Starting /dee2/code/volunteer_pipeline.sh SRR7166206 current disk space = 3103854866432 free memory = 1579332072 SRR7166206 SRAfilesize f5e7dabed1c78f1ffcf539018c7cb6e1 SRR7166206.sra SRR7166206.sra file validated SRR7166206 is paired end SRR7166206 is conventional basespace SRR7166206 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.04175 18.0 18.0 32.0 18.0 33.0 2 24.808 25.0 18.0 29.0 18.0 33.0 3 28.5535 29.0 27.0 31.0 25.0 33.0 4 24.9245 28.0 15.0 31.0 15.0 33.0 5 28.4065 32.0 27.0 32.0 15.0 33.0 6 35.74175 37.0 36.0 38.0 31.0 38.0 7 37.1785 38.0 37.0 38.0 36.0 38.0 8 37.50675 38.0 38.0 38.0 37.0 38.0 9 37.5275 38.0 38.0 38.0 37.0 38.0 10-14 37.546299999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.596450000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.63905 38.0 38.0 38.0 38.0 38.0 25-29 37.55935 38.0 38.0 38.0 38.0 38.0 30-34 37.5735 38.0 38.0 38.0 38.0 38.0 35-39 37.56335 38.0 38.0 38.0 38.0 38.0 40-44 37.5426 38.0 38.0 38.0 38.0 38.0 45-49 37.48115 38.0 38.0 38.0 37.0 38.0 50-54 37.08845 38.0 38.0 38.0 36.8 38.0 55-59 36.684749999999994 38.0 38.0 38.0 36.2 38.0 60-64 36.97055 38.0 38.0 38.0 36.2 38.0 65-69 37.245799999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.12785000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.125099999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.005050000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.9034 38.0 38.0 38.0 35.2 38.0 90-94 36.89885 38.0 38.0 38.0 35.8 38.0 95-99 36.691250000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.5293 38.0 38.0 38.0 34.4 38.0 105-109 36.174749999999996 38.0 38.0 38.0 33.8 38.0 110-114 36.3811 38.0 38.0 38.0 34.0 38.0 115-119 36.1355 38.0 37.6 38.0 33.6 38.0 120-124 35.9913 38.0 37.0 38.0 33.0 38.0 125-129 35.81765 38.0 36.8 38.0 32.2 38.0 130-134 35.70805 38.0 36.4 38.0 31.8 38.0 135-139 35.3953 38.0 36.0 38.0 30.6 38.0 140-144 35.22975 38.0 36.0 38.0 30.2 38.0 145-149 34.67865 38.0 35.4 38.0 28.0 38.0 150-151 31.491 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 4.0 21 1.0 22 4.0 23 4.0 24 8.0 25 12.0 26 15.0 27 20.0 28 26.0 29 40.0 30 28.0 31 43.0 32 66.0 33 112.0 34 161.0 35 275.0 36 865.0 37 2310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.55360325948561 15.151515151515152 11.841100076394193 34.45378151260504 2 22.85 24.5 37.6 15.049999999999999 3 17.075000000000003 31.674999999999997 27.875 23.375 4 23.225 35.375 21.65 19.75 5 21.030257564391096 38.13453363340835 23.1807951987997 17.65441360340085 6 16.150000000000002 37.2 25.05 21.6 7 12.375 20.7 46.525 20.4 8 17.95 20.724999999999998 28.525 32.800000000000004 9 18.099999999999998 21.125 31.15 29.625 10-14 19.695 30.055 26.640000000000004 23.61 15-19 20.345 28.965000000000003 27.395000000000003 23.294999999999998 20-24 19.88 29.544999999999998 27.189999999999998 23.385 25-29 19.665 28.804999999999996 28.175 23.355 30-34 19.85 29.145 27.750000000000004 23.255 35-39 19.064999999999998 29.505 28.084999999999997 23.345 40-44 19.535 29.235 27.99 23.24 45-49 20.349999999999998 28.335 27.345000000000002 23.97 50-54 19.353048041986273 28.471941865159465 28.41643116673395 23.758578926120308 55-59 