.0 37.0 38.0 30.2 38.0 70-74 35.5883 38.0 37.0 38.0 29.8 38.0 75-79 35.32735 38.0 36.6 38.0 29.2 38.0 80-84 35.247550000000004 38.0 36.4 38.0 28.6 38.0 85-89 35.242000000000004 38.0 36.6 38.0 28.8 38.0 90-94 35.22395 38.0 36.2 38.0 28.8 38.0 95-99 34.8909 38.0 36.0 38.0 27.0 38.0 100-104 34.48655 38.0 35.0 38.0 24.8 38.0 105-109 34.455149999999996 38.0 34.8 38.0 25.2 38.0 110-114 33.90305 38.0 34.0 38.0 21.4 38.0 115-119 33.6995 38.0 34.2 38.0 17.8 38.0 120-124 32.914049999999996 37.8 32.6 38.0 15.0 38.0 125-129 31.800850000000004 37.0 30.6 38.0 14.8 38.0 130-134 31.00865 36.0 28.6 38.0 13.8 38.0 135-139 30.3202 36.0 27.2 38.0 13.0 38.0 140-144 29.06775 35.4 24.4 38.0 3.8 38.0 145-149 27.15645 33.8 16.2 38.0 2.0 38.0 150-151 21.455875 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 10.0 4 1.0 5 1.0 6 3.0 7 3.0 8 2.0 9 4.0 10 5.0 11 3.0 12 2.0 13 0.0 14 4.0 15 1.0 16 6.0 17 12.0 18 14.0 19 17.0 20 13.0 21 20.0 22 25.0 23 26.0 24 44.0 25 35.0 26 49.0 27 63.0 28 68.0 29 81.0 30 113.0 31 126.0 32 164.0 33 234.0 34 300.0 35 455.0 36 847.0 37 1242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.025 15.125 13.325000000000001 30.525000000000002 2 21.325 24.4 38.0 16.275000000000002 3 19.950000000000003 26.025 32.425 21.6 4 23.375 34.575 22.7 19.35 5 23.9 38.125 21.775 16.2 6 17.275 39.050000000000004 25.1 18.575 7 16.125 15.5 47.099999999999994 21.275 8 19.775000000000002 21.349999999999998 28.475 30.4 9 22.650000000000002 24.025 29.775000000000002 23.549999999999997 10-14 22.55 29.304999999999996 27.125 21.02 15-19 22.720000000000002 28.000000000000004 28.53 20.75 20-24 22.965 28.95 27.939999999999998 20.145 25-29 22.895 28.884999999999998 28.415000000000003 19.805 30-34 22.53 28.360000000000003 28.655 20.455000000000002 35-39 22.81 28.655 28.27 20.265 40-44 23.200000000000003 27.855 28.98 19.965 45-49 23.005 28.389999999999997 28.455000000000002 20.150000000000002 50-54 22.665 28.405 28.53 20.4 55-59 22.985 28.535 28.060000000000002 20.419999999999998 60-64 22.93 28.425 28.485 20.16 65-69 23.02 27.99 28.63 20.36 70-74 23.645 27.855 27.915 20.585 75-79 23.064999999999998 28.645 28.055000000000003 20.235 80-84 22.805 28.03 28.9 20.265 85-89 23.655 27.405 28.46 20.48 90-94 23.29 27.98 28.689999999999998 20.04 95-99 23.325000000000003 28.185 28.475 20.015 100-104 23.400000000000002 27.750000000000004 28.835 20.015 105-109 23.205000000000002 27.765 28.595 20.435 110-114 23.29 28.235 28.405 20.07 115-119 23.294999999999998 27.985 28.59 20.13 120-124 23.599999999999998 28.02 28.53 19.85 125-129 23.94 28.535 27.32 20.205000000000002 130-134 24.27 27.675 28.360000000000003 19.695 135-139 24.84 27.584999999999997 28.134999999999998 19.439999999999998 140-144 24.945 28.310000000000002 27.355 19.39 145-149 25.759999999999998 27.950000000000003 26.995 19.295 150-151 25.825 27.400000000000002 27.5625 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 1.5 24 3.5 25 3.5 26 2.5 27 4.5 28 7.0 29 12.5 30 16.0 31 17.0 32 29.5 33 41.5 34 46.0 35 68.5 36 99.5 37 125.5 38 155.5 39 196.5 40 212.5 41 235.0 42 283.0 43 299.5 44 291.5 45 290.0 46 271.5 47 234.0 48 226.5 49 192.5 50 144.0 51 123.5 52 99.0 53 73.0 54 55.0 55 40.5 56 32.0 57 22.0 58 12.0 59 9.0 60 6.0 61 5.5 62 2.5 63 1.0 64 1.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4500000000000002 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.925000000000001 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTGCA 10 0.006830828 145.0 6 >>END_MODULE Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886799 spots for SRR7166201.sra Written 886799 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra Read 886796 spots for SRR7166201.sra Written 886796 spots for SRR7166201.sra SRR ids: ['SRR7166201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hd_4h3cl SRR7166201.sra spots: 17735923 blocks: [[1, 886796], [886797, 1773592], [1773593, 2660388], [2660389, 3547184], [3547185, 4433980], [4433981, 5320776], [5320777, 6207572], [6207573, 7094368], [7094369, 7981164], [7981165, 8867960], [8867961, 9754756], [9754757, 10641552], [10641553, 11528348], [11528349, 12415144], [12415145, 13301940], [13301941, 14188736], [14188737, 15075532], [15075533, 15962328], [15962329, 16849124], [16849125, 17735923]] SRR7166201 file size 5988421 SRR7166201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166201 SRR7166201_1.fastq SRR7166201_2.fastq Input file: SRR7166201_1.fastq Paired file: SRR7166201_2.fastq trimmed: SRR7166201-trimmed-pair1.fastq, SRR7166201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 01:33:11 2025 >> started Sat Feb 15 01:33:34 2025 >> done (23.531s) 17735923 read pairs processed; of these: 21976 ( 0.12%) short read pairs filtered out after trimming by size control 19721 ( 0.11%) empty read pairs filtered out after trimming by size control 17694226 (99.76%) read pairs available; of these: 11712286 (66.19%) trimmed read pairs available after processing 5981940 (33.