Starting /dee2/code/volunteer_pipeline.sh SRR7166207 current disk space = 3103282089984 free memory = 1577929652 SRR7166207 SRAfilesize d8f5f6ceea420727887c743911abfb09 SRR7166207.sra SRR7166207.sra file validated SRR7166207 is paired end SRR7166207 is conventional basespace SRR7166207 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8155 33.0 32.0 34.0 30.0 34.0 2 32.10375 33.0 33.0 34.0 29.0 34.0 3 32.182 33.0 32.0 34.0 30.0 34.0 4 32.07875 33.0 32.0 34.0 30.0 34.0 5 32.3425 33.0 33.0 34.0 31.0 34.0 6 36.311 38.0 37.0 38.0 33.0 38.0 7 36.74425 38.0 37.0 38.0 34.0 38.0 8 36.80225 38.0 38.0 38.0 34.0 38.0 9 36.95875 38.0 38.0 38.0 35.0 38.0 10-14 36.9013 38.0 38.0 38.0 35.0 38.0 15-19 36.797000000000004 38.0 38.0 38.0 34.6 38.0 20-24 36.902699999999996 38.0 38.0 38.0 35.0 38.0 25-29 36.64534999999999 38.0 38.0 38.0 34.2 38.0 30-34 36.404799999999994 38.0 37.6 38.0 33.8 38.0 35-39 36.22705 38.0 37.0 38.0 33.2 38.0 40-44 36.14885 38.0 37.0 38.0 33.0 38.0 45-49 36.1144 38.0 37.0 38.0 32.2 38.0 50-54 35.836499999999994 38.0 36.8 38.0 31.0 38.0 55-59 35.631550000000004 38.0 36.0 38.0 29.6 38.0 60-64 35.6394 38.0 36.0 38.0 29.4 38.0 65-69 35.41375 38.0 36.0 38.0 29.0 38.0 70-74 35.34375000000001 38.0 36.0 38.0 29.0 38.0 75-79 34.5823 38.0 35.2 38.0 26.8 38.0 80-84 34.2222 38.0 34.6 38.0 25.2 38.0 85-89 34.55095 38.0 34.4 38.0 25.2 38.0 90-94 34.3233 38.0 34.0 38.0 24.8 38.0 95-99 33.891149999999996 38.0 34.0 38.0 21.0 38.0 100-104 33.677749999999996 37.6 33.6 38.0 19.8 38.0 105-109 33.077400000000004 37.0 32.4 38.0 15.0 38.0 110-114 32.917899999999996 37.0 31.8 38.0 15.0 38.0 115-119 32.152300000000004 36.8 30.6 38.0 15.0 38.0 120-124 31.807049999999997 36.6 30.0 38.0 15.0 38.0 125-129 30.9784 36.0 28.2 38.0 14.6 38.0 130-134 29.05575 33.6 23.2 38.0 13.2 38.0 135-139 27.65625 33.0 19.4 38.0 8.2 38.0 140-144 26.756899999999995 33.0 14.8 38.0 2.0 38.0 145-149 24.24255 31.8 8.0 38.0 2.0 38.0 150-151 18.24725 16.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 4.0 15 1.0 16 4.0 17 5.0 18 8.0 19 13.0 20 13.0 21 16.0 22 36.0 23 30.0 24 46.0 25 60.0 26 72.0 27 93.0 28 98.0 29 132.0 30 176.0 31 205.0 32 284.0 33 347.0 34 444.0 35 627.0 36 807.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.93830921553694 18.93881695861894 9.926377253109926 34.1964965727342 2 18.125 26.5 37.45 17.925 3 17.5 30.4 27.825 24.275 4 20.4 38.525 21.4 19.675 5 20.525 37.275000000000006 23.05 19.15 6 15.9 37.55 24.95 21.6 7 13.425 20.0 45.125 21.45 8 16.7 21.4 29.15 32.75 9 17.9 21.275 31.374999999999996 29.45 10-14 18.815 30.3 27.255000000000003 23.630000000000003 15-19 19.175 29.080000000000002 28.015 23.73 20-24 19.515 28.725 28.060000000000002 23.7 25-29 19.545 29.265 27.815 23.375 30-34 19.41 29.409999999999997 27.54 23.64 35-39 19.53 28.88 28.634999999999998 22.955000000000002 40-44 20.11 29.304999999999996 27.51 23.075000000000003 45-49 20.06 28.485 28.16 23.294999999999998 50-54 20.585 28.535 27.92 22.96 55-59 19.475 28.939999999999998 28.025 23.56 60-64 19.62 29.065 27.97 23.345 65-69 20.055 29.185 27.38 23.380000000000003 70-74 20.103015452317848 28.644296644496674 27.94919237885683 23.30349552432865 75-79 20.27734037689846 28.67374409508813 28.07436379336618 