Starting /dee2/code/volunteer_pipeline.sh SRR7166208 current disk space = 3104141701120 free memory = 1449660652 SRR7166208 SRAfilesize c7e342a36083bd85e83e880e9326d4a1 SRR7166208.sra SRR7166208.sra file validated SRR7166208 is paired end SRR7166208 is conventional basespace SRR7166208 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.19975 32.0 25.0 33.0 18.0 33.0 2 26.36175 28.0 18.0 31.0 18.0 33.0 3 28.603 29.0 27.0 31.0 18.0 33.0 4 31.132 33.0 30.0 33.0 28.0 33.0 5 32.04775 33.0 32.0 33.0 31.0 33.0 6 36.6205 38.0 37.0 38.0 34.0 38.0 7 37.33775 38.0 38.0 38.0 37.0 38.0 8 37.46725 38.0 38.0 38.0 37.0 38.0 9 37.64225 38.0 38.0 38.0 38.0 38.0 10-14 37.58605 38.0 38.0 38.0 38.0 38.0 15-19 37.587450000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.59895 38.0 38.0 38.0 38.0 38.0 25-29 37.6008 38.0 38.0 38.0 38.0 38.0 30-34 37.542899999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.500350000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.53445000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.507 38.0 38.0 38.0 37.8 38.0 50-54 37.23 38.0 38.0 38.0 37.0 38.0 55-59 36.94985 38.0 38.0 38.0 36.8 38.0 60-64 37.08915 38.0 38.0 38.0 37.0 38.0 65-69 37.289649999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.17205 38.0 38.0 38.0 36.8 38.0 75-79 37.12819999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.05929999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.036899999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.9299 38.0 38.0 38.0 35.8 38.0 95-99 36.79705 38.0 38.0 38.0 35.2 38.0 100-104 36.621500000000005 38.0 38.0 38.0 34.6 38.0 105-109 36.3445 38.0 38.0 38.0 34.0 38.0 110-114 36.44435 38.0 38.0 38.0 34.0 38.0 115-119 36.31825 38.0 38.0 38.0 34.0 38.0 120-124 36.137449999999994 38.0 37.2 38.0 33.0 38.0 125-129 35.9503 38.0 37.2 38.0 33.2 38.0 130-134 35.88445 38.0 36.8 38.0 32.6 38.0 135-139 35.661449999999995 38.0 36.0 38.0 31.8 38.0 140-144 35.465250000000005 38.0 36.0 38.0 31.2 38.0 145-149 34.93515 38.0 35.6 38.0 29.4 38.0 150-151 31.7 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 3.0 18 0.0 19 1.0 20 1.0 21 5.0 22 6.0 23 7.0 24 4.0 25 8.0 26 11.0 27 14.0 28 18.0 29 32.0 30 25.0 31 36.0 32 58.0 33 86.0 34 144.0 35 241.0 36 633.0 37 2660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.358948432760364 24.418604651162788 8.670374115267949 36.5520728008089 2 14.85 33.95 32.9 18.3 3 16.6 32.975 24.45 25.974999999999998 4 18.775 40.325 21.175 19.725 5 19.244244244244243 39.214214214214216 21.646646646646648 19.894894894894897 6 15.85 38.25 24.95 20.95 7 12.5 20.175 45.9 21.425 8 17.025000000000002 20.974999999999998 28.999999999999996 33.0 9 17.150000000000002 23.175 30.125 29.549999999999997 10-14 19.255 30.959999999999997 26.39 23.395 15-19 19.345000000000002 29.849999999999998 27.275 23.53 20-24 19.39 29.854999999999997 28.205000000000002 22.55 25-29 19.09 29.875 27.29 23.745 30-34 19.855 29.720000000000002 27.515 22.91 35-39 19.580000000000002 29.235 27.265 23.919999999999998 40-44 19.435 30.345 27.075 23.145 45-49 19.73 29.654999999999998 27.474999999999998 23.14 50-54 18.91430007539583 29.369188238250814 28.112591103292285 23.60392058306107 55-59 20.119270227927426 29.06959114570172 27.97796533077273 22.83317329559812 60-64 19.19481302774427 29.041013268998796 27.94028950542823 