20.012211876049456 28.825115758408387 27.38004375922251 23.782628606319644 60-64 19.931444702086903 28.541183587055148 28.158080451658435 23.369291259199514 65-69 19.900000000000002 28.749999999999996 27.33 24.02 70-74 20.181144915932748 29.283426741393114 27.276821457165735 23.258606885508406 75-79 20.169999999999998 29.365000000000002 26.950000000000003 23.515 80-84 20.02 28.95 27.43 23.599999999999998 85-89 20.1 28.88 27.91 23.11 90-94 20.064999999999998 28.42 27.96 23.555 95-99 19.89 28.455000000000002 28.475 23.18 100-104 20.241676694745287 28.976133172884076 27.3164861612515 23.465703971119133 105-109 20.004040199989902 28.68036967829908 27.559214181101964 23.756375940609058 110-114 20.115 28.84 27.965 23.080000000000002 115-119 20.59280806459702 28.63232860223682 27.21299964892923 23.561863684236922 120-124 20.275000000000002 29.03 27.339999999999996 23.355 125-129 20.889312211750553 28.27351112893523 27.611790655704834 23.225386003609387 130-134 20.27 28.975 27.51 23.244999999999997 135-139 20.495 29.09 27.1 23.315 140-144 20.86 29.049999999999997 27.185 22.905 145-149 20.580000000000002 28.465 27.33 23.625 150-151 21.310655327663834 28.72686343171586 26.93846923461731 23.024012006003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 3.5 24 3.0 25 4.0 26 5.5 27 8.5 28 14.5 29 20.5 30 25.0 31 32.0 32 39.0 33 47.0 34 63.5 35 76.5 36 97.0 37 134.0 38 154.0 39 175.0 40 199.0 41 224.5 42 257.0 43 270.0 44 268.5 45 269.0 46 254.0 47 229.5 48 219.0 49 197.0 50 162.0 51 128.5 52 107.5 53 83.5 54 54.0 55 40.5 56 37.5 57 27.5 58 16.0 59 11.0 60 9.0 61 8.5 62 6.0 63 3.5 64 3.0 65 2.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.9199999999999999 55-59 1.735 60-64 0.8099999999999999 65-69 0.0 70-74 0.08 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.27999999999999997 105-109 0.9950000000000001 110-114 0.0 115-119 0.305 120-124 0.0 125-129 0.26 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.3375000000000004 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7166206 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.486 33.0 33.0 34.0 32.0 34.0 2 32.63075 33.0 33.0 34.0 32.0 34.0 3 32.74925 33.0 33.0 34.0 32.0 34.0 4 32.58375 33.0 33.0 34.0 32.0 34.0 5 32.6455 33.0 33.0 34.0 32.0 34.0 6 36.918 38.0 38.0 38.0 36.0 38.0 7 36.98775 38.0 38.0 38.0 36.0 38.0 8 36.91125 38.0 38.0 38.0 36.0 38.0 9 36.92325 38.0 38.0 38.0 36.0 38.0 10-14 36.9525 38.0 38.0 38.0 36.0 38.0 15-19 36.9053 38.0 38.0 38.0 35.4 38.0 20-24 36.84065 38.0 38.0 38.0 35.0 38.0 25-29 36.78705 38.0 38.0 38.0 35.0 38.0 30-34 36.673449999999995 38.0 38.0 38.0 34.8 38.0 35-39 36.60205 38.0 38.0 38.0 34.2 38.0 40-44 36.4728 38.0 38.0 38.0 34.0 38.0 45-49 36.318349999999995 38.0 37.6 38.0 33.8 38.0 50-54 36.04225 38.0 37.0 38.0 32.2 38.0 55-59 35.90635 38.0 37.0 38.0 31.0 38.0 60-64 35.986900000000006 38.0 37.0 38.0 32.2 38.0 65-69 35.74675 38.0 37.0 38.0 30.6 38.0 70-74 35.62570000000001 38.0 37.0 38.0 29.8 38.0 75-79 35.338049999999996 38.0 36.2 38.0 28.8 38.0 80-84 35.19799999999999 38.0 36.0 38.0 28.6 38.0 85-89 34.987249999999996 38.0 36.0 38.0 27.8 38.0 90-94 34.732800000000005 38.0 35.2 38.0 26.8 38.0 