Starting /dee2/code/volunteer_pipeline.sh SRR7166205 current disk space = 3104965447680 free memory = 1456358228 SRR7166205 SRAfilesize 0f1afe1d64473ca608a6bee41d04cf0c SRR7166205.sra SRR7166205.sra file validated SRR7166205 is paired end SRR7166205 is conventional basespace SRR7166205 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74875 33.0 32.0 34.0 28.0 34.0 2 32.09125 33.0 31.0 34.0 29.0 34.0 3 31.9175 33.0 31.0 34.0 29.0 34.0 4 32.2055 33.0 33.0 34.0 31.0 34.0 5 32.43175 33.0 33.0 34.0 31.0 34.0 6 36.61325 38.0 37.0 38.0 34.0 38.0 7 36.9815 38.0 38.0 38.0 35.0 38.0 8 37.13075 38.0 38.0 38.0 36.0 38.0 9 37.0765 38.0 38.0 38.0 36.0 38.0 10-14 36.93795 38.0 38.0 38.0 35.2 38.0 15-19 36.815 38.0 38.0 38.0 34.8 38.0 20-24 36.9433 38.0 38.0 38.0 35.4 38.0 25-29 36.605599999999995 38.0 38.0 38.0 34.0 38.0 30-34 36.376650000000005 38.0 37.2 38.0 33.4 38.0 35-39 36.26065 38.0 37.0 38.0 33.0 38.0 40-44 36.1379 38.0 37.0 38.0 32.8 38.0 45-49 36.1308 38.0 37.0 38.0 32.4 38.0 50-54 36.0596 38.0 37.0 38.0 32.2 38.0 55-59 35.935199999999995 38.0 37.0 38.0 31.4 38.0 60-64 35.571349999999995 38.0 36.2 38.0 29.0 38.0 65-69 35.66105 38.0 36.2 38.0 29.4 38.0 70-74 35.64919999999999 38.0 36.0 38.0 29.2 38.0 75-79 35.0159 38.0 35.8 38.0 28.2 38.0 80-84 34.750350000000005 38.0 35.8 38.0 26.8 38.0 85-89 34.49105 38.0 34.4 38.0 25.6 38.0 90-94 34.87925 38.0 35.2 38.0 27.4 38.0 95-99 34.174400000000006 38.0 34.4 38.0 22.4 38.0 100-104 33.6356 37.8 33.6 38.0 18.2 38.0 105-109 33.52455 37.4 33.6 38.0 19.8 38.0 110-114 32.53195 37.0 31.0 38.0 15.0 38.0 115-119 32.76774999999999 37.0 31.2 38.0 15.0 38.0 120-124 31.90135 36.4 29.4 38.0 15.0 38.0 125-129 31.791800000000002 36.6 29.8 38.0 15.0 38.0 130-134 30.50965 35.4 26.0 38.0 14.2 38.0 135-139 29.30625 33.8 23.6 38.0 13.2 38.0 140-144 27.59995 33.6 18.8 38.0 2.0 38.0 145-149 25.76305 32.8 10.8 38.0 2.0 38.0 150-151 19.550625 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 4.0 17 5.0 18 6.0 19 1.0 20 10.0 21 17.0 22 20.0 23 29.0 24 49.0 25 51.0 26 76.0 27 98.0 28 91.0 29 133.0 30 154.0 31 182.0 32 243.0 33 316.0 34 417.0 35 576.0 36 858.0 37 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.33872598584429 15.621840242669363 11.47623862487361 37.563195146612735 2 18.85 25.35 37.95 17.849999999999998 3 17.8 28.849999999999998 27.0 26.35 4 21.275 37.5 21.6 19.625 5 20.424999999999997 37.425000000000004 24.425 17.724999999999998 6 15.575 37.1 26.05 21.275 7 11.725 20.200000000000003 46.7 21.375 8 17.349999999999998 21.099999999999998 29.4 32.15 9 16.900000000000002 21.975 32.925 28.199999999999996 10-14 18.790000000000003 31.215 26.455000000000002 23.54 15-19 19.245 28.970000000000002 27.944999999999997 23.84 20-24 19.220000000000002 29.255 27.36 24.165 25-29 19.470000000000002 29.349999999999998 27.79 23.39 30-34 19.555 29.244999999999997 27.250000000000004 23.95 35-39 19.555 29.01 28.12 23.315 40-44 19.805 29.2 27.529999999999998 23.465 45-49 18.725 29.65 27.61 24.015 50-54 19.105 28.860000000000003 28.01 24.025 55-59 19.225 29.375 27.339999999999996 24.060000000000002 60-64 19.13 28.96 28.125 23.785 65-69 19.41 