22.97455173464723 80-84 19.896246566981997 28.867866951480014 27.698097853728004 23.537788627809988 85-89 20.175 29.45 27.894999999999996 22.48 90-94 20.615 28.915000000000003 27.62 22.85 95-99 20.235 28.99 27.525 23.25 100-104 19.705000000000002 29.220000000000002 27.82 23.255 105-109 19.72 29.315 27.284999999999997 23.68 110-114 19.925 29.185 27.785 23.105 115-119 20.57 28.77 27.639999999999997 23.02 120-124 19.666966696669665 28.83788378837884 27.9027902790279 23.592359235923592 125-129 20.378056708506275 28.8593288993349 26.934040106015907 23.82857428614292 130-134 20.725936367297624 29.163310511478052 26.847563431333064 23.263189689891263 135-139 20.909409234155373 28.22770246610975 26.972137461857837 23.890750837877047 140-144 20.536160848254475 28.24847454236271 27.253175952785835 23.96218865659698 145-149 20.606060606060606 28.289506636614075 26.937139994991234 24.167292762334082 150-151 20.76393237319975 26.900438321853475 27.889793362554787 24.445835942391987 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 0.5 22 3.0 23 4.5 24 4.0 25 3.5 26 5.0 27 9.5 28 14.0 29 19.5 30 27.0 31 32.5 32 42.0 33 51.5 34 60.5 35 78.0 36 101.0 37 119.0 38 143.5 39 176.0 40 212.5 41 249.5 42 278.5 43 290.0 44 278.0 45 257.5 46 251.5 47 249.5 48 224.5 49 184.5 50 141.0 51 116.0 52 94.5 53 73.5 54 53.5 55 36.5 56 31.5 57 22.0 58 11.5 59 10.5 60 10.5 61 6.5 62 4.0 63 2.0 64 1.5 65 1.0 66 1.5 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 1.5650000000000002 80-84 1.69 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.015 130-134 0.6799999999999999 135-139 0.045 140-144 0.03 145-149 0.17500000000000002 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.4000000000000004 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTCA 10 0.006867937 144.7375 9 TTCAACT 10 0.006867937 144.7375 7 ATTCAAC 10 0.006867937 144.7375 6 >>END_MODULE SRR7166207 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166207_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.544 33.0 33.0 34.0 32.0 34.0 2 32.5755 33.0 33.0 34.0 32.0 34.0 3 32.7525 33.0 33.0 34.0 32.0 34.0 4 32.56275 33.0 33.0 34.0 32.0 34.0 5 32.65825 33.0 33.0 34.0 32.0 34.0 6 36.7665 38.0 38.0 38.0 35.0 38.0 7 36.8455 38.0 38.0 38.0 35.0 38.0 8 36.72925 38.0 38.0 38.0 35.0 38.0 9 36.68125 38.0 38.0 38.0 35.0 38.0 10-14 36.5694 38.0 38.0 38.0 34.4 38.0 15-19 36.5049 38.0 38.0 38.0 34.0 38.0 20-24 36.373749999999994 38.0 38.0 38.0 34.0 38.0 25-29 36.4664 38.0 38.0 38.0 34.2 38.0 30-34 36.426100000000005 38.0 38.0 38.0 34.0 38.0 35-39 36.21535 38.0 38.0 38.0 33.2 38.0 40-44 36.162549999999996 38.0 38.0 38.0 33.4 38.0 45-49 35.96315 38.0 38.0 38.0 31.8 38.0 50-54 35.97430000000001 38.0 37.4 38.0 32.2 38.0 55-59 35.93665 38.0 37.2 38.0 32.0 38.0 60-64 35.86555 38.0 37.0 38.0 31.4 38.0 65-69 35.7084 38.0 37.0 38.0 30.6 38.0 70-74 35.5351 38.0 36.8 38.0 29.6 38.0 75-79 35.42045 38.0 36.8 38.0 29.8 38.0 80-84 35.251149999999996 38.0 36.2 38.0 28.8 38.0 85-89 35.1395 38.0 36.0 38.0 28.6 38.0 90-94 34.85645 38.0 35.8 38.0 27.2 38.0 95-99 34.69355 38.0 35.4 38.0 26.2 38.0 100-104 34.333749999999995 38.0 34.8 38.0 22.8 38.0 105-109 34.2341 38.0 34.4 38.0 23.4 38.0 110-114 33.95415 38.0 34.0 38.0 