23.82388419782871 65-69 19.082633053221286 29.186674669867944 28.19127651060424 23.539415766306522 70-74 19.531484633096404 29.417359095004503 27.204925417959757 23.846230853939332 75-79 19.696893912869502 28.87510628720052 27.684689641374483 23.743310158555495 80-84 19.376937693769378 28.86788678867887 28.312831283128315 23.442344234423445 85-89 19.500975048752437 29.616480824041204 27.341367068353417 23.541177058852945 90-94 19.675 29.485 27.845 22.994999999999997 95-99 20.004001800810364 29.258166174778648 27.822520134060326 22.915311890350658 100-104 20.11125588854365 29.192141926430793 26.886839731382178 23.80976245364338 105-109 20.044274501911854 29.60857315355202 27.49044073254176 22.856711611994367 110-114 20.245122561280642 29.63981990995498 27.313656828414207 22.801400700350175 115-119 20.832288794184006 29.150162948107294 27.18475808473302 22.832790172975685 120-124 20.526157847354206 29.643893167950385 26.668000400120036 23.161948584575374 125-129 20.253545122012326 28.716740993135243 27.20348749812096 23.826226386731474 130-134 20.53424040818368 29.348206693011857 26.601970886899107 23.51558201190536 135-139 20.44011002750688 29.28232058014504 26.691672918229557 23.585896474118528 140-144 20.699139827965592 28.915783156631324 26.435287057411482 23.949789957991598 145-149 21.071589374155785 28.490669868427638 26.699684826654664 23.73805593076192 150-151 20.72117190434456 28.48378615249781 26.33028671591336 24.46475522724427 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 2.0 22 2.5 23 3.0 24 4.0 25 6.0 26 9.0 27 12.5 28 16.5 29 17.5 30 22.0 31 36.5 32 52.5 33 60.5 34 70.0 35 90.5 36 117.0 37 133.5 38 144.0 39 179.0 40 232.5 41 256.5 42 256.0 43 271.0 44 274.5 45 268.5 46 253.5 47 224.0 48 206.5 49 176.0 50 136.5 51 115.0 52 95.5 53 75.0 54 58.0 55 36.5 56 24.5 57 22.0 58 17.0 59 7.5 60 2.0 61 3.0 62 2.5 63 1.5 64 1.0 65 0.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.525 55-59 1.065 60-64 0.52 65-69 0.04 70-74 0.11 75-79 0.034999999999999996 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.045 100-104 0.22999999999999998 105-109 0.62 110-114 0.05 115-119 0.27499999999999997 120-124 0.03 125-129 0.215 130-134 0.045 135-139 0.025 140-144 0.02 145-149 0.055 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.8375 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.925 0.0 0.0 0.0 0.0 124-125 6.475 0.0 0.0 0.0 0.0 126-127 6.9125 0.0 0.0 0.0 0.0 128-129 7.4375 0.0 0.0 0.0 0.0 130-131 8.037500000000001 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.475000000000001 0.0 0.0 0.0 0.0 136-137 10.175 0.0 0.0 0.0 0.0 138-139 10.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTAT 10 0.0070081474 143.7625 8 >>END_MODULE SRR7166208 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166208_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78 33.0 33.0 34.0 32.0 34.0 2 32.9055 33.0 33.0 34.0 32.0 34.0 3 32.867 33.0 33.0 34.0 32.0 34.0 4 33.02125 33.0 33.0 34.0 32.0 34.0 5 32.962 33.0 33.0 34.0 32.0 34.0 6 37.193 38.0 38.0 38.0 37.0 38.0 7 37.2115 38.0 38.0 38.0 37.0 38.0 8 37.239 38.0 38.0 38.0 37.0 38.0 9 37.25875 38.0 38.0 38.0 37.0 38.0 10-14 37.208299999999994 38.0 38.0 38.0 36.8 38.0 15-19 37.18945 38.0 38.0 38.0 37.0 38.0 20-24 37.157 38.0 38.0 38.0 36.8 38.0 25-29 37.0679 38.0 38.0 38.0 36.2 38.0 30-34 