95-99 34.490449999999996 38.0 35.0 38.0 25.4 38.0 100-104 34.17405 38.0 34.2 38.0 23.0 38.0 105-109 33.9827 38.0 34.0 38.0 22.8 38.0 110-114 33.36919999999999 38.0 33.6 38.0 16.2 38.0 115-119 32.832800000000006 37.4 33.0 38.0 15.0 38.0 120-124 32.2628 37.0 31.0 38.0 15.0 38.0 125-129 31.916949999999996 37.0 31.0 38.0 14.8 38.0 130-134 31.1767 36.2 29.2 38.0 14.0 38.0 135-139 30.430349999999997 35.6 27.6 38.0 13.2 38.0 140-144 29.179249999999996 35.0 24.2 38.0 4.2 38.0 145-149 27.2563 34.6 16.6 38.0 2.0 38.0 150-151 22.530124999999998 29.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 3.0 11 4.0 12 1.0 13 6.0 14 3.0 15 7.0 16 11.0 17 9.0 18 11.0 19 14.0 20 21.0 21 23.0 22 25.0 23 22.0 24 33.0 25 35.0 26 50.0 27 54.0 28 61.0 29 84.0 30 109.0 31 121.0 32 179.0 33 248.0 34 340.0 35 584.0 36 939.0 37 993.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.2 15.375 14.299999999999999 33.125 2 21.925 24.6 37.475 16.0 3 20.125 26.75 30.325000000000003 22.8 4 22.875 35.875 21.025 20.225 5 23.575 37.724999999999994 21.825 16.875 6 17.325 37.925 24.45 20.3 7 17.1 14.75 46.949999999999996 21.2 8 19.825 21.875 28.849999999999998 29.45 9 22.3 23.35 28.349999999999998 26.0 10-14 22.36 29.24 26.889999999999997 21.51 15-19 22.615 27.805000000000003 28.599999999999998 20.979999999999997 20-24 22.17 28.685 28.365000000000002 20.78 25-29 22.73 28.27 28.565 20.435 30-34 22.195 28.395 28.42 20.990000000000002 35-39 22.5 27.875 28.33 21.295 40-44 23.41 28.38 27.744999999999997 20.465 45-49 22.735 27.944999999999997 28.87 20.45 50-54 22.93 28.12 28.435 20.515 55-59 22.96 28.01 28.46 20.57 60-64 22.95 28.215 28.33 20.505000000000003 65-69 23.189999999999998 28.075 28.660000000000004 20.075000000000003 70-74 24.005000000000003 27.884999999999998 28.23 19.88 75-79 23.105 27.55 28.595 20.75 80-84 23.13 28.08 28.485 20.305 85-89 23.32 28.139999999999997 28.000000000000004 20.54 90-94 23.11 28.155 28.42 20.315 95-99 23.75 27.595 28.095 20.560000000000002 100-104 23.080000000000002 28.825 27.944999999999997 20.150000000000002 105-109 23.89 28.24 27.87 20.0 110-114 23.25 28.26 27.985 20.505000000000003 115-119 23.825 28.035 27.884999999999998 20.255000000000003 120-124 24.12 28.310000000000002 27.68 19.89 125-129 23.865 27.694999999999997 28.21 20.23 130-134 24.58 27.560000000000002 27.810000000000002 20.05 135-139 24.515 27.775 28.125 19.585 140-144 24.310000000000002 27.93 27.565 20.195 145-149 25.180000000000003 27.889999999999997 27.700000000000003 19.23 150-151 25.103137892236532 27.340917614701837 28.22852856607076 19.327415926990874 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 3.5 25 4.0 26 6.5 27 9.0 28 7.0 29 12.0 30 19.5 31 27.5 32 34.0 33 42.0 34 60.0 35 74.5 36 94.0 37 111.5 38 126.5 39 166.0 40 203.5 41 225.5 42 253.5 43 291.0 44 303.0 45 288.5 46 260.5 47 235.5 48 220.5 49 193.5 50 159.5 51 124.0 52 103.5 53 90.0 54 69.5 55 45.5 56 34.0 57 29.5 58 20.0 59 13.5 60 10.0 61 6.5 62 4.5 63 3.0 64 2.0 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.4534005037783375 0.8999999999999999 3 0.07556675062972291 0.22499999999999998 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.8375 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.2 0.0 0.0 0.0 0.0 138-139 6.