Starting /dee2/code/volunteer_pipeline.sh SRR7166203 current disk space = 3104127037440 free memory = 1580077404 SRR7166203 SRAfilesize 0cae897e137a90d014cbe3683320935d SRR7166203.sra SRR7166203.sra file validated SRR7166203 is paired end SRR7166203 is conventional basespace SRR7166203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56625 33.0 32.0 34.0 27.0 34.0 2 32.05225 33.0 31.0 34.0 29.0 34.0 3 31.929 33.0 31.0 34.0 28.0 34.0 4 32.286 33.0 33.0 34.0 31.0 34.0 5 32.347 33.0 33.0 34.0 31.0 34.0 6 36.3105 38.0 37.0 38.0 33.0 38.0 7 36.90625 38.0 37.0 38.0 35.0 38.0 8 36.97375 38.0 38.0 38.0 35.0 38.0 9 36.9725 38.0 38.0 38.0 35.0 38.0 10-14 36.859950000000005 38.0 38.0 38.0 34.8 38.0 15-19 36.750750000000004 38.0 38.0 38.0 34.6 38.0 20-24 36.78845 38.0 38.0 38.0 34.6 38.0 25-29 36.475300000000004 38.0 37.8 38.0 33.6 38.0 30-34 36.29174999999999 38.0 37.0 38.0 33.4 38.0 35-39 36.1245 38.0 37.0 38.0 32.2 38.0 40-44 35.952749999999995 38.0 37.0 38.0 31.0 38.0 45-49 35.99015 38.0 37.0 38.0 31.0 38.0 50-54 35.91365 38.0 37.0 38.0 30.6 38.0 55-59 35.67444999999999 38.0 36.2 38.0 29.2 38.0 60-64 35.3686 38.0 36.0 38.0 28.6 38.0 65-69 35.491249999999994 38.0 36.0 38.0 29.0 38.0 70-74 35.363499999999995 38.0 36.0 38.0 29.0 38.0 75-79 34.6907 38.0 35.6 38.0 26.8 38.0 80-84 34.365449999999996 38.0 35.0 38.0 25.8 38.0 85-89 34.28195 38.0 34.0 38.0 25.0 38.0 90-94 34.5832 38.0 35.0 38.0 25.8 38.0 95-99 33.84495 37.4 33.8 38.0 20.8 38.0 100-104 33.33575 37.2 33.2 38.0 16.6 38.0 105-109 33.0492 37.2 32.4 38.0 15.0 38.0 110-114 32.0836 36.8 29.2 38.0 15.0 38.0 115-119 32.149950000000004 36.8 30.2 38.0 15.0 38.0 120-124 31.365549999999995 36.0 28.2 38.0 15.0 38.0 125-129 31.113199999999996 35.8 27.8 38.0 14.6 38.0 130-134 29.8362 35.0 24.4 38.0 13.4 38.0 135-139 28.512400000000003 33.4 22.2 38.0 10.8 38.0 140-144 26.89405 33.6 15.6 38.0 2.0 38.0 145-149 25.203900000000004 32.4 10.8 38.0 2.0 38.0 150-151 18.775125 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 4.0 14 2.0 15 3.0 16 2.0 17 7.0 18 4.0 19 15.0 20 16.0 21 20.0 22 40.0 23 39.0 24 49.0 25 58.0 26 63.0 27 93.0 28 124.0 29 137.0 30 149.0 31 192.0 32 254.0 33 353.0 34 424.0 35 551.0 36 838.0 37 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.75429726996967 17.669362992922146 11.223458038422649 34.352881698685536 2 20.05 25.8 36.5 17.65 3 16.6 32.725 27.075 23.599999999999998 4 20.925 36.425000000000004 21.95 20.7 5 18.85 38.75 23.375 19.025 6 16.2 37.724999999999994 23.974999999999998 22.1 7 11.525 20.549999999999997 47.25 20.674999999999997 8 18.725 21.775 26.55 32.95 9 18.15 22.325 30.0 29.525000000000002 10-14 19.005 31.069999999999997 26.375 23.549999999999997 15-19 19.185 29.285 28.075 23.455000000000002 20-24 19.125 29.904999999999998 27.889999999999997 23.080000000000002 25-29 18.740000000000002 30.159999999999997 27.74 23.36 30-34 18.91 29.565 27.91 23.615 35-39 19.805 29.695 27.700000000000003 22.8 40-44 19.53 29.315 27.744999999999997 23.41 45-49 19.325 29.49 27.63 23.555 50-54 18.925 29.659999999999997 27.855 23.56 55-59 19.605 29.304999999999996 27.235 23.855 60-64 19.470000000000002 29.580000000000002 27.21 23.74 65-69 19.505 28.65 27.975 23.87 70-74 19.76878034132426 