37.02119999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.9933 38.0 38.0 38.0 36.0 38.0 40-44 36.89905 38.0 38.0 38.0 36.0 38.0 45-49 36.75865 38.0 38.0 38.0 35.2 38.0 50-54 36.599149999999995 38.0 38.0 38.0 34.4 38.0 55-59 36.46865 38.0 38.0 38.0 34.0 38.0 60-64 36.43075 38.0 38.0 38.0 34.0 38.0 65-69 36.381449999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.2863 38.0 37.4 38.0 33.8 38.0 75-79 36.109700000000004 38.0 37.0 38.0 33.0 38.0 80-84 35.99035 38.0 37.0 38.0 32.6 38.0 85-89 35.73585 38.0 37.0 38.0 31.0 38.0 90-94 35.4844 38.0 36.6 38.0 29.4 38.0 95-99 35.2881 38.0 36.0 38.0 28.8 38.0 100-104 35.10725000000001 38.0 36.0 38.0 28.6 38.0 105-109 34.812 38.0 35.0 38.0 27.2 38.0 110-114 34.440250000000006 38.0 34.6 38.0 24.8 38.0 115-119 33.97525 38.0 34.0 38.0 22.8 38.0 120-124 33.5681 38.0 34.0 38.0 18.6 38.0 125-129 33.16715 37.8 33.8 38.0 16.2 38.0 130-134 32.509800000000006 37.2 32.6 38.0 15.0 38.0 135-139 31.7308 36.4 31.0 38.0 14.0 38.0 140-144 30.596950000000003 35.6 28.4 38.0 13.2 38.0 145-149 29.07665 34.6 25.6 38.0 2.0 38.0 150-151 24.07075 32.0 8.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 2.0 6 0.0 7 1.0 8 3.0 9 2.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 2.0 16 5.0 17 1.0 18 5.0 19 5.0 20 10.0 21 15.0 22 14.0 23 9.0 24 21.0 25 30.0 26 40.0 27 42.0 28 50.0 29 58.0 30 89.0 31 123.0 32 134.0 33 196.0 34 296.0 35 520.0 36 968.0 37 1347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.010502625656414 16.9792448112028 13.178294573643413 27.831957989497376 2 21.425 23.45 37.8 17.325 3 19.825 25.45 32.324999999999996 22.400000000000002 4 23.599999999999998 36.35 22.400000000000002 17.65 5 22.780695173793447 38.60965241310328 20.830207551887973 17.779444861215303 6 18.05 37.85 25.0 19.1 7 16.75 16.725 44.625 21.9 8 19.825 21.75 27.875 30.55 9 22.05 24.275 29.099999999999998 24.575 10-14 22.97 28.7 27.24 21.09 15-19 22.715 27.775 28.854999999999997 20.655 20-24 22.81 27.42 28.93 20.84 25-29 22.445 27.965 28.98 20.61 30-34 22.259999999999998 28.249999999999996 29.049999999999997 20.44 35-39 22.935 27.125 29.145 20.794999999999998 40-44 22.685 27.98 28.84 20.495 45-49 22.994999999999997 28.03 28.62 20.355 50-54 22.919999999999998 27.825 29.099999999999998 20.155 55-59 23.09 28.000000000000004 28.835 20.075000000000003 60-64 22.98 28.38 28.59 20.05 65-69 23.005 27.605 29.335 20.055 70-74 23.175 28.38 28.4 20.044999999999998 75-79 23.96 27.785 28.915000000000003 19.34 80-84 22.945 27.72 29.03 20.305 85-89 23.62 27.29 28.88 20.21 90-94 23.380000000000003 28.27 28.82 19.53 95-99 23.724999999999998 27.35 29.125 19.8 100-104 23.535 27.339999999999996 28.595 20.53 105-109 23.3 27.465 28.970000000000002 20.265 110-114 23.765 28.17 28.355000000000004 19.71 115-119 24.165 28.07 27.91 19.855 120-124 24.610000000000003 27.66 28.134999999999998 19.595000000000002 125-129 24.485 27.685 27.88 19.950000000000003 130-134 25.259999999999998 27.325 28.21 19.205 135-139 24.57 27.794999999999998 28.255000000000003 19.38 140-144 25.09 27.315 27.805000000000003 19.79 145-149 25.55 27.41 27.994999999999997 19.045 150-151 26.350675337668832 27.201100550275136 27.876438219109556 18.571785892946473 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 5.0 26 4.5 27 9.5 28 14.0 29 12.0 30 18.5 31 26.0 32 40.5 33 48.5 34 51.0 