Starting /dee2/code/volunteer_pipeline.sh SRR7166209 current disk space = 3103430021120 free memory = 1579859952 SRR7166209 SRAfilesize c2e1571e57c4fbff4681d782e1bdb01e SRR7166209.sra SRR7166209.sra file validated SRR7166209 is paired end SRR7166209 is conventional basespace SRR7166209 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166209_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7825 33.0 32.0 34.0 30.0 34.0 2 32.2135 33.0 33.0 34.0 29.0 34.0 3 32.107 33.0 32.0 34.0 30.0 34.0 4 32.01875 33.0 32.0 34.0 30.0 34.0 5 32.359 33.0 33.0 34.0 31.0 34.0 6 36.267 38.0 37.0 38.0 33.0 38.0 7 36.7515 38.0 37.0 38.0 34.0 38.0 8 36.784 38.0 38.0 38.0 35.0 38.0 9 36.9625 38.0 38.0 38.0 35.0 38.0 10-14 36.94250000000001 38.0 38.0 38.0 35.0 38.0 15-19 36.87075 38.0 38.0 38.0 35.0 38.0 20-24 36.964549999999996 38.0 38.0 38.0 35.2 38.0 25-29 36.83284999999999 38.0 38.0 38.0 35.0 38.0 30-34 36.566700000000004 38.0 38.0 38.0 34.0 38.0 35-39 36.4052 38.0 37.4 38.0 33.8 38.0 40-44 36.3706 38.0 37.2 38.0 33.6 38.0 45-49 36.33645 38.0 37.0 38.0 33.4 38.0 50-54 36.05425 38.0 37.0 38.0 32.2 38.0 55-59 35.815 38.0 36.6 38.0 30.4 38.0 60-64 35.878249999999994 38.0 36.8 38.0 31.4 38.0 65-69 35.56665 38.0 36.2 38.0 29.6 38.0 70-74 35.70075 38.0 36.6 38.0 30.2 38.0 75-79 35.0167 38.0 36.0 38.0 28.6 38.0 80-84 34.7007 38.0 35.6 38.0 27.2 38.0 85-89 34.9381 38.0 35.0 38.0 27.6 38.0 90-94 34.731049999999996 38.0 34.8 38.0 26.6 38.0 95-99 34.4769 38.0 34.6 38.0 25.4 38.0 100-104 34.1072 38.0 34.0 38.0 23.2 38.0 105-109 33.6494 37.8 33.8 38.0 20.2 38.0 110-114 33.425799999999995 37.2 33.0 38.0 18.2 38.0 115-119 32.8765 37.0 31.0 38.0 16.2 38.0 120-124 32.40465 36.8 30.6 38.0 15.0 38.0 125-129 31.69885 36.8 30.4 38.0 14.6 38.0 130-134 29.984949999999998 34.6 25.6 38.0 13.4 38.0 135-139 28.627250000000004 33.0 21.8 38.0 12.2 38.0 140-144 28.042099999999998 33.0 21.6 38.0 3.8 38.0 145-149 25.82145 33.0 11.8 38.0 2.0 38.0 150-151 19.391624999999998 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 4.0 15 2.0 16 4.0 17 2.0 18 1.0 19 6.0 20 11.0 21 8.0 22 27.0 23 31.0 24 43.0 25 53.0 26 74.0 27 70.0 28 86.0 29 115.0 30 137.0 31 196.0 32 264.0 33 326.0 34 405.0 35 629.0 36 845.0 37 658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.63587921847247 18.650088809946713 10.53032225323522 36.1837097183456 2 20.075000000000003 24.875 37.9 17.150000000000002 3 17.775 30.075000000000003 29.049999999999997 23.1 4 21.05 36.525 23.025000000000002 19.400000000000002 5 18.85 38.275 24.099999999999998 18.775 6 15.825 35.699999999999996 26.150000000000002 22.325 7 11.875 18.725 47.949999999999996 21.45 8 16.875 21.0 28.375 33.75 9 17.0 22.325 31.474999999999998 29.2 10-14 18.62 30.12 26.924999999999997 24.335 15-19 19.064999999999998 29.145 28.23 23.56 20-24 19.29 29.48 27.92 23.31 25-29 18.970000000000002 29.439999999999998 28.005000000000003 23.585 30-34 