28.15 28.52 23.919999999999998 70-74 19.400370388908353 29.526002302417538 27.323689874368085 23.74993743430602 75-79 19.83274201723264 28.606183476938675 27.49113025848961 24.069944247339077 80-84 19.236431943950855 29.5730314261055 27.57272681118952 23.617809818754125 85-89 19.585 29.17 27.905 23.34 90-94 19.57 29.054999999999996 28.050000000000004 23.325000000000003 95-99 19.580000000000002 28.955 27.779999999999998 23.685000000000002 100-104 19.545 29.044999999999998 27.88 23.53 105-109 19.55 29.075 27.985 23.39 110-114 20.015 28.939999999999998 27.775 23.27 115-119 20.555 28.405 27.560000000000002 23.48 120-124 20.612214274996248 28.690041514530083 27.329565347871753 23.36817886260191 125-129 20.281224979983985 29.25340272217774 26.72137710168134 23.743995196156924 130-134 20.5531207495844 28.960757644451164 27.12709687169412 23.359024734270314 135-139 19.863870677143286 28.221810720184177 27.88649216755918 24.027826435113358 140-144 20.647226529285252 28.28990146551293 26.904416545791026 24.158455459410792 145-149 20.68671679197995 28.401002506265666 26.902255639097746 24.01002506265664 150-151 22.005257228689448 27.60045061960195 26.19852296908249 24.195769182626112 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 2.0 24 2.5 25 3.0 26 4.0 27 6.5 28 12.0 29 16.5 30 22.5 31 34.0 32 45.5 33 58.5 34 74.5 35 89.5 36 119.0 37 150.5 38 166.5 39 172.5 40 194.5 41 232.5 42 260.0 43 279.0 44 280.0 45 263.0 46 249.5 47 241.0 48 209.5 49 166.5 50 135.0 51 119.5 52 95.0 53 68.5 54 59.5 55 47.5 56 30.0 57 19.5 58 18.5 59 15.0 60 8.5 61 5.0 62 4.0 63 1.5 64 2.0 65 3.5 66 2.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.105 75-79 1.35 80-84 1.5150000000000001 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.08 130-134 0.745 135-139 0.095 140-144 0.034999999999999996 145-149 0.25 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.5875000000000004 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166205 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.694 33.0 33.0 34.0 32.0 34.0 2 32.77675 33.0 33.0 34.0 32.0 34.0 3 32.79725 34.0 33.0 34.0 32.0 34.0 4 32.7305 34.0 33.0 34.0 32.0 34.0 5 32.72975 34.0 33.0 34.0 32.0 34.0 6 36.7125 38.0 38.0 38.0 35.0 38.0 7 36.8535 38.0 38.0 38.0 35.0 38.0 8 36.83375 38.0 38.0 38.0 35.0 38.0 9 36.911 38.0 38.0 38.0 36.0 38.0 10-14 36.67545 38.0 38.0 38.0 34.4 38.0 15-19 36.69134999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.49145 38.0 38.0 38.0 34.0 38.0 25-29 36.6221 38.0 38.0 38.0 34.6 38.0 30-34 36.650150000000004 38.0 38.0 38.0 34.6 38.0 35-39 36.5024 38.0 38.0 38.0 34.2 38.0 40-44 36.3437 38.0 38.0 38.0 33.6 38.0 45-49 36.144149999999996 38.0 37.8 38.0 32.8 38.0 50-54 36.05095 38.0 37.4 38.0 31.8 38.0 55-59 36.077549999999995 38.0 37.2 38.0 32.4 38.0 60-64 35.9671 38.0 37.2 38.0 31.4 38.0 65-69 35.98 38.0 37.0 38.0 31.8 38.0 70-74 35.76965 38.0 37.0 38.0 30.6 38.0 75-79 35.6836 38.0 37.0 38.0 30.2 38.0 80-84 35.602500000000006 38.0 37.0 38.0 29.6 38.0 85-89 35.55345 38.0 36.6 38.0 29.8 38.0 90-94 35.290200000000006 38.0 36.0 38.0 29.0 38.0 95-99 34.7953 38.0 35.4 38.0 26.4 38.0 100-104 