35 68.5 36 87.5 37 115.5 38 151.5 39 191.0 40 196.5 41 234.0 42 297.0 43 300.0 44 282.0 45 273.5 46 258.5 47 230.5 48 211.5 49 177.5 50 155.0 51 135.0 52 98.5 53 78.0 54 64.0 55 47.0 56 33.0 57 21.0 58 16.5 59 14.5 60 9.0 61 4.0 62 3.0 63 4.5 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.15 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.775 0.0 0.0 0.0 0.0 116-117 4.175000000000001 0.0 0.0 0.0 0.0 118-119 4.675000000000001 0.0 0.0 0.0 0.0 120-121 5.0875 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.237500000000001 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.175 0.0 0.0 0.0 0.0 130-131 7.7875 0.0 0.0 0.0 0.0 132-133 8.45 0.0 0.0 0.0 0.0 134-135 9.1625 0.0 0.0 0.0 0.0 136-137 9.8 0.0 0.0 0.0 0.0 138-139 10.524999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAAGC 10 0.006832588 144.9875 8 AAAAAAA 20 0.0059376103 28.9975 70-74 GTGTGTG 30 0.0014445208 24.164585 125-129 >>END_MODULE Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra Read 762644 spots for SRR7166208.sra Written 762644 spots for SRR7166208.sra SRR ids: ['SRR7166208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a7am2pgg SRR7166208.sra spots: 15252880 blocks: [[1, 762644], [762645, 1525288], [1525289, 2287932], [2287933, 3050576], [3050577, 3813220], [3813221, 4575864], [4575865, 5338508], [5338509, 6101152], [6101153, 6863796], [6863797, 7626440], [7626441, 8389084], [8389085, 9151728], [9151729, 9914372], [9914373, 10677016], [10677017, 11439660], [11439661, 12202304], [12202305, 12964948], [12964949, 13727592], [13727593, 14490236], [14490237, 15252880]] SRR7166208 file size 5147000 SRR7166208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166208 SRR7166208_1.fastq SRR7166208_2.fastq Input file: SRR7166208_1.fastq Paired file: SRR7166208_2.fastq trimmed: SRR7166208-trimmed-pair1.fastq, SRR7166208-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 01:36:54 2025 >> started Sat Feb 15 01:37:18 2025 >> done (24.389s) 15252880 read pairs processed; of these: 11276 ( 0.07%) short read pairs filtered out after trimming by size control 12372 ( 0.08%) empty read pairs filtered out after trimming by size control 15229232 (99.84%) read pairs available; of these: 6982668 (45.85%) trimmed read pairs available after processing 8246564 (54.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 9 0.00% 21 9 0.00% 22 8 0.00% 23 8 0.00% 24 13 0.00% 25 10 0.00% 26 7 0.00% 27 3 0.00% 28 11 0.00% 29 4 0.00% 30 8 0.00% 31 6 0.00% 32 9 0.00% 33 8 0.00% 34 15 0.00% 35 14 0.00% 36 14 0.00% 37 14 0.00% 38 14 0.00% 39 10 0.00% 40 27 0.00% 41 18 0.00% 42 37 0.00% 43 21 0.00% 44 37 0.00% 45 48 0.00% 46 39 0.00% 47 39 0.00% 48 51 0.00% 49 63 0.00% 50 73 0.00% 51 87 0.00% 52 83 0.00% 53 88 0.00% 54 93 0.00% 55 109 0.00% 56 150 0.00% 57 162 0.00% 58 190 0.00% 59 229 0.00% 60 251 0.00% 61 323 0.00% 62 333 0.00% 63 367 0.00% 64 407 0.00% 65 479 0.00% 66 566 0.00% 67 589 0.00% 68 669 0.00% 69 826 0.01% 70 1015 0.01% 71 1171 0.01% 72 1311 0.01% 73 1584 0.01% 74 1678 0.01% 75 1897 0.01% 76 2085 0.01% 77 2239 0.01% 78 2404 0.02% 79 2774 0.02% 80 3186 0.02% 81 3656 0.02% 82 4152 0.03% 83 4694 0.03% 84 5791 0.04% 85 6511 0.04% 86 7205 0.05% 87 7698 0.05% 88 8165 0.05% 89 8578 0.06% 90 9319 0.06% 91 10293 0.07% 92 11557 0.08% 93 12423 0.08% 94 13307 0.09% 95 14212 0.09% 