22.6 38.0 115-119 33.4322 38.0 33.8 38.0 17.4 38.0 120-124 33.1034 38.0 32.8 38.0 15.0 38.0 125-129 32.361 37.4 31.8 38.0 15.0 38.0 130-134 31.550349999999998 36.6 31.0 38.0 13.8 38.0 135-139 30.384800000000002 36.0 28.2 38.0 12.8 38.0 140-144 29.45505 35.8 26.4 38.0 5.6 38.0 145-149 27.18675 33.4 17.0 38.0 2.0 38.0 150-151 21.30475 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 1.0 6 1.0 7 3.0 8 1.0 9 4.0 10 2.0 11 3.0 12 5.0 13 5.0 14 3.0 15 2.0 16 3.0 17 5.0 18 8.0 19 11.0 20 10.0 21 15.0 22 22.0 23 37.0 24 37.0 25 51.0 26 47.0 27 57.0 28 76.0 29 90.0 30 118.0 31 139.0 32 178.0 33 207.0 34 313.0 35 449.0 36 831.0 37 1248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.8849712428107 16.90422605651413 14.603650912728183 28.60715178794699 2 23.13078269567392 24.656164041010253 35.58389597399349 16.62915728932233 3 19.929982495623904 26.6816704176044 33.33333333333333 20.05501375343836 4 22.705676419104776 35.45886471617904 22.755688922230558 19.079769942485623 5 22.836418209104554 37.943971985992995 21.1855927963982 18.034017008504254 6 18.9 38.675 25.074999999999996 17.349999999999998 7 16.2 16.425 45.574999999999996 21.8 8 19.425 21.0 29.45 30.125 9 22.1 23.775 28.625 25.5 10-14 22.425 28.78 28.044999999999998 20.75 15-19 22.465 28.34 28.194999999999997 21.0 20-24 22.73 28.64 28.505000000000003 20.125 25-29 23.03 28.255000000000003 28.315 20.4 30-34 22.365 27.839999999999996 28.910000000000004 20.885 35-39 22.822282228222825 27.947794779477945 29.187918791879184 20.042004200420042 40-44 22.515 28.76 28.470000000000002 20.255000000000003 45-49 22.81 27.51 29.244999999999997 20.435 50-54 22.955000000000002 28.79 28.444999999999997 19.81 55-59 22.481124056202813 27.841392069603483 29.106455322766138 20.571028551427574 60-64 23.225 28.49 28.48 19.805 65-69 23.02 27.975 28.999999999999996 20.005 70-74 23.3 28.64 28.015 20.044999999999998 75-79 23.02 27.944999999999997 28.985 20.05 80-84 23.189999999999998 27.73 28.715000000000003 20.365 85-89 23.66 27.705000000000002 28.28 20.355 90-94 23.075000000000003 27.87 28.810000000000002 20.244999999999997 95-99 23.395 27.655 28.910000000000004 20.04 100-104 23.313497024553683 28.019202880432065 28.66930039505926 19.997999699954995 105-109 23.53088272068017 28.157039259814955 28.252063015753937 20.060015003750937 110-114 24.141035258814703 27.751937984496124 28.457114278569644 19.64991247811953 115-119 23.67618380919046 28.206410320516024 28.456422821141057 19.66098304915246 120-124 24.085 28.050000000000004 28.325 19.54 125-129 24.560000000000002 27.62 28.244999999999997 19.575 130-134 24.7 27.85 28.205000000000002 19.245 135-139 24.62 27.66 27.694999999999997 20.025000000000002 140-144 24.775 27.99 28.1 19.134999999999998 145-149 24.759999999999998 28.349999999999998 27.439999999999998 19.45 150-151 24.825 28.125 27.962500000000002 19.