34.6032 38.0 35.2 38.0 25.6 38.0 105-109 34.606049999999996 38.0 35.0 38.0 25.6 38.0 110-114 34.29625 38.0 34.6 38.0 23.2 38.0 115-119 33.84915 38.0 34.0 38.0 21.0 38.0 120-124 33.2639 38.0 33.6 38.0 16.2 38.0 125-129 32.503949999999996 37.4 31.0 38.0 15.0 38.0 130-134 31.810950000000002 36.8 30.6 38.0 14.6 38.0 135-139 31.263150000000003 36.0 30.6 38.0 13.2 38.0 140-144 30.290700000000005 36.0 28.6 38.0 10.4 38.0 145-149 27.699599999999997 34.2 18.6 38.0 2.0 38.0 150-151 21.986125 27.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 3.0 6 0.0 7 1.0 8 1.0 9 2.0 10 3.0 11 2.0 12 2.0 13 2.0 14 4.0 15 6.0 16 6.0 17 6.0 18 3.0 19 6.0 20 7.0 21 10.0 22 21.0 23 24.0 24 34.0 25 43.0 26 49.0 27 52.0 28 89.0 29 82.0 30 109.0 31 141.0 32 188.0 33 237.0 34 279.0 35 431.0 36 779.0 37 1371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875 15.675 14.124999999999998 31.324999999999996 2 22.475 23.925 38.475 15.125 3 21.224999999999998 26.400000000000002 31.900000000000002 20.474999999999998 4 25.35 35.4 21.15 18.099999999999998 5 23.275000000000002 37.175000000000004 22.400000000000002 17.150000000000002 6 16.6 39.725 24.55 19.125 7 15.65 15.275 47.425 21.65 8 21.349999999999998 21.175 28.375 29.099999999999998 9 22.3 21.25 29.349999999999998 27.1 10-14 22.35 28.92 27.965 20.765 15-19 23.025000000000002 28.134999999999998 28.804999999999996 20.035 20-24 23.1 28.71 27.794999999999998 20.395 25-29 22.855 28.299999999999997 28.804999999999996 20.04 30-34 22.8 28.09 28.67 20.44 35-39 23.175 28.17 28.660000000000004 19.994999999999997 40-44 23.145 28.084999999999997 28.345 20.424999999999997 45-49 23.305 28.065 28.49 20.14 50-54 22.855 28.32 28.970000000000002 19.855 55-59 23.57 27.944999999999997 28.505000000000003 19.98 60-64 23.125 28.185 28.95 19.74 65-69 23.565 27.72 28.54 20.175 70-74 23.43 28.015 28.685 19.869999999999997 75-79 23.62 27.91 28.095 20.375 80-84 23.294999999999998 28.15 28.470000000000002 20.085 85-89 24.005000000000003 27.18 29.065 19.75 90-94 23.080000000000002 27.450000000000003 29.385 20.085 95-99 24.18 27.88 28.53 19.41 100-104 23.674999999999997 28.499999999999996 28.035 19.79 105-109 24.132413241324134 27.997799779978 28.66786678667867 19.2019201920192 110-114 24.14620731036552 28.21141057052853 28.356417820891046 19.28596429821491 115-119 23.665 28.175 28.299999999999997 19.86 120-124 23.955000000000002 27.455000000000002 28.575 20.015 125-129 24.63 28.08 28.125 19.165 130-134 25.355 27.235 27.98 19.43 135-139 24.625 27.82 28.825 18.73 140-144 25.319999999999997 28.294999999999998 27.58 18.805 145-149 25.775 28.26 26.640000000000004 19.325 150-151 26.6125 28.3125 27.200000000000003 17.