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 7 0.00% 21 4 0.00% 22 6 0.00% 23 8 0.00% 24 9 0.00% 25 6 0.00% 26 3 0.00% 27 7 0.00% 28 7 0.00% 29 7 0.00% 30 15 0.00% 31 18 0.00% 32 15 0.00% 33 20 0.00% 34 13 0.00% 35 15 0.00% 36 15 0.00% 37 21 0.00% 38 21 0.00% 39 30 0.00% 40 25 0.00% 41 25 0.00% 42 27 0.00% 43 48 0.00% 44 26 0.00% 45 45 0.00% 46 45 0.00% 47 62 0.00% 48 73 0.00% 49 61 0.00% 50 95 0.00% 51 96 0.00% 52 125 0.00% 53 116 0.00% 54 120 0.00% 55 137 0.00% 56 171 0.00% 57 215 0.00% 58 226 0.00% 59 239 0.00% 60 294 0.00% 61 341 0.00% 62 400 0.00% 63 461 0.00% 64 504 0.00% 65 543 0.00% 66 605 0.00% 67 726 0.00% 68 814 0.00% 69 968 0.01% 70 1116 0.01% 71 1282 0.01% 72 1386 0.01% 73 1624 0.01% 74 1789 0.01% 75 2030 0.01% 76 2251 0.01% 77 2525 0.01% 78 2811 0.02% 79 3028 0.02% 80 3374 0.02% 81 3812 0.02% 82 4329 0.02% 83 4890 0.03% 84 6160 0.03% 85 7066 0.04% 86 7399 0.04% 87 7789 0.04% 88 8420 0.05% 89 9003 0.05% 90 9911 0.06% 91 10974 0.06% 92 11758 0.07% 93 12778 0.07% 94 13470 0.08% 95 14470 0.08% 96 15314 0.09% 97 15886 0.09% 98 16822 0.10% 99 17745 0.10% 100 19370 0.11% 101 20926 0.12% 102 22353 0.13% 103 23674 0.13% 104 24810 0.14% 105 25977 0.15% 106 26867 0.15% 107 27684 0.16% 108 29256 0.17% 109 30504 0.17% 110 33128 0.19% 111 34060 0.19% 112 36016 0.20% 113 37949 0.21% 114 40370 0.23% 115 42463 0.24% 116 43948 0.25% 117 45934 0.26% 118 47723 0.27% 119 49702 0.28% 120 52419 0.30% 121 55304 0.31% 122 58890 0.33% 123 62322 0.35% 124 65461 0.37% 125 69040 0.39% 126 72232 0.41% 127 76877 0.43% 128 79845 0.45% 129 85364 0.48% 130 91124 0.51% 131 96143 0.54% 132 104220 0.59% 133 111775 0.63% 134 120501 0.68% 135 131704 0.74% 136 138800 0.78% 137 145981 0.83% 138 159275 0.90% 139 176526 1.00% 140 201880 1.14% 141 200327 1.13% 142 216680 1.22% 143 244355 1.38% 144 281952 1.59% 145 338345 1.91% 146 426215 2.41% 147 570634 3.22% 148 806619 4.56% 149 1362807 7.70% 150 4216846 23.83% 151 5981940 33.81% 17694226 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=14 prefix-density=0.26 prefix-fanout=3.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=11.20 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=3.4 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=5.20 fanout-score-rank=16 prefix-density=0.50 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=37.39 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.0 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7166201 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 01:34:44 Started mapping on | Feb 15 01:34:44 Finished on | Feb 15 01:36:29 Mapping speed, Million of reads per hour | 606.66 Number of input reads | 17694226 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16894159 Uniquely mapped reads % | 95.48% Average mapped length | 289.66 Number of splices: Total | 16358131 Number of splices: Annotated (sjdb) | 16061176 Number of splices: GT/AG | 16101129 Number of splices: GC/AG | 204349 Number of splices: AT/AC | 11703 Number of splices: Non-canonical | 40950 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436113 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 33107 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 386445 386445 386445 N_multimapping 436113 436113 436113 N_noFeature 550365 16634408 730189 N_ambiguous 161873 1020 81358 UnstrandedReadsAssigned:16181921 PositiveStrandReadsAssigned:258731 NegativeStrandReadsAssigned:16082612 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166201-trimmed-pair1.fastq SRR7166201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,694,226 reads, 16,015,490 reads pseudoaligned [quant] estimated average fragment length: 228.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7166201.ke.tsv 34699 SRR7166201.se.tsv 87100 total ==> SRR7166201.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.36 935 32.9441 Potri.005G024800.1.v4.1 1035 807.355 241 18.8303 Potri.004G059700.1.v4.1 961 733.365 43 3.69874 Potri.007G009000.2.v4.1 1416 1188.36 0 0 Potri.003G141000.2.v4.1 2943 2715.36 626.459 14.5536 Potri.016G087400.1.v4.1 270 85.8233 1129.22 830.005 Potri.015G069301.1.v4.1 564 340.016 0 0 Potri.010G195200.1.v4.1 1773 1545.36 153 6.24552 Potri.012G127500.1.v4.1 977 749.365 3712 312.479 ==> SRR7166201.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 359 SRR7166201 completed mapping pipeline successfully