Starting /dee2/code/volunteer_pipeline.sh SRR7166204 current disk space = 3104293941248 free memory = 1482406696 SRR7166204 SRAfilesize 8f565fd942a5aff192aae2bfc50e8ce7 SRR7166204.sra SRR7166204.sra file validated SRR7166204 is paired end SRR7166204 is conventional basespace SRR7166204 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8405 33.0 31.0 34.0 18.0 34.0 2 32.25175 33.0 31.0 34.0 29.0 34.0 3 31.80225 33.0 31.0 33.0 29.0 34.0 4 32.986 33.0 33.0 34.0 32.0 34.0 5 33.09025 33.0 33.0 34.0 33.0 34.0 6 36.22175 38.0 36.0 38.0 33.0 38.0 7 37.1845 38.0 38.0 38.0 36.0 38.0 8 37.34675 38.0 38.0 38.0 36.0 38.0 9 37.59525 38.0 38.0 38.0 38.0 38.0 10-14 37.64785 38.0 38.0 38.0 38.0 38.0 15-19 37.600449999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.650400000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.63665 38.0 38.0 38.0 38.0 38.0 30-34 37.62055 38.0 38.0 38.0 38.0 38.0 35-39 37.5914 38.0 38.0 38.0 38.0 38.0 40-44 37.54180000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.527950000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.49465 38.0 38.0 38.0 37.6 38.0 55-59 37.1139 38.0 38.0 38.0 37.0 38.0 60-64 37.30165 38.0 38.0 38.0 37.0 38.0 65-69 37.31455 38.0 38.0 38.0 37.0 38.0 70-74 37.30075 38.0 38.0 38.0 37.0 38.0 75-79 37.2789 38.0 38.0 38.0 37.0 38.0 80-84 37.15495 38.0 38.0 38.0 36.0 38.0 85-89 37.05055 38.0 38.0 38.0 36.0 38.0 90-94 36.93055 38.0 38.0 38.0 35.6 38.0 95-99 36.8834 38.0 38.0 38.0 35.6 38.0 100-104 36.7599 38.0 38.0 38.0 35.0 38.0 105-109 36.65695 38.0 38.0 38.0 34.6 38.0 110-114 36.601749999999996 38.0 38.0 38.0 34.4 38.0 115-119 36.459500000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.24165000000001 38.0 37.6 38.0 33.6 38.0 125-129 36.126250000000006 38.0 37.2 38.0 33.4 38.0 130-134 35.922399999999996 38.0 36.8 38.0 33.0 38.0 135-139 35.75455 38.0 36.4 38.0 32.2 38.0 140-144 35.443400000000004 38.0 36.0 38.0 31.0 38.0 145-149 35.0052 38.0 36.0 38.0 29.2 38.0 150-151 32.033375 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 2.0 21 0.0 22 5.0 23 0.0 24 4.0 25 5.0 26 10.0 27 11.0 28 13.0 29 19.0 30 22.0 31 40.0 32 62.0 33 70.0 34 133.0 35 251.0 36 626.0 37 2717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.12667353244078 16.29763130792997 12.873326467559219 33.70236869207003 2 20.200000000000003 23.425 38.9 17.474999999999998 3 17.95 30.575000000000003 26.5 24.975 4 20.474999999999998 37.175000000000004 21.775 20.575 5 20.075093867334168 38.698372966207764 24.20525657071339 17.02127659574468 6 16.45 36.625 24.925 22.0 7 12.8 21.0 46.2 20.0 8 16.775000000000002 20.0 30.325000000000003 32.9 9 17.575 21.7 31.3 29.425 10-14 19.220000000000002 30.294999999999998 27.32 23.165 15-19 20.435 29.015 27.405 23.145 20-24 19.575 29.465000000000003 27.72 23.24 25-29 19.98 29.49 28.000000000000004 22.53 30-34 20.29 29.354999999999997 27.675 22.68 35-39 20.02 29.365000000000002 27.700000000000003 22.915 40-44 19.86 29.335 27.735 23.07 45-49 19.645000000000003 28.89 27.98 23.485 50-54 20.25 28.485 27.575 23.69 55-59 20.10395115305041 28.490689811777763 27.774133319876874 23.63122571529495 60-64 19.82780197226811 29.664113730790408 27.556690193722783 22.9513941032187 65-69 20.169999999999998 28.79 28.13 22.91 70-74 20.235 28.82 27.63 23.315 75-79 20.03 28.65 27.839999999999996 23.48 80-84 20.085 29.23 27.435 23.25 85-89 20.435 28.884999999999998 27.565 23.115 90-94 20.16 29.07 27.465 23.305 95-99 20.5 28.95 27.29 23.26 100-104 20.986789431545237 28.7179743795036 27.547037630104082 22.748198558847076 105-109 20.42359303024234 29.125776086521128 27.102944121770477 23.34768676146605 110-114 20.990000000000002 28.83 27.67 22.509999999999998 115-119 20.755000000000003 28.744999999999997 27.05 23.45 120-124 