28.827386016715877 28.0416395575797 23.36219408438016 75-79 19.642494413975218 28.81373146455413 27.376599634369285 24.167174487101363 80-84 19.787158205611284 29.16645450379347 27.65924945261979 23.38713783797546 85-89 20.155 28.405 27.875 23.565 90-94 19.805 29.4 27.36 23.435 95-99 19.905 28.92 27.415 23.76 100-104 20.380000000000003 28.42 27.905 23.294999999999998 105-109 20.34 28.499999999999996 27.27 23.89 110-114 19.985 28.89 27.529999999999998 23.595 115-119 20.64 28.68 26.895000000000003 23.785 120-124 20.511153346003802 28.833650095028506 27.058117435230567 23.59707912373712 125-129 20.817695040784667 28.544262623229745 26.632637742080767 24.00540459390482 130-134 21.04732115830895 28.473413379073758 27.2121884774493 23.267076985167996 135-139 20.764069697576605 28.63508912477468 26.852593631083515 23.74824754656519 140-144 21.102385835042263 28.074826189166206 27.354574100935324 23.4682138748562 145-149 21.386645261626448 27.81819093964782 26.719510359705012 24.07565343902072 150-151 21.160110248058132 26.396893009270862 27.298922575795544 25.14407416687547 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 3.0 23 4.0 24 5.0 25 8.0 26 9.5 27 10.0 28 16.5 29 27.5 30 29.5 31 30.5 32 43.0 33 61.0 34 78.0 35 97.0 36 118.0 37 132.5 38 158.5 39 188.0 40 199.0 41 229.0 42 263.0 43 257.5 44 246.0 45 247.0 46 238.5 47 222.0 48 209.5 49 183.0 50 152.0 51 123.0 52 94.0 53 75.0 54 58.5 55 47.5 56 34.5 57 23.5 58 20.0 59 14.0 60 9.0 61 9.5 62 6.5 63 2.5 64 4.0 65 3.0 66 1.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.095 75-79 1.54 80-84 1.805 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.08499999999999999 130-134 0.89 135-139 0.13999999999999999 140-144 0.034999999999999996 145-149 0.335 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.612500000000001 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGTAT 10 0.006662729 146.18988 1 ACTGTGC 10 0.0069214175 144.3625 6 >>END_MODULE SRR7166203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62275 33.0 33.0 34.0 32.0 34.0 2 32.64725 33.0 33.0 34.0 32.0 34.0 3 32.64975 33.0 33.0 34.0 32.0 34.0 4 32.67425 34.0 33.0 34.0 32.0 34.0 5 32.6825 34.0 33.0 34.0 32.0 34.0 6 36.63825 38.0 38.0 38.0 35.0 38.0 7 36.65925 38.0 38.0 38.0 35.0 38.0 8 36.7545 38.0 38.0 38.0 35.0 38.0 9 36.75025 38.0 38.0 38.0 35.0 38.0 10-14 36.59775 38.0 38.0 38.0 34.4 38.0 15-19 36.5209 38.0 38.0 38.0 34.0 38.0 20-24 36.371249999999996 38.0 38.0 38.0 33.8 38.0 25-29 36.5005 38.0 38.0 38.0 34.0 38.0 30-34 36.4842 38.0 38.0 38.0 34.0 38.0 35-39 36.367200000000004 38.0 38.0 38.0 33.8 38.0 40-44 36.250150000000005 38.0 38.0 38.0 33.2 38.0 45-49 35.99209999999999 38.0 37.8 38.0 32.2 38.0 50-54 35.87235 38.0 37.0 38.0 31.0 38.0 55-59 35.991200000000006 38.0 37.2 38.0 32.0 38.0 60-64 35.82005 38.0 37.0 38.0 31.0 38.0 65-69 35.86495 38.0 37.0 38.0 31.0 38.0 70-74 35.5875 38.0 37.0 38.0 29.2 38.0 75-79 35.49735 38.0 36.8 38.0 29.6 38.0 80-84 35.4781 38.0 37.0 38.0 29.0 38.0 85-89 35.30544999999999 38.0 36.6 38.0 29.0 38.0 90-94 35.036649999999995 38.0 36.0 38.0 28.0 38.0 95-99 34.667500000000004 38.0 35.4 38.0 25.6 38.0 100-104 34.42835 38.0 35.0 38.0 25.4 38.0 105-109 34.4524 38.0 35.0 38.0 25.2 38.0 110-114 