Starting /dee2/code/volunteer_pipeline.sh SRR7166202 current disk space = 3105499078656 free memory = 1449536008 SRR7166202 SRAfilesize 7a401bf3cd8af85264996adb4e7781fb SRR7166202.sra SRR7166202.sra file validated SRR7166202 is paired end SRR7166202 is conventional basespace SRR7166202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5435 33.0 32.0 34.0 27.0 34.0 2 31.98775 33.0 31.0 34.0 28.0 34.0 3 31.91875 33.0 31.0 34.0 28.0 34.0 4 32.23175 33.0 33.0 34.0 31.0 34.0 5 32.332 33.0 33.0 34.0 31.0 34.0 6 36.31175 38.0 37.0 38.0 33.0 38.0 7 36.731 38.0 37.0 38.0 34.0 38.0 8 36.8965 38.0 38.0 38.0 35.0 38.0 9 36.83425 38.0 38.0 38.0 35.0 38.0 10-14 36.780800000000006 38.0 38.0 38.0 34.6 38.0 15-19 36.69415 38.0 38.0 38.0 34.2 38.0 20-24 36.757600000000004 38.0 38.0 38.0 34.6 38.0 25-29 36.41895 38.0 37.4 38.0 33.6 38.0 30-34 36.19305000000001 38.0 37.0 38.0 32.6 38.0 35-39 36.05480000000001 38.0 37.0 38.0 31.6 38.0 40-44 35.996249999999996 38.0 37.0 38.0 31.0 38.0 45-49 36.0074 38.0 37.0 38.0 31.0 38.0 50-54 35.8891 38.0 37.0 38.0 30.4 38.0 55-59 35.6833 38.0 36.4 38.0 29.6 38.0 60-64 35.37769999999999 38.0 36.0 38.0 28.8 38.0 65-69 35.43645 38.0 36.0 38.0 28.8 38.0 70-74 35.283950000000004 38.0 36.0 38.0 28.4 38.0 75-79 34.637899999999995 38.0 35.6 38.0 26.4 38.0 80-84 34.27954999999999 38.0 34.8 38.0 25.2 38.0 85-89 34.23805 38.0 34.2 38.0 24.6 38.0 90-94 34.564550000000004 38.0 34.8 38.0 25.6 38.0 95-99 33.88835 37.8 33.6 38.0 20.6 38.0 100-104 33.47880000000001 37.4 33.2 38.0 16.6 38.0 105-109 33.133750000000006 37.0 32.4 38.0 15.0 38.0 110-114 32.138099999999994 36.8 29.4 38.0 15.0 38.0 115-119 32.32215 37.0 31.0 38.0 15.0 38.0 120-124 31.5237 36.0 28.2 38.0 15.0 38.0 125-129 31.053350000000002 35.8 27.4 38.0 14.6 38.0 130-134 29.7825 35.0 24.4 38.0 13.2 38.0 135-139 28.5653 33.4 22.2 38.0 10.8 38.0 140-144 27.101499999999998 33.6 17.0 38.0 2.0 38.0 145-149 25.152499999999996 32.0 10.8 38.0 2.0 38.0 150-151 19.152 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 7.0 16 3.0 17 4.0 18 8.0 19 11.0 20 18.0 21 21.0 22 33.0 23 22.0 24 64.0 25 75.0 26 93.0 27 93.0 28 111.0 29 127.0 30 154.0 31 186.0 32 247.0 33 294.0 34 428.0 35 565.0 36 851.0 37 583.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.53346855983773 19.574036511156187 9.787018255578094 36.105476673427994 2 18.725 26.174999999999997 37.625 17.474999999999998 3 15.975 33.074999999999996 27.55 23.400000000000002 4 19.950000000000003 37.875 21.45 20.724999999999998 5 19.925 39.074999999999996 22.75 18.25 6 14.75 37.9 24.275 23.075000000000003 7 11.475 21.45 46.575 20.5 8 16.925 21.175 28.15 33.75 9 17.599999999999998 21.625 30.525000000000002 30.25 10-14 18.775 30.86 26.565 23.799999999999997 15-19 19.465 29.28 27.41 23.845 20-24 18.945 29.45 27.785 23.82 25-29 18.755 29.585 28.470000000000002 23.189999999999998 30-34 19.225 29.265 28.134999999999998 23.375 35-39 19.56 29.439999999999998 27.465 23.535 40-44 19.095000000000002 29.87 27.650000000000002 23.385 45-49 19.139999999999997 30.025000000000002 27.500000000000004 23.335 50-54 19.1 29.310000000000002 27.38 24.21 55-59 19.355 29.304999999999996 27.54 23.799999999999997 60-64 18.995 29.165000000000003 28.17 23.669999999999998 65-69 19.535 29.74 27.355 23.369999999999997 70-74 19.542130047089472 