20.335 29.285 27.26 23.119999999999997 125-129 20.474999999999998 29.09 27.065 23.369999999999997 130-134 21.22 29.115000000000002 26.665 23.0 135-139 21.099999999999998 28.655 26.665 23.580000000000002 140-144 20.849999999999998 29.459999999999997 26.384999999999998 23.305 145-149 21.095 28.78 26.479999999999997 23.645 150-151 20.583448103167648 28.771754100413172 26.242644296982597 24.402153499436587 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 5.0 25 9.5 26 12.0 27 11.5 28 12.5 29 20.5 30 25.0 31 35.5 32 44.0 33 59.5 34 79.0 35 88.0 36 107.0 37 128.0 38 147.5 39 179.0 40 210.0 41 212.0 42 230.5 43 256.0 44 276.0 45 281.5 46 258.0 47 237.0 48 210.0 49 184.0 50 149.0 51 112.0 52 92.0 53 81.0 54 62.0 55 39.0 56 32.5 57 26.0 58 15.5 59 13.5 60 11.5 61 9.0 62 9.5 63 8.5 64 4.5 65 2.5 66 3.0 67 2.5 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.915 60-64 0.11499999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.13999999999999999 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 5.050000000000001 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTT 10 0.006832588 144.9875 9 >>END_MODULE SRR7166204 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.023 33.0 33.0 34.0 32.0 34.0 2 33.1495 33.0 33.0 34.0 32.0 34.0 3 33.14475 34.0 33.0 34.0 32.0 34.0 4 33.16 34.0 33.0 34.0 33.0 34.0 5 33.16875 34.0 33.0 34.0 33.0 34.0 6 37.40075 38.0 38.0 38.0 37.0 38.0 7 37.4275 38.0 38.0 38.0 37.0 38.0 8 37.4035 38.0 38.0 38.0 37.0 38.0 9 37.45075 38.0 38.0 38.0 37.0 38.0 10-14 37.3515 38.0 38.0 38.0 37.0 38.0 15-19 37.36655 38.0 38.0 38.0 37.0 38.0 20-24 37.33545 38.0 38.0 38.0 37.0 38.0 25-29 37.255700000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.26825 38.0 38.0 38.0 36.8 38.0 35-39 37.1696 38.0 38.0 38.0 36.2 38.0 40-44 37.132400000000004 38.0 38.0 38.0 36.4 38.0 45-49 37.0313 38.0 38.0 38.0 36.0 38.0 50-54 36.8441 38.0 38.0 38.0 35.2 38.0 55-59 36.8261 38.0 38.0 38.0 35.2 38.0 60-64 36.76455 38.0 38.0 38.0 35.0 38.0 65-69 36.77419999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.6032 38.0 38.0 38.0 34.4 38.0 75-79 36.513650000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.37035 38.0 37.8 38.0 34.0 38.0 85-89 36.16115 38.0 37.0 38.0 33.0 38.0 90-94 36.060649999999995 38.0 37.0 38.0 32.8 38.0 95-99 35.79255 38.0 37.0 38.0 32.0 38.0 100-104 35.7307 38.0 37.0 38.0 31.0 38.0 105-109 35.379999999999995 38.0 36.0 38.0 29.0 38.0 110-114 35.15355 38.0 36.0 38.0 28.4 38.0 115-119 34.8771 38.0 35.4 38.0 27.4 38.0 120-124 34.4602 38.0 35.0 38.0 25.0 38.0 125-129 34.256899999999995 38.0 35.0 38.0 24.0 38.0 130-134 33.602599999999995 38.0 34.0 38.0 21.8 38.0 135-139 33.0841 38.0 33.8 38.0 16.2 38.0 140-144 32.11175 37.0 32.8 38.0 14.0 38.0 145-149 30.782049999999998 36.8 31.0 38.0 6.4 38.0 150-151 25.951375 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 3.0 11 0.0 12 1.0 13 1.0 14 3.0 15 7.0 16 1.0 17 5.0 18 1.0 19 9.0 20 9.0 21 15.0 22 12.0 23 17.0 24 15.0 25 18.0 26 22.0 27 20.0 28 27.0 29 40.0 30 59.0 31 85.0 32 110.0 33 162.0 34 224.0 35 435.0 36 967.0 37 1731.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.35 14.075 16.25 31.324999999999996 2 24.05 22.225 36.225 17.5 3 19.5 26.075 34.599999999999994 19.825 4 24.5 34.300000000000004 21.55 19.650000000000002 5 23.799999999999997 37.425000000000004 22.075 16.7 6 17.1 37.175000000000004 24.825 20.9 7 16.125 15.625 46.949999999999996 21.3 8 20.625 20.275000000000002 29.175 29.925 9 22.275 22.5 29.275000000000002 25.95 10-14 22.57 29.375 26.965 21.09 15-19 22.975 27.33 28.744999999999997 20.95 20-24 22.34 28.17 28.475 21.015 25-29 22.564999999999998 28.76 27.72 20.955 30-34 22.994999999999997 27.525 28.685 20.794999999999998 35-39 22.645 28.24 28.28 20.835 40-44 