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGC 10 0.006830828 145.0 7 ATTCCAA 10 0.006830828 145.0 5 CTCGAGG 10 0.006830828 145.0 6 >>END_MODULE Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931771 spots for SRR7166206.sra Written 931771 spots for SRR7166206.sra Read 931781 spots for SRR7166206.sra Written 931781 spots for SRR7166206.sra SRR ids: ['SRR7166206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wrgka_re SRR7166206.sra spots: 18635430 blocks: [[1, 931771], [931772, 1863542], [1863543, 2795313], [2795314, 3727084], [3727085, 4658855], [4658856, 5590626], [5590627, 6522397], [6522398, 7454168], [7454169, 8385939], [8385940, 9317710], [9317711, 10249481], [10249482, 11181252], [11181253, 12113023], [12113024, 13044794], [13044795, 13976565], [13976566, 14908336], [14908337, 15840107], [15840108, 16771878], [16771879, 17703649], [17703650, 18635430]] SRR7166206 file size 6293235 SRR7166206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166206 SRR7166206_1.fastq SRR7166206_2.fastq Input file: SRR7166206_1.fastq Paired file: SRR7166206_2.fastq trimmed: SRR7166206-trimmed-pair1.fastq, SRR7166206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:18:20 2025 >> started Sat Feb 15 02:18:42 2025 >> done (21.625s) 18635430 read pairs processed; of these: 5881 ( 0.03%) short read pairs filtered out after trimming by size control 6281 ( 0.03%) empty read pairs filtered out after trimming by size control 18623268 (99.93%) read pairs available; of these: 8312289 (44.63%) trimmed read pairs available after processing 10310979 (55.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 13 0.00% 21 6 0.00% 22 9 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 4 0.00% 27 8 0.00% 28 4 0.00% 29 10 0.00% 30 9 0.00% 31 8 0.00% 32 6 0.00% 33 11 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 12 0.00% 38 14 0.00% 39 13 0.00% 40 17 0.00% 41 18 0.00% 42 20 0.00% 43 27 0.00% 44 28 0.00% 45 20 0.00% 46 34 0.00% 47 52 0.00% 48 33 0.00% 49 47 0.00% 50 64 0.00% 51 49 0.00% 52 61 0.00% 53 72 0.00% 54 90 0.00% 55 77 0.00% 56 106 0.00% 57 125 0.00% 58 166 0.00% 59 178 0.00% 60 212 0.00% 61 238 0.00% 62 202 0.00% 63 281 0.00% 64 340 0.00% 65 343 0.00% 66 357 0.00% 67 450 0.00% 68 494 0.00% 69 584 0.00% 70 685 0.00% 71 796 0.00% 72 848 0.00% 73 1015 0.01% 74 1179 0.01% 75 1240 0.01% 76 1364 0.01% 77 1604 0.01% 78 1775 0.01% 79 1998 0.01% 80 2224 0.01% 81 2629 0.01% 82 3004 0.02% 83 3349 0.02% 84 4187 0.02% 85 4591 0.02% 86 4912 0.03% 87 5688 0.03% 88 6045 0.03% 89 6744 0.04% 90 7145 0.04% 91 8054 0.04% 92 8736 0.05% 93 9393 0.05% 94 10252 0.06% 95 11213 0.06% 96 11853 0.06% 97 12695 0.07% 98 13347 0.07% 99 14534 0.08% 100 14954 0.08% 101 16186 0.09% 102 17225 0.09% 103 18167 0.10% 104 19433 0.10% 105 20724 0.11% 106 21627 0.12% 107 22347 0.12% 108 23546 0.13% 109 24760 0.13% 110 25918 0.14% 111 27370 0.15% 112 29387 0.16% 113 30857 0.17% 114 32490 0.17% 115 34075 0.18% 116 35333 0.19% 117 36423 0.20% 118 38134 0.20% 119 39054 0.21% 120 40299 0.22% 121 42788 0.23% 122 44953 0.24% 123 46609 0.25% 124 48978 