29.12032862438633 28.163510670273517 23.17403065825068 75-79 19.465376782077392 28.900203665987778 27.74949083503055 23.884928716904277 80-84 19.77242575773038 29.273395244412697 27.691601183794262 23.26257781406266 85-89 19.85 28.610000000000003 28.055000000000003 23.485 90-94 19.75 29.134999999999998 27.779999999999998 23.335 95-99 19.67 28.854999999999997 27.794999999999998 23.68 100-104 19.215 28.794999999999998 28.599999999999998 23.39 105-109 19.895 29.065 27.54 23.5 110-114 19.825 29.28 27.63 23.265 115-119 19.99 29.12 27.445000000000004 23.445 120-124 20.4352176088044 28.73936968484242 27.523761880940473 23.301650825412707 125-129 21.094532345283394 28.80532745844182 27.002803925495694 23.09733627077909 130-134 20.470171890798785 29.170879676440848 26.749241658240646 23.60970677451972 135-139 20.66703390254895 28.3789874305173 27.132054684761382 23.821923982172365 140-144 20.46125368952924 28.60073040172095 27.219970984041225 23.71804492470859 145-149 20.5222194325885 28.551343208636702 26.70851117248305 24.21792618629174 150-151 20.77173640691556 27.023302430468554 26.472062139814582 25.732899022801302 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 5.0 25 7.5 26 9.0 27 9.5 28 12.5 29 18.0 30 23.0 31 41.5 32 57.0 33 65.5 34 74.5 35 86.0 36 116.0 37 145.0 38 155.5 39 182.5 40 212.0 41 237.5 42 259.0 43 275.0 44 285.0 45 267.0 46 245.5 47 226.5 48 207.0 49 177.5 50 136.0 51 106.5 52 85.0 53 64.0 54 47.0 55 35.5 56 28.0 57 20.0 58 17.5 59 15.5 60 10.5 61 8.0 62 5.0 63 3.5 64 3.0 65 1.5 66 1.0 67 0.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.19 75-79 1.7999999999999998 80-84 2.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.05 125-129 0.13999999999999999 130-134 1.0999999999999999 135-139 0.155 140-144 0.055 145-149 0.42500000000000004 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.725 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.699999999999999 0.0 0.0 0.0 0.0 128-129 5.075 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.137499999999999 0.0 0.0 0.0 0.0 138-139 7.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAAT 10 0.0068963906 144.5375 9 AATCATG 10 0.0068963906 144.5375 5 >>END_MODULE SRR7166202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57775 33.0 33.0 34.0 32.0 34.0 2 32.695 33.0 33.0 34.0 32.0 34.0 3 32.66525 34.0 33.0 34.0 32.0 34.0 4 32.61075 33.0 33.0 34.0 32.0 34.0 5 32.6765 34.0 33.0 34.0 32.0 34.0 6 36.556 38.0 38.0 38.0 34.0 38.0 7 36.59 38.0 38.0 38.0 34.0 38.0 8 36.63175 38.0 38.0 38.0 35.0 38.0 9 36.68 38.0 38.0 38.0 35.0 38.0 10-14 36.59425 38.0 38.0 38.0 34.0 38.0 15-19 36.455499999999994 38.0 38.0 38.0 34.0 38.0 20-24 36.3861 38.0 38.0 38.0 33.8 38.0 25-29 36.4099 38.0 38.0 38.0 34.0 38.0 30-34 36.44425 38.0 38.0 38.0 34.0 38.0 35-39 36.3132 38.0 38.0 38.0 33.8 38.0 40-44 36.1563 38.0 37.8 38.0 33.0 38.0 45-49 35.9519 38.0 37.2 38.0 31.2 38.0 50-54 35.8095 38.0 37.2 38.0 30.0 38.0 55-59 35.977650000000004 38.0 37.2 38.0 31.4 38.0 60-64 35.808350000000004 38.0 37.0 38.0 30.6 38.0 65-69 35.72895 38.0 37.0 38.0 29.6 38.0 70-74 35.5603 38.0 37.0 38.0 29.0 38.0 75-79 35.4952 38.0 36.8 38.0 28.8 38.0 80-84 35.43855 38.0 37.0 38.0 29.0 38.0 85-89 35.28535 38.0 36.4 38.0 28.8 38.0 90-94 35.0843 38.0 36.0 38.0 28.0 38.0 95-99 34.5817 38.0 35.2 