22.900000000000002 27.815 28.52 20.765 45-49 23.22 27.07 29.459999999999997 20.25 50-54 23.03 27.365000000000002 28.965000000000003 20.64 55-59 23.26 27.639999999999997 28.685 20.415 60-64 22.78 27.474999999999998 28.93 20.815 65-69 23.35 28.37 27.700000000000003 20.580000000000002 70-74 22.955000000000002 27.985 28.615000000000002 20.445 75-79 22.605 28.305000000000003 28.74 20.349999999999998 80-84 22.98 27.605 29.235 20.18 85-89 23.25 28.17 28.265 20.315 90-94 23.59 28.050000000000004 28.515 19.845 95-99 23.1 28.24 28.449999999999996 20.21 100-104 23.87 27.744999999999997 28.315 20.07 105-109 24.065 28.349999999999998 27.805000000000003 19.78 110-114 23.849999999999998 28.000000000000004 27.83 20.32 115-119 23.705000000000002 28.675 28.044999999999998 19.575 120-124 23.905 28.02 28.225 19.85 125-129 23.94 27.975 28.044999999999998 20.04 130-134 24.11 28.565 27.884999999999998 19.439999999999998 135-139 24.765 28.32 27.735 19.18 140-144 25.585 28.1 27.215 19.1 145-149 25.45 28.33 27.345000000000002 18.875 150-151 25.74430823117338 26.832624468351263 28.096072054040533 19.326995246434826 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 2.0 25 1.0 26 5.0 27 9.5 28 11.5 29 11.0 30 13.0 31 27.0 32 37.0 33 43.0 34 57.0 35 73.5 36 93.0 37 121.5 38 147.0 39 179.5 40 198.0 41 221.5 42 255.5 43 274.5 44 284.5 45 284.5 46 261.5 47 241.5 48 232.5 49 190.0 50 138.5 51 118.0 52 119.5 53 93.0 54 64.0 55 46.5 56 33.0 57 26.5 58 21.0 59 16.0 60 10.5 61 7.0 62 4.0 63 3.5 64 4.0 65 4.5 66 3.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.112500000000001 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.225 0.0 0.0 0.0 0.0 134-135 7.925000000000001 0.0 0.0 0.0 0.0 136-137 8.6625 0.0 0.0 0.0 0.0 138-139 9.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809751 spots for SRR7166204.sra Written 809751 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra Read 809740 spots for SRR7166204.sra Written 809740 spots for SRR7166204.sra SRR ids: ['SRR7166204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kzi7vmh6 SRR7166204.sra spots: 16194811 blocks: [[1, 809740], [809741, 1619480], [1619481, 2429220], [2429221, 3238960], [3238961, 4048700], [4048701, 4858440], [4858441, 5668180], [5668181, 6477920], [6477921, 7287660], [7287661, 8097400], [8097401, 8907140], [8907141, 9716880], [9716881, 10526620], [10526621, 11336360], [11336361, 12146100], [12146101, 12955840], [12955841, 13765580], [13765581, 14575320], [14575321, 15385060], [15385061, 16194811]] SRR7166204 file size 5466189 SRR7166204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166204 SRR7166204_1.fastq SRR7166204_2.fastq Input file: SRR7166204_1.fastq Paired file: SRR7166204_2.fastq trimmed: SRR7166204-trimmed-pair1.fastq, SRR7166204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 01:30:04 2025 >> started Sat Feb 15 01:30:22 2025 >> done (18.733s) 16194811 read pairs processed; of these: 6187 ( 0.04%) short read pairs filtered out after trimming by size control 5863 ( 0.04%) empty read pairs filtered out after trimming by size control 16182761 (99.93%) read pairs available; of these: 8027808 (49.61%) trimmed read pairs available after processing 8154953 (50.