34.198750000000004 38.0 34.8 38.0 24.2 38.0 115-119 33.65795 38.0 34.0 38.0 21.0 38.0 120-124 33.03965 38.0 33.8 38.0 15.0 38.0 125-129 32.29279999999999 37.6 31.0 38.0 15.0 38.0 130-134 31.452550000000002 36.6 30.6 38.0 13.8 38.0 135-139 30.87795 36.0 30.0 38.0 13.2 38.0 140-144 30.082599999999996 36.0 28.2 38.0 7.8 38.0 145-149 27.63855 34.2 18.4 38.0 2.0 38.0 150-151 21.862875 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 9.0 4 1.0 5 3.0 6 2.0 7 1.0 8 1.0 9 3.0 10 3.0 11 2.0 12 1.0 13 6.0 14 5.0 15 6.0 16 7.0 17 6.0 18 4.0 19 14.0 20 11.0 21 12.0 22 22.0 23 27.0 24 20.0 25 47.0 26 46.0 27 50.0 28 73.0 29 90.0 30 111.0 31 142.0 32 184.0 33 215.0 34 293.0 35 450.0 36 775.0 37 1349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.675 15.775 15.725 28.825 2 25.10627656914228 23.380845211302827 35.65891472868217 15.853963490872719 3 20.630157539384847 26.65666416604151 31.657914478619652 21.05526381595399 4 23.81190595297649 35.91795897948975 21.660830415207606 18.609304652326163 5 23.88694347173587 38.56928464232116 20.535267633816908 17.008504252126063 6 18.224999999999998 39.5 23.45 18.825 7 16.275000000000002 15.85 45.9 21.975 8 20.325 21.925 28.725 29.025000000000002 9 23.905976494123532 22.48062015503876 28.40710177544386 25.206301575393848 10-14 22.623393509026354 29.00435065259789 27.36410461569235 21.008151222683402 15-19 23.07 27.93 28.055000000000003 20.945 20-24 22.75 28.165000000000003 27.955000000000002 21.13 25-29 23.22 27.67 28.985 20.125 30-34 23.05 27.88 28.694999999999997 20.375 35-39 23.33116655832792 28.25141257062853 28.111405570278514 20.306015300765036 40-44 23.330000000000002 28.389999999999997 28.000000000000004 20.28 45-49 23.005 27.73 28.689999999999998 20.575 50-54 22.645 28.389999999999997 28.720000000000002 20.244999999999997 55-59 23.84119205960298 27.886394319715986 28.016400820041003 20.256012800640033 60-64 23.805 27.224999999999998 28.71 20.26 65-69 23.73 27.925 28.46 19.885 70-74 23.465 27.889999999999997 28.525 20.119999999999997 75-79 23.615 27.465 28.720000000000002 20.200000000000003 80-84 23.502350235023503 27.3977397739774 28.97789778977898 20.122012201220123 85-89 23.651182559127957 28.046402320116005 28.601430071503575 19.700985049252463 90-94 23.14 28.115000000000002 28.395 20.349999999999998 95-99 24.03860579086863 27.954193128969347 28.134220133019955 19.87298094714207 100-104 24.295933169926467 27.792506627982593 28.27772497623931 19.633835225851634 105-109 24.244546728036823 27.78667200320192 28.47208324994997 19.496698018811287 110-114 23.808094451948573 28.30556806243434 28.060433238281057 19.825904247336034 115-119 23.7023702370237 27.9027902790279 28.68786878687869 19.706970697069707 120-124 24.493674051107668 27.69415412311847 27.714157123568533 20.09801470220533 125-129 24.785 27.33 28.605000000000004 19.28 130-134 24.84 27.400000000000002 28.505000000000003 19.255 135-139 25.165 27.284999999999997 28.199999999999996 19.35 140-144 25.869999999999997 27.634999999999998 28.189999999999998 18.305 145-149 25.8 27.93 27.055 19.215 150-151 26.200000000000003 27.125 27.625 19.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 1.5 19 2.