38.0 25.8 38.0 100-104 34.3421 38.0 34.8 38.0 24.6 38.0 105-109 34.545700000000004 38.0 35.0 38.0 25.6 38.0 110-114 34.14065 38.0 34.2 38.0 23.2 38.0 115-119 33.578649999999996 38.0 34.0 38.0 17.4 38.0 120-124 33.0837 38.0 33.2 38.0 15.0 38.0 125-129 32.218849999999996 37.2 31.0 38.0 15.0 38.0 130-134 31.488349999999997 36.8 30.4 38.0 13.8 38.0 135-139 30.894350000000003 36.0 29.2 38.0 13.2 38.0 140-144 30.035050000000002 36.0 28.2 38.0 7.8 38.0 145-149 27.6322 34.0 18.8 38.0 2.0 38.0 150-151 21.96375 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 5.0 6 3.0 7 0.0 8 2.0 9 2.0 10 1.0 11 3.0 12 3.0 13 2.0 14 6.0 15 2.0 16 8.0 17 5.0 18 10.0 19 11.0 20 15.0 21 19.0 22 19.0 23 32.0 24 35.0 25 49.0 26 55.0 27 60.0 28 70.0 29 90.0 30 89.0 31 154.0 32 174.0 33 231.0 34 285.0 35 431.0 36 769.0 37 1349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 16.625 13.775 30.5 2 23.93098274568642 24.20605151287822 35.63390847711928 16.22905726431608 3 20.280070017504375 26.131532883220803 32.50812703175794 21.080270067516878 4 23.51175587793897 35.842921460730366 21.935967983991997 18.70935467733867 5 22.56128064032016 37.89394697348674 21.585792896448226 17.958979489744873 6 16.975 38.2 25.825 19.0 7 16.45 16.625 47.0 19.925 8 19.8 21.875 28.65 29.675 9 22.630657664416105 23.680920230057513 28.33208302075519 25.35633908477119 10-14 22.85342801420213 29.35940391058659 26.87903185477822 20.908136220433065 15-19 23.555 27.815 28.08 20.549999999999997 20-24 23.41 28.660000000000004 27.92 20.01 25-29 23.035 28.194999999999997 28.860000000000003 19.91 30-34 23.445 27.525 28.79 20.24 35-39 22.936146807340364 28.346417320866042 28.21641082054103 20.501025051252565 40-44 23.23 27.884999999999998 28.705000000000002 20.18 45-49 23.965 28.24 28.22 19.575 50-54 22.795 28.060000000000002 29.085 20.06 55-59 23.171158557927896 28.71643582179109 28.61143057152858 19.500975048752437 60-64 23.65 28.09 28.625 19.634999999999998 65-69 23.605 28.185 28.15 20.06 70-74 23.549999999999997 28.000000000000004 28.565 19.885 75-79 23.65 27.11 29.304999999999996 19.935 80-84 23.2023202320232 27.602760276027606 29.107910791079107 20.087008700870086 85-89 22.94614730736537 28.751437571878597 28.841442072103607 19.460973048652434 90-94 23.625 27.38 29.235 19.759999999999998 95-99 23.118467770165523 28.479271890783618 28.614292143821572 19.787968195229286 100-104 23.82572157470862 27.907558401280575 28.928017607923568 19.338702416087237 105-109 23.976988494247124 28.099049524762382 28.704352176088044 19.21960980490245 110-114 24.285928667900556 28.042619178630385 28.1426641988895 19.52878795457956 115-119 23.237323732373238 28.38783878387839 28.50785078507851 19.866986698669866 120-124 24.383657548632296 27.89918487773166 28.709306395959395 19.007851177676653 125-129 24.025 28.63 28.075 19.27 130-134 24.445 28.075 28.21 19.27 135-139 24.94 28.549999999999997 27.3 19.21 140-144 25.46 27.88 27.750000000000004 18.91 145-149 25.205 28.015 28.24 18.54 150-151 25.874999999999996 27.6625 28.125 18.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.5 25 3.5 26 4.0 27 3.0 28 11.5 29 20.0 30 25.0 31 33.5 32 44.0 33 50.5 34 58.0 35 68.5 36 85.0 37 126.0 38 157.5 39 172.5 40 197.5 41 219.0 42 249.5 43 293.5 44 307.0 45 279.0 46 263.5 47 254.5 48 214.5 49 180.5 50 155.5 51 121.5 52 98.5 53 82.0 54 57.5 55 38.5 56 29.5 57 24.0 58 16.5 59 10.5 60 10.5 61 9.0 62 5.5 63 2.0 64 1.0 65 1.5 66 1.0 67 2.