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 3.5 24 5.0 25 3.0 26 4.5 27 8.5 28 12.0 29 13.0 30 17.5 31 24.5 32 34.5 33 50.5 34 63.5 35 79.0 36 85.0 37 114.5 38 161.0 39 174.0 40 195.5 41 243.5 42 277.5 43 283.5 44 285.5 45 288.5 46 280.0 47 254.0 48 215.5 49 182.0 50 145.0 51 115.5 52 102.0 53 73.5 54 51.5 55 42.0 56 26.5 57 18.5 58 18.0 59 16.0 60 8.5 61 3.0 62 3.0 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.025 110-114 0.025 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9249999999999999 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.0999999999999996 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.699999999999999 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.550000000000001 0.0 0.0 0.0 0.0 132-133 7.175 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138-139 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACCTT 10 0.006830828 145.0 2 CAAATTC 10 0.006830828 145.0 9 >>END_MODULE Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra Read 940190 spots for SRR7166207.sra Written 940190 spots for SRR7166207.sra SRR ids: ['SRR7166207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2jx3oerc SRR7166207.sra spots: 18803800 blocks: [[1, 940190], [940191, 1880380], [1880381, 2820570], [2820571, 3760760], [3760761, 4700950], [4700951, 5641140], [5641141, 6581330], [6581331, 7521520], [7521521, 8461710], [8461711, 9401900], [9401901, 10342090], [10342091, 11282280], [11282281, 12222470], [12222471, 13162660], [13162661, 14102850], [14102851, 15043040], [15043041, 15983230], [15983231, 16923420], [16923421, 17863610], [17863611, 18803800]] SRR7166207 file size 6350290 SRR7166207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166207 SRR7166207_1.fastq SRR7166207_2.fastq Input file: SRR7166207_1.fastq Paired file: SRR7166207_2.fastq trimmed: SRR7166207-trimmed-pair1.fastq, SRR7166207-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:59:52 2025 >> started Sat Feb 15 03:00:13 2025 >> done (20.708s) 18803800 read pairs processed; of these: 21179 ( 0.11%) short read pairs filtered out after trimming by size control 17326 ( 0.09%) empty read pairs filtered out after trimming by size control 18765295 (99.80%) read pairs available; of these: 13552256 (72.22%) trimmed read pairs available after processing 5213039 (27.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 12 0.00% 21 3 0.00% 22 16 0.00% 23 14 0.00% 24 8 0.00% 25 5 0.00% 26 11 0.00% 27 13 0.00% 28 12 0.00% 29 17 0.00% 30 17 0.00% 31 10 0.00% 32 12 0.00% 33 15 0.00% 34 16 0.00% 35 21 0.00% 36 21 0.00% 37 26 0.00% 38 29 0.00% 39 24 0.00% 40 33 0.00% 41 43 0.00% 42 44 0.00% 43 44 0.00% 44 37 0.00% 45 58 0.00% 46 59 0.00% 47 55 0.00% 48 88 0.00% 49 85 0.00% 50 96 0.00% 51 123 0.00% 52 116 0.00% 53 139 0.00% 54 138 0.00% 55 179 0.00% 56 224 0.00% 57 239 0.00% 58 295 0.00% 59 323 0.00% 60 431 0.00% 61 423 0.00% 62 490 0.00% 63 551 0.00% 64 651 0.00% 65 657 0.00% 66 771 0.00% 67 906 0.00% 68 1012 0.01% 69 1149 0.01% 70 1401 0.01% 71 1569 0.01% 72 1781 0.01% 73 2068 0.01% 74 2294 0.01% 75 2572 0.01% 76 2892 0.02% 77 3101 0.02% 78 3411 0.02% 79 3741 0.02% 80 4431 0.02% 81 5026 0.03% 82 5855 0.03% 83 6580 0.04% 84 7892 0.04% 85 8729 0.05% 86 9319 0.05% 87 9803 0.05% 88 10777 0.06% 89 11236 0.06% 90 12285 0.07% 91 13338 0.07% 92 14441 0.08% 93 15841 0.08% 94 17134 0.09% 95 18225 0.10% 96 19037 0.10% 97 20139 0.11% 98 21011 0.11% 99 22538 0.12% 100 23867 0.13% 101 25475 0.14% 102 27068 0.14% 103 29370 0.16% 104 30687 0.16% 105 32965 0.18% 106 34095 0.18% 107 34965 0.19% 108 36573 0.19% 109 38569 