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 2.0 26 6.0 27 9.5 28 12.0 29 15.0 30 16.5 31 20.5 32 37.5 33 41.0 34 41.0 35 74.5 36 103.0 37 113.5 38 134.5 39 160.0 40 197.5 41 231.0 42 268.0 43 276.5 44 270.0 45 283.5 46 268.5 47 250.5 48 219.5 49 183.0 50 161.5 51 137.5 52 119.0 53 92.0 54 64.0 55 47.0 56 35.5 57 27.5 58 19.5 59 15.5 60 11.0 61 5.5 62 2.5 63 4.0 64 3.5 65 2.0 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.015 100-104 0.045 105-109 0.06 110-114 0.055 115-119 0.01 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.17561465127947817 0.35000000000000003 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.449999999999999 0.0 0.0 0.0 0.0 130-131 5.8875 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801861 spots for SRR7166203.sra Written 801861 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra Read 801852 spots for SRR7166203.sra Written 801852 spots for SRR7166203.sra SRR ids: ['SRR7166203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mo192k1f SRR7166203.sra spots: 16037049 blocks: [[1, 801852], [801853, 1603704], [1603705, 2405556], [2405557, 3207408], [3207409, 4009260], [4009261, 4811112], [4811113, 5612964], [5612965, 6414816], [6414817, 7216668], [7216669, 8018520], [8018521, 8820372], [8820373, 9622224], [9622225, 10424076], [10424077, 11225928], [11225929, 12027780], [12027781, 12829632], [12829633, 13631484], [13631485, 14433336], [14433337, 15235188], [15235189, 16037049]] SRR7166203 file size 5412729 SRR7166203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166203 SRR7166203_1.fastq SRR7166203_2.fastq Input file: SRR7166203_1.fastq Paired file: SRR7166203_2.fastq trimmed: SRR7166203-trimmed-pair1.fastq, SRR7166203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:03:54 2025 >> started Sat Feb 15 02:04:13 2025 >> done (18.238s) 16037049 read pairs processed; of these: 15083 ( 0.09%) short read pairs filtered out after trimming by size control 10970 ( 0.07%) empty read pairs filtered out after trimming by size control 16010996 (99.84%) read pairs available; of these: 10740326 (67.08%) trimmed read pairs available after processing 5270670 (32.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 11 0.00% 32 12 0.00% 33 4 0.00% 34 9 0.00% 35 13 0.00% 36 6 0.00% 37 15 0.00% 38 13 0.00% 39 13 0.00% 40 17 0.00% 41 16 0.00% 42 16 0.00% 43 14 0.00% 44 23 0.00% 45 19 0.00% 46 41 0.00% 47 33 0.00% 48 37 0.00% 49 45 0.00% 50 55 0.00% 51 63 0.00% 52 58 0.00% 53 80 0.00% 54 108 0.00% 55 105 0.00% 56 114 0.00% 57 143 0.00% 58 181 0.00% 59 197 0.00% 60 210 0.00% 61 256 0.00% 62 306 0.00% 63 351 0.00% 64 394 0.00% 65 402 0.00% 66 509 0.00% 67 526 0.00% 68 634 0.00% 69 738 0.00% 70 771 0.00% 71 950 0.01% 72 1173 0.01% 73 1362 0.01% 74 1432 0.01% 75 1641 0.01% 76 1833 0.01% 77 2053 0.01% 78 2373 0.01% 79 2657 0.02% 80 3126 0.02% 81 3397 0.02% 82 4031 0.03% 83 4571 0.03% 84 5507 0.03% 85 6096 0.04% 86 6600 0.04% 87 7387 0.05% 88 7766 0.05% 89 8351 0.05% 90 9217 0.06% 91 9950 0.06% 92 10878 0.07% 93 11918 0.07% 94 12518 0.08% 95 13669 0.09% 96 14418 0.09% 97 15211 0.10% 98 16114 0.10% 99 17300 0.11% 100 18421 0.12% 101 20057 0.13% 102 20900 0.13% 103 22370 0.14% 104 23848 0.15% 105 25375 0.16% 106 26186 0.16% 107 27121 0.17% 108 28703 