19.52 28.415000000000003 28.04 24.025 35-39 19.885 28.384999999999998 28.13 23.599999999999998 40-44 19.3 28.715000000000003 28.415000000000003 23.57 45-49 19.64 29.415000000000003 27.61 23.335 50-54 19.365 29.205 28.134999999999998 23.294999999999998 55-59 19.225 28.810000000000002 27.975 23.990000000000002 60-64 20.24 28.865000000000002 27.415 23.48 65-69 19.470000000000002 29.455 27.77 23.305 70-74 19.646964696469645 28.84788478847885 27.75777577757776 23.74737473747375 75-79 19.90261716372489 27.956989247311824 28.535199837695274 23.605193751268004 80-84 20.207253886010363 28.35009651529005 27.781164279183173 23.661485319516405 85-89 20.255000000000003 28.810000000000002 27.595 23.34 90-94 19.86 29.345 27.62 23.175 95-99 19.564999999999998 28.804999999999996 28.110000000000003 23.52 100-104 19.72 28.74 27.694999999999997 23.845 105-109 20.23 28.24 27.905 23.625 110-114 20.345 28.970000000000002 27.32 23.365 115-119 20.330000000000002 28.965000000000003 27.525 23.18 120-124 20.128051220488192 28.756502601040417 27.235894357743096 23.87955182072829 125-129 20.257025702570257 28.76787678767877 27.652765276527653 23.32233223322332 130-134 20.32311641250189 28.914389249584783 26.835774321807843 23.92672001610549 135-139 20.584409086360452 28.36985890123086 27.33913739617733 23.70659461623136 140-144 20.555277638819412 28.0040020010005 27.32366183091546 24.117058529264632 145-149 20.673751754561863 28.213354722277924 26.79466613194305 24.318227391217164 150-151 21.370412125767256 26.84454465739697 26.518852561693603 25.26619065514218 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 2.0 22 2.5 23 4.0 24 5.5 25 5.5 26 5.5 27 10.5 28 12.0 29 17.5 30 22.0 31 30.0 32 48.0 33 57.5 34 68.5 35 88.0 36 108.5 37 129.5 38 170.0 39 195.5 40 213.0 41 242.5 42 240.5 43 251.5 44 279.5 45 275.0 46 248.0 47 224.0 48 200.0 49 174.5 50 150.5 51 116.0 52 91.0 53 76.5 54 62.0 55 44.0 56 26.5 57 23.5 58 24.0 59 17.0 60 9.5 61 7.0 62 6.5 63 3.0 64 3.5 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 1.4200000000000002 80-84 1.5699999999999998 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.01 130-134 0.655 135-139 0.06999999999999999 140-144 0.05 145-149 0.26 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.025 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.199999999999999 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTCC 10 0.006899958 144.51251 5 >>END_MODULE SRR7166209 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166209_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42275 33.0 33.0 34.0 32.0 34.0 2 32.46425 33.0 33.0 34.0 31.0 34.0 3 32.5985 33.0 33.0 34.0 32.0 34.0 4 32.4505 33.0 33.0 34.0 31.0 34.0 5 32.47475 33.0 33.0 34.0 31.0 34.0 6 36.68975 38.0 38.0 38.0 35.0 38.0 7 36.659 38.0 38.0 38.0 35.0 38.0 8 36.7615 38.0 38.0 38.0 35.0 38.0 9 36.592 38.0 38.0 38.0 35.0 38.0 10-14 36.444100000000006 