96 14671 0.10% 97 15805 0.10% 98 16359 0.11% 99 17589 0.12% 100 18259 0.12% 101 19653 0.13% 102 21067 0.14% 103 22306 0.15% 104 23650 0.16% 105 24854 0.16% 106 25955 0.17% 107 26455 0.17% 108 27086 0.18% 109 28385 0.19% 110 29748 0.20% 111 30794 0.20% 112 32652 0.21% 113 34340 0.23% 114 36896 0.24% 115 38585 0.25% 116 39101 0.26% 117 40038 0.26% 118 40858 0.27% 119 41902 0.28% 120 43093 0.28% 121 45018 0.30% 122 46469 0.31% 123 49259 0.32% 124 51155 0.34% 125 53014 0.35% 126 54824 0.36% 127 55268 0.36% 128 56448 0.37% 129 58320 0.38% 130 59942 0.39% 131 61350 0.40% 132 64958 0.43% 133 67535 0.44% 134 70871 0.47% 135 74348 0.49% 136 77224 0.51% 137 80029 0.53% 138 83989 0.55% 139 86689 0.57% 140 91282 0.60% 141 98290 0.65% 142 105795 0.69% 143 115565 0.76% 144 129730 0.85% 145 149816 0.98% 146 180177 1.18% 147 229756 1.51% 148 329125 2.16% 149 598351 3.93% 150 2892408 18.99% 151 8246564 54.15% 15229232 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=20 prefix-density=0.28 prefix-fanout=3.5 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=12.55 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.9 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=30.66 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=10.7 sequence=GAGAAGGCAATGAGAGATGC SRR7166208 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 01:38:44 Started mapping on | Feb 15 01:38:44 Finished on | Feb 15 01:40:58 Mapping speed, Million of reads per hour | 409.14 Number of input reads | 15229232 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14215708 Uniquely mapped reads % | 93.34% Average mapped length | 291.45 Number of splices: Total | 13798311 Number of splices: Annotated (sjdb) | 13530158 Number of splices: GT/AG | 13571604 Number of splices: GC/AG | 176477 Number of splices: AT/AC | 10484 Number of splices: Non-canonical | 39746 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385948 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 31053 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638528 638528 638528 N_multimapping 385948 385948 385948 N_noFeature 499756 14032915 609441 N_ambiguous 141929 1024 68211 UnstrandedReadsAssigned:13574023 PositiveStrandReadsAssigned:181769 NegativeStrandReadsAssigned:13538056 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166208 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166208-trimmed-pair1.fastq SRR7166208-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,229,232 reads, 13,489,310 reads pseudoaligned [quant] estimated average fragment length: 224.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR7166208.ke.tsv 34699 SRR7166208.se.tsv 87100 total ==> SRR7166208.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.37 987 41.8105 Potri.005G024800.1.v4.1 1035 811.373 208 19.486 Potri.004G059700.1.v4.1 961 737.403 41 4.2263 Potri.007G009000.2.v4.1 1416 1192.37 1 0.0637483 Potri.003G141000.2.v4.1 2943 2719.37 528.158 14.763 Potri.016G087400.1.v4.1 270 90.2655 978 823.565 Potri.015G069301.1.v4.1 564 345.039 0 0 Potri.010G195200.1.v4.1 1773 1549.37 506 24.8242 Potri.012G127500.1.v4.1 977 753.393 3068 309.538 ==> SRR7166208.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 393 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 183 SRR7166208 completed mapping pipeline successfully