0.18% 109 29691 0.19% 110 31894 0.20% 111 33358 0.21% 112 35453 0.22% 113 37441 0.23% 114 39739 0.25% 115 41995 0.26% 116 42734 0.27% 117 45245 0.28% 118 47001 0.29% 119 49167 0.31% 120 50901 0.32% 121 53286 0.33% 122 55872 0.35% 123 59091 0.37% 124 62976 0.39% 125 67042 0.42% 126 70811 0.44% 127 73395 0.46% 128 76768 0.48% 129 81408 0.51% 130 85329 0.53% 131 91053 0.57% 132 97543 0.61% 133 104438 0.65% 134 111313 0.70% 135 121751 0.76% 136 127990 0.80% 137 134430 0.84% 138 144722 0.90% 139 161609 1.01% 140 184230 1.15% 141 180557 1.13% 142 198434 1.24% 143 220281 1.38% 144 256651 1.60% 145 309220 1.93% 146 390448 2.44% 147 517148 3.23% 148 717462 4.48% 149 1252208 7.82% 150 3825141 23.89% 151 5270670 32.92% 16010996 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=25 prefix-density=1.01 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=23.11 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.1 sequence=GAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=26 prefix-density=0.92 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=44.61 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7166203 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:05:12 Started mapping on | Feb 15 02:05:16 Finished on | Feb 15 02:07:54 Mapping speed, Million of reads per hour | 364.81 Number of input reads | 16010996 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14684139 Uniquely mapped reads % | 91.71% Average mapped length | 289.35 Number of splices: Total | 13016235 Number of splices: Annotated (sjdb) | 12712758 Number of splices: GT/AG | 12805600 Number of splices: GC/AG | 156397 Number of splices: AT/AC | 10285 Number of splices: Non-canonical | 43953 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362966 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 49228 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.57% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 978329 978329 978329 N_multimapping 362966 362966 362966 N_noFeature 556806 14488458 651092 N_ambiguous 172729 861 70940 UnstrandedReadsAssigned:13954604 PositiveStrandReadsAssigned:194820 NegativeStrandReadsAssigned:13962107 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7166203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166203-trimmed-pair1.fastq SRR7166203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,010,996 reads, 13,851,787 reads pseudoaligned [quant] estimated average fragment length: 227.306 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR7166203.ke.tsv 34699 SRR7166203.se.tsv 87100 total ==> SRR7166203.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.69 1434 49.2186 Potri.005G024800.1.v4.1 1035 808.694 2330 177.18 Potri.004G059700.1.v4.1 961 734.709 7 0.585904 Potri.007G009000.2.v4.1 1416 1189.69 0 0 Potri.003G141000.2.v4.1 2943 2716.69 795.28 18.0021 Potri.016G087400.1.v4.1 270 86.4249 934.63 665.036 Potri.015G069301.1.v4.1 564 340.347 0 0 Potri.010G195200.1.v4.1 1773 1546.69 630.92 25.085 Potri.012G127500.1.v4.1 977 750.709 5747 470.775 ==> SRR7166203.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 715 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 497 SRR7166203 completed mapping pipeline successfully