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.015 100-104 0.045 105-109 0.05 110-114 0.045 115-119 0.01 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.7874999999999996 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.3625 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 6.949999999999999 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTATC 10 0.006830828 145.0 6 TATACAA 10 0.006830828 145.0 7 AACCAGA 10 0.006830828 145.0 4 TGTATCT 10 0.006830828 145.0 7 TTTGTAT 10 0.006830828 145.0 5 ACCAGAG 10 0.006830828 145.0 5 >>END_MODULE Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 941003 spots for SRR7166202.sra Written 941003 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra Read 940990 spots for SRR7166202.sra Written 940990 spots for SRR7166202.sra SRR ids: ['SRR7166202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rc3dp1cn SRR7166202.sra spots: 18819813 blocks: [[1, 940990], [940991, 1881980], [1881981, 2822970], [2822971, 3763960], [3763961, 4704950], [4704951, 5645940], [5645941, 6586930], [6586931, 7527920], [7527921, 8468910], [8468911, 9409900], [9409901, 10350890], [10350891, 11291880], [11291881, 12232870], [12232871, 13173860], [13173861, 14114850], [14114851, 15055840], [15055841, 15996830], [15996831, 16937820], [16937821, 17878810], [17878811, 18819813]] SRR7166202 file size 6355716 SRR7166202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166202 SRR7166202_1.fastq SRR7166202_2.fastq Input file: SRR7166202_1.fastq Paired file: SRR7166202_2.fastq trimmed: SRR7166202-trimmed-pair1.fastq, SRR7166202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 00:31:17 2025 >> started Sat Feb 15 00:31:55 2025 >> done (38.056s) 18819813 read pairs processed; of these: 16192 ( 0.09%) short read pairs filtered out after trimming by size control 12455 ( 0.07%) empty read pairs filtered out after trimming by size control 18791166 (99.85%) read pairs available; of these: 12601973 (67.06%) trimmed read pairs available after processing 6189193 (32.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 9 0.00% 21 8 0.00% 22 8 0.00% 23 4 0.00% 24 1 0.00% 25 8 0.00% 26 9 0.00% 27 5 0.00% 28 3 0.00% 29 12 0.00% 30 8 0.00% 31 7 0.00% 32 11 0.00% 33 8 0.00% 34 8 0.00% 35 4 0.00% 36 13 0.00% 37 12 0.00% 38 10 0.00% 39 18 0.00% 40 20 0.00% 41 28 0.00% 42 27 0.00% 43 22 0.00% 44 26 0.00% 45 28 0.00% 46 43 0.00% 47 52 0.00% 48 42 0.00% 49 55 0.00% 50 79 0.00% 51 80 0.00% 52 93 0.00% 53 108 0.00% 54 116 0.00% 55 127 0.00% 56 146 0.00% 57 169 0.00% 58 229 0.00% 59 257 0.00% 60 283 0.00% 61 318 0.00% 62 357 0.00% 63 442 0.00% 64 497 0.00% 65 513 0.00% 66 623 0.00% 67 674 0.00% 68 811 0.00% 69 974 0.01% 70 1050 0.01% 71 1301 0.01% 72 1376 0.01% 73 1617 0.01% 74 1888 0.01% 75 2148 0.01% 76 2381 0.01% 77 2662 0.01% 78 2870 0.02% 79 3324 0.02% 80 3803 0.02% 81 4118 0.02% 82 4944 0.03% 83 5533 0.03% 84 6872 0.04% 85 7660 0.04% 86 8118 0.04% 87 8777 0.05% 88 9616 0.05% 89 10499 0.06% 90 11308 0.06% 91 12464 0.07% 92 13510 0.07% 93 14913 0.08% 94 15796 0.08% 95 16486 0.09% 96 17987 0.10% 97 18845 0.10% 98 19954 0.11% 99 21336 0.11% 100 22978 0.12% 101 24502 0.13% 102 