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 6 0.00% 27 2 0.00% 28 3 0.00% 29 6 0.00% 30 3 0.00% 31 10 0.00% 32 7 0.00% 33 13 0.00% 34 6 0.00% 35 10 0.00% 36 5 0.00% 37 9 0.00% 38 14 0.00% 39 11 0.00% 40 14 0.00% 41 15 0.00% 42 12 0.00% 43 12 0.00% 44 20 0.00% 45 22 0.00% 46 35 0.00% 47 38 0.00% 48 35 0.00% 49 40 0.00% 50 57 0.00% 51 57 0.00% 52 69 0.00% 53 77 0.00% 54 79 0.00% 55 83 0.00% 56 109 0.00% 57 141 0.00% 58 165 0.00% 59 175 0.00% 60 202 0.00% 61 239 0.00% 62 276 0.00% 63 307 0.00% 64 349 0.00% 65 356 0.00% 66 407 0.00% 67 523 0.00% 68 615 0.00% 69 715 0.00% 70 789 0.00% 71 849 0.01% 72 1094 0.01% 73 1244 0.01% 74 1317 0.01% 75 1619 0.01% 76 1764 0.01% 77 1894 0.01% 78 2236 0.01% 79 2457 0.02% 80 2859 0.02% 81 3141 0.02% 82 3667 0.02% 83 4154 0.03% 84 4828 0.03% 85 5392 0.03% 86 5940 0.04% 87 6444 0.04% 88 7129 0.04% 89 7717 0.05% 90 8389 0.05% 91 8939 0.06% 92 10083 0.06% 93 10715 0.07% 94 11824 0.07% 95 12578 0.08% 96 13390 0.08% 97 14128 0.09% 98 15087 0.09% 99 16317 0.10% 100 16533 0.10% 101 17728 0.11% 102 19043 0.12% 103 20166 0.12% 104 21252 0.13% 105 22275 0.14% 106 23602 0.15% 107 24263 0.15% 108 25572 0.16% 109 26684 0.16% 110 27543 0.17% 111 29498 0.18% 112 30790 0.19% 113 32271 0.20% 114 33632 0.21% 115 35496 0.22% 116 36613 0.23% 117 37623 0.23% 118 38926 0.24% 119 40171 0.25% 120 41294 0.26% 121 43038 0.27% 122 44775 0.28% 123 47604 0.29% 124 49548 0.31% 125 51059 0.32% 126 52717 0.33% 127 54792 0.34% 128 56556 0.35% 129 58684 0.36% 130 60516 0.37% 131 62844 0.39% 132 66185 0.41% 133 69531 0.43% 134 72909 0.45% 135 76458 0.47% 136 80007 0.49% 137 83607 0.52% 138 88799 0.55% 139 94179 0.58% 140 99758 0.62% 141 108830 0.67% 142 119218 0.74% 143 132225 0.82% 144 150688 0.93% 145 177258 1.10% 146 214436 1.33% 147 282704 1.75% 148 414015 2.56% 149 781013 4.83% 150 3539509 21.87% 151 8154953 50.39% 16182761 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.4 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=89.88 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.2 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=26 prefix-density=0.26 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=74.20 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.3 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7166204 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 01:31:32 Started mapping on | Feb 15 01:31:32 Finished on | Feb 15 01:33:44 Mapping speed, Million of reads per hour | 441.35 Number of input reads | 16182761 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15115118 Uniquely mapped reads % | 93.40% Average mapped length | 292.22 Number of splices: Total | 14243903 Number of splices: Annotated (sjdb) | 13974829 Number of splices: GT/AG | 14013631 Number of splices: GC/AG | 173520 Number of splices: AT/AC | 10262 Number of splices: Non-canonical | 46490 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358722 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 66394 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 715598 715598 715598 N_multimapping 358722 358722 358722 N_noFeature 526176 14929424 627773 N_ambiguous 171166 1128 86287 UnstrandedReadsAssigned:14417776 PositiveStrandReadsAssigned:184566 NegativeStrandReadsAssigned:14401058 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166204-trimmed-pair1.fastq SRR7166204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,182,761 reads, 14,310,610 reads pseudoaligned [quant] estimated average fragment length: 225.147 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7166204.ke.tsv 34699 SRR7166204.se.tsv 87100 total ==> SRR7166204.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.85 2051 81.6817 Potri.005G024800.1.v4.1 1035 810.853 1606 141.498 Potri.004G059700.1.v4.1 961 736.873 9 0.872561 Potri.007G009000.2.v4.1 1416 1191.85 0 0 Potri.003G141000.2.v4.1 2943 2718.85 867 22.7813 Potri.016G087400.1.v4.1 270 87.6566 613 499.599 Potri.015G069301.1.v4.1 564 342.938 0 0 Potri.010G195200.1.v4.1 1773 1548.85 432.876 19.9664 Potri.012G127500.1.v4.1 977 752.863 5701 540.979 ==> SRR7166204.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 417 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 182 SRR7166204 completed mapping pipeline successfully