0.26% 125 50809 0.27% 126 52893 0.28% 127 54383 0.29% 128 55680 0.30% 129 58913 0.32% 130 61233 0.33% 131 64160 0.34% 132 66720 0.36% 133 71242 0.38% 134 74689 0.40% 135 78455 0.42% 136 82431 0.44% 137 87028 0.47% 138 92334 0.50% 139 97938 0.53% 140 105263 0.57% 141 113739 0.61% 142 126443 0.68% 143 138198 0.74% 144 158527 0.85% 145 186426 1.00% 146 229768 1.23% 147 299445 1.61% 148 436656 2.34% 149 806924 4.33% 150 3742295 20.09% 151 10310979 55.37% 18623268 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=30 prefix-density=0.78 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=22.24 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.4 sequence=GCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCAC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=24 prefix-density=0.79 prefix-fanout=2.0 sequence=TTTCTCAGAGAACACCACAACTGAGACAATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=25.22 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTTACCTGCAGAAAATGTCTGGCTGTAGCTGTGGCTCTGACTGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA SRR7166206 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:19:54 Started mapping on | Feb 15 02:19:57 Finished on | Feb 15 02:22:46 Mapping speed, Million of reads per hour | 396.71 Number of input reads | 18623268 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17286932 Uniquely mapped reads % | 92.82% Average mapped length | 293.66 Number of splices: Total | 16881606 Number of splices: Annotated (sjdb) | 16559797 Number of splices: GT/AG | 16609460 Number of splices: GC/AG | 213804 Number of splices: AT/AC | 12640 Number of splices: Non-canonical | 45702 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 472577 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 34721 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870767 870767 870767 N_multimapping 472577 472577 472577 N_noFeature 557537 17079307 674532 N_ambiguous 181159 1245 89713 UnstrandedReadsAssigned:16548236 PositiveStrandReadsAssigned:206380 NegativeStrandReadsAssigned:16522687 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7166206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166206-trimmed-pair1.fastq SRR7166206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,623,268 reads, 16,381,393 reads pseudoaligned [quant] estimated average fragment length: 238.098 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7166206.ke.tsv 34699 SRR7166206.se.tsv 87100 total ==> SRR7166206.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.9 1445 47.4098 Potri.005G024800.1.v4.1 1035 797.902 265 19.406 Potri.004G059700.1.v4.1 961 723.933 36 2.90565 Potri.007G009000.2.v4.1 1416 1178.9 0 0 Potri.003G141000.2.v4.1 2943 2705.9 869.686 18.7798 Potri.016G087400.1.v4.1 270 84.2634 1014 703.136 Potri.015G069301.1.v4.1 564 332.464 0 0 Potri.010G195200.1.v4.1 1773 1535.9 601 22.8639 Potri.012G127500.1.v4.1 977 739.913 4918 388.372 ==> SRR7166206.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 176 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 531 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 444 SRR7166206 completed mapping pipeline successfully