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 4.5 26 4.5 27 8.0 28 9.5 29 10.0 30 15.0 31 20.0 32 34.5 33 50.0 34 56.5 35 76.0 36 100.5 37 117.0 38 149.5 39 177.5 40 203.0 41 228.0 42 258.5 43 290.0 44 300.5 45 302.5 46 260.5 47 233.5 48 230.0 49 198.0 50 163.0 51 128.5 52 100.0 53 75.5 54 50.0 55 31.5 56 25.5 57 23.0 58 19.5 59 13.5 60 6.0 61 5.5 62 4.5 63 1.5 64 1.5 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.2762430939226519 0.5499999999999999 3 0.05022601707684581 0.15 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 6.075 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCAAA 10 0.006830828 145.0 6 TTTTTTT 20 0.00593511 29.0 95-99 >>END_MODULE Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764579 spots for SRR7166205.sra Written 764579 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra Read 764572 spots for SRR7166205.sra Written 764572 spots for SRR7166205.sra SRR ids: ['SRR7166205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_drdp7i77 SRR7166205.sra spots: 15291447 blocks: [[1, 764572], [764573, 1529144], [1529145, 2293716], [2293717, 3058288], [3058289, 3822860], [3822861, 4587432], [4587433, 5352004], [5352005, 6116576], [6116577, 6881148], [6881149, 7645720], [7645721, 8410292], [8410293, 9174864], [9174865, 9939436], [9939437, 10704008], [10704009, 11468580], [11468581, 12233152], [12233153, 12997724], [12997725, 13762296], [13762297, 14526868], [14526869, 15291447]] SRR7166205 file size 5160069 SRR7166205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166205 SRR7166205_1.fastq SRR7166205_2.fastq Input file: SRR7166205_1.fastq Paired file: SRR7166205_2.fastq trimmed: SRR7166205-trimmed-pair1.fastq, SRR7166205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 00:55:36 2025 >> started Sat Feb 15 00:56:00 2025 >> done (23.988s) 15291447 read pairs processed; of these: 10666 ( 0.07%) short read pairs filtered out after trimming by size control 7600 ( 0.05%) empty read pairs filtered out after trimming by size control 15273181 (99.88%) read pairs available; of these: 10081329 (66.01%) trimmed read pairs available after processing 5191852 (33.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 3 0.00% 27 7 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 3 0.00% 32 2 0.00% 33 6 0.00% 34 6 0.00% 35 8 0.00% 36 10 0.00% 37 9 0.00% 38 11 0.00% 39 10 0.00% 40 15 0.00% 41 17 0.00% 42 12 0.00% 43 20 0.00% 44 16 0.00% 45 25 0.00% 46 25 0.00% 47 44 0.00% 48 30 0.00% 49 39 0.00% 50 48 0.00% 51 60 0.00% 52 65 0.00% 53 67 0.00% 54 83 0.00% 55 87 0.00% 56 92 0.00% 57 126 0.00% 58 135 0.00% 59 181 0.00% 60 171 0.00% 61 220 0.00% 62 224 0.00% 63 238 0.00% 64 257 0.00% 65 316 0.00% 66 384 0.00% 67 408 0.00% 68 527 0.00% 69 543 0.00% 70 670 0.00% 71 753 0.00% 72 832 0.01% 73 966 0.01% 74 1122 0.01% 75 1223 0.01% 76 1475 0.01% 77 1600 0.01% 78 1751 0.01% 79 2025 0.01% 80 2293 0.02% 81 2625 0.02% 82 2862 0.02% 83 3389 0.02% 84 4114 0.03% 85 4636 0.03% 86 5057 0.03% 87 5513 0.04% 88 5865 0.04% 89 6444 0.04% 90 7174 0.05% 91 7889 0.05% 92 8369 0.05% 93 9134 0.06% 94 10050 0.07% 95 10259 0.07% 96 11336 0.07% 97 12052 0.08% 98 12812 0.08% 99 13958 0.09% 100 15001 0.10% 101 15898 0.10% 102 16954 0.11% 103 17913 0.12% 104 19310 0.13% 105 20268 0.13% 106 21417 0.14% 107 22309 0.15% 108 23064 0.15% 109 24738 0.16% 110 25971 0.17% 111 27922 0.18% 112 29256 0.19% 113 31302 0.20% 114 33279 0.22% 115 34654 0.23% 116 35846 0.23% 117 37840 0.25% 118 39959 0.26% 119 41540 0.27% 120 43946 0.29% 121 46580 0.30% 122 48187 0.32% 123 51241 0.34% 124 54454 0.36% 125 57847 