0.21% 110 40260 0.21% 111 42562 0.23% 112 45494 0.24% 113 48641 0.26% 114 51948 0.28% 115 55081 0.29% 116 56327 0.30% 117 59440 0.32% 118 62070 0.33% 119 63935 0.34% 120 67354 0.36% 121 70951 0.38% 122 75298 0.40% 123 80196 0.43% 124 85765 0.46% 125 90663 0.48% 126 95476 0.51% 127 100513 0.54% 128 105110 0.56% 129 111244 0.59% 130 118095 0.63% 131 126718 0.68% 132 135647 0.72% 133 147111 0.78% 134 158957 0.85% 135 175225 0.93% 136 184114 0.98% 137 191779 1.02% 138 206595 1.10% 139 225340 1.20% 140 249863 1.33% 141 255042 1.36% 142 279735 1.49% 143 311567 1.66% 144 359352 1.91% 145 425517 2.27% 146 521108 2.78% 147 674398 3.59% 148 931649 4.96% 149 1573813 8.39% 150 4290425 22.86% 151 5213039 27.78% 18765295 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=28 prefix-density=0.34 prefix-fanout=2.3 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=79.61 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=9.8 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.14 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=4.8 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=114.95 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.0 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7166207 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 03:01:07 Started mapping on | Feb 15 03:01:07 Finished on | Feb 15 03:03:08 Mapping speed, Million of reads per hour | 558.31 Number of input reads | 18765295 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17662033 Uniquely mapped reads % | 94.12% Average mapped length | 287.44 Number of splices: Total | 15982773 Number of splices: Annotated (sjdb) | 15648669 Number of splices: GT/AG | 15717756 Number of splices: GC/AG | 208532 Number of splices: AT/AC | 12142 Number of splices: Non-canonical | 44343 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437188 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 27495 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 687632 687632 687632 N_multimapping 437188 437188 437188 N_noFeature 767175 17403554 947575 N_ambiguous 164544 1416 85397 UnstrandedReadsAssigned:16730314 PositiveStrandReadsAssigned:257063 NegativeStrandReadsAssigned:16629061 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=136 echo kmer=131 SRR7166207 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166207-trimmed-pair1.fastq SRR7166207-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,765,295 reads, 16,557,255 reads pseudoaligned [quant] estimated average fragment length: 229.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7166207.ke.tsv 34699 SRR7166207.se.tsv 87100 total ==> SRR7166207.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.43 2084 76.7876 Potri.005G024800.1.v4.1 1035 806.428 344 28.1255 Potri.004G059700.1.v4.1 961 732.438 30 2.70059 Potri.007G009000.2.v4.1 1416 1187.43 0 0 Potri.003G141000.2.v4.1 2943 2714.43 678.076 16.4705 Potri.016G087400.1.v4.1 270 88.5078 626 466.338 Potri.015G069301.1.v4.1 564 340.124 0 0 Potri.010G195200.1.v4.1 1773 1544.43 591 25.2306 Potri.012G127500.1.v4.1 977 748.433 7724 680.451 ==> SRR7166207.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 922 SRR7166207 completed mapping pipeline successfully