25513 0.14% 103 26935 0.14% 104 29149 0.16% 105 31361 0.17% 106 32795 0.17% 107 33693 0.18% 108 35263 0.19% 109 36786 0.20% 110 38550 0.21% 111 40741 0.22% 112 42965 0.23% 113 46016 0.24% 114 48717 0.26% 115 51001 0.27% 116 52403 0.28% 117 55321 0.29% 118 57390 0.31% 119 59739 0.32% 120 61472 0.33% 121 65055 0.35% 122 67902 0.36% 123 72209 0.38% 124 76748 0.41% 125 80411 0.43% 126 84810 0.45% 127 89044 0.47% 128 93066 0.50% 129 97699 0.52% 130 102599 0.55% 131 108846 0.58% 132 116458 0.62% 133 124704 0.66% 134 133842 0.71% 135 144467 0.77% 136 152486 0.81% 137 158822 0.85% 138 172004 0.92% 139 191113 1.02% 140 216993 1.15% 141 212630 1.13% 142 232588 1.24% 143 257966 1.37% 144 301375 1.60% 145 361421 1.92% 146 455239 2.42% 147 602142 3.20% 148 833558 4.44% 149 1449927 7.72% 150 4431989 23.59% 151 6189193 32.94% 18791166 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=23 prefix-density=0.69 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=215.70 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.7 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCTGATCACAACCTGGTGGTAAAGAGCTGCAAGTGCTGCTCCAATGAAGGGGCCAACCCA criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=53.88 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.2 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7166202 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 00:33:04 Started mapping on | Feb 15 00:33:04 Finished on | Feb 15 00:36:10 Mapping speed, Million of reads per hour | 363.70 Number of input reads | 18791166 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17445480 Uniquely mapped reads % | 92.84% Average mapped length | 288.96 Number of splices: Total | 16119604 Number of splices: Annotated (sjdb) | 15796606 Number of splices: GT/AG | 15865765 Number of splices: GC/AG | 198008 Number of splices: AT/AC | 12064 Number of splices: Non-canonical | 43767 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411100 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 56034 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 950303 950303 950303 N_multimapping 411100 411100 411100 N_noFeature 670078 17218706 795190 N_ambiguous 184556 1006 82269 UnstrandedReadsAssigned:16590846 PositiveStrandReadsAssigned:225768 NegativeStrandReadsAssigned:16568021 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166202-trimmed-pair1.fastq SRR7166202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,791,166 reads, 16,468,045 reads pseudoaligned [quant] estimated average fragment length: 227.644 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7166202.ke.tsv 34699 SRR7166202.se.tsv 87100 total ==> SRR7166202.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.36 2062 64.7507 Potri.005G024800.1.v4.1 1035 808.356 2270 157.965 Potri.004G059700.1.v4.1 961 734.361 16 1.2256 Potri.007G009000.2.v4.1 1416 1189.36 0 0 Potri.003G141000.2.v4.1 2943 2716.36 1182.61 24.4903 Potri.016G087400.1.v4.1 270 87.7959 1327.3 850.415 Potri.015G069301.1.v4.1 564 340.569 0 0 Potri.010G195200.1.v4.1 1773 1546.36 598 21.7535 Potri.012G127500.1.v4.1 977 750.361 3661 274.452 ==> SRR7166202.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 589 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 224 SRR7166202 completed mapping pipeline successfully