0.38% 126 60692 0.40% 127 64556 0.42% 128 68184 0.45% 129 71397 0.47% 130 75983 0.50% 131 81388 0.53% 132 87673 0.57% 133 93801 0.61% 134 100853 0.66% 135 110135 0.72% 136 115384 0.76% 137 122321 0.80% 138 133730 0.88% 139 149255 0.98% 140 170187 1.11% 141 168401 1.10% 142 184574 1.21% 143 207426 1.36% 144 241686 1.58% 145 292283 1.91% 146 369476 2.42% 147 491438 3.22% 148 687592 4.50% 149 1206417 7.90% 150 3726965 24.40% 151 5191852 33.99% 15273181 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=14 prefix-density=1.00 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=31.42 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.2 sequence=TTATTTATTATTAATACCATTTTGGATTTACTCCATAGAATATTGAAATGGACAGGCGTTTTGTTCTTCTTGTGATAATGTATCTGTAACACTGGTAGACAGGACCTCGACATCTTTGACTCCAACACGCCGCCTCATATTTAGAAAAAGTGGAAGATTTTTAATCACTGTCGCTGTCACTGCTGCTATGGCCATCATGACCATGCTTCTTCTCCT criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=17 prefix-density=0.92 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=49.68 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=13.9 sequence=TTGGTGCTGAGA SRR7166205 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 00:57:08 Started mapping on | Feb 15 00:57:09 Finished on | Feb 15 00:59:01 Mapping speed, Million of reads per hour | 490.92 Number of input reads | 15273181 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14543478 Uniquely mapped reads % | 95.22% Average mapped length | 290.30 Number of splices: Total | 13553153 Number of splices: Annotated (sjdb) | 13272278 Number of splices: GT/AG | 13337895 Number of splices: GC/AG | 169036 Number of splices: AT/AC | 10361 Number of splices: Non-canonical | 35861 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336403 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 41841 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 404731 404731 404731 N_multimapping 336403 336403 336403 N_noFeature 575507 14366098 672143 N_ambiguous 153431 842 72176 UnstrandedReadsAssigned:13814540 PositiveStrandReadsAssigned:176538 NegativeStrandReadsAssigned:13799159 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR7166205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166205-trimmed-pair1.fastq SRR7166205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,273,181 reads, 13,685,322 reads pseudoaligned [quant] estimated average fragment length: 232.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7166205.ke.tsv 34699 SRR7166205.se.tsv 87100 total ==> SRR7166205.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.79 1608 61.0955 Potri.005G024800.1.v4.1 1035 803.79 950 80.2376 Potri.004G059700.1.v4.1 961 729.79 11 1.02327 Potri.007G009000.2.v4.1 1416 1184.79 0 0 Potri.003G141000.2.v4.1 2943 2711.79 935 23.4074 Potri.016G087400.1.v4.1 270 83.8502 996 806.404 Potri.015G069301.1.v4.1 564 335.615 0 0 Potri.010G195200.1.v4.1 1773 1541.79 545 23.9976 Potri.012G127500.1.v4.1 977 745.79 4898 445.861 ==> SRR7166205.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 491 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 261 SRR7166205 completed mapping pipeline successfully