38.0 38.0 38.0 34.0 38.0 15-19 36.34675 38.0 38.0 38.0 33.6 38.0 20-24 36.15085 38.0 37.8 38.0 32.8 38.0 25-29 36.3077 38.0 38.0 38.0 33.8 38.0 30-34 36.29365 38.0 38.0 38.0 33.4 38.0 35-39 36.0787 38.0 38.0 38.0 32.8 38.0 40-44 36.02005 38.0 37.4 38.0 32.6 38.0 45-49 35.822449999999996 38.0 37.0 38.0 31.2 38.0 50-54 35.78025 38.0 37.0 38.0 30.8 38.0 55-59 35.7164 38.0 37.0 38.0 30.4 38.0 60-64 35.8157 38.0 37.0 38.0 31.0 38.0 65-69 35.63975000000001 38.0 37.0 38.0 29.8 38.0 70-74 35.498749999999994 38.0 37.0 38.0 29.0 38.0 75-79 35.31585 38.0 36.6 38.0 28.6 38.0 80-84 35.085 38.0 36.0 38.0 28.2 38.0 85-89 34.975100000000005 38.0 36.0 38.0 27.4 38.0 90-94 34.770799999999994 38.0 35.8 38.0 26.4 38.0 95-99 34.6684 38.0 35.4 38.0 25.8 38.0 100-104 34.271100000000004 38.0 35.0 38.0 22.4 38.0 105-109 34.174249999999994 38.0 34.6 38.0 23.2 38.0 110-114 33.92985 38.0 34.2 38.0 23.0 38.0 115-119 33.3583 38.0 34.0 38.0 15.0 38.0 120-124 32.79 38.0 32.4 38.0 15.0 38.0 125-129 32.14595 37.2 31.2 38.0 15.0 38.0 130-134 31.40575 36.8 30.6 38.0 13.4 38.0 135-139 30.47865 36.0 28.8 38.0 12.8 38.0 140-144 29.304250000000003 36.0 25.6 38.0 3.8 38.0 145-149 26.87595 33.2 14.8 38.0 2.0 38.0 150-151 21.363375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 1.0 5 3.0 6 1.0 7 5.0 8 2.0 9 0.0 10 3.0 11 5.0 12 5.0 13 4.0 14 1.0 15 10.0 16 6.0 17 7.0 18 13.0 19 14.0 20 18.0 21 13.0 22 35.0 23 28.0 24 35.0 25 49.0 26 51.0 27 59.0 28 80.0 29 81.0 30 120.0 31 124.0 32 164.0 33 228.0 34 304.0 35 456.0 36 803.0 37 1255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.284571142785694 17.35433858464616 15.153788447111777 29.207301825456366 2 23.755938984746187 24.406101525381345 34.60865216304076 17.22930732683171 3 19.779944986246562 27.231807951987996 32.53313328332083 20.455113778444613 4 23.411705852926463 35.24262131065532 22.56128064032016 18.78439219609805 5 22.786393196598297 38.14407203601801 21.360680340170084 17.70885442721361 6 17.549999999999997 37.574999999999996 24.6 20.275000000000002 7 16.675 16.1 46.35 20.875 8 21.0 21.65 26.674999999999997 30.675 9 22.375 24.0 27.900000000000002 25.724999999999998 10-14 22.175 29.544999999999998 27.425 20.855 15-19 22.759999999999998 28.165000000000003 28.345 20.73 20-24 23.265 28.860000000000003 27.46 20.415 25-29 22.415 28.825 28.244999999999997 20.515 30-34 22.58 28.000000000000004 28.42 21.0 35-39 22.7022702270227 28.902890289028903 28.352835283528353 20.042004200420042 40-44 22.765 28.13 28.4 20.705000000000002 45-49 22.82 28.425 28.15 20.605 50-54 22.74 27.889999999999997 28.985 20.385 55-59 23.105 28.249999999999996 28.71 19.935 60-64 23.605 28.835 27.474999999999998 20.085 65-69 23.064999999999998 28.725 28.29 19.919999999999998 70-74 23.305 27.93 28.965000000000003 19.8 75-79 23.195 27.685 28.945 20.175 80-84 22.905 27.68 28.935 20.48 85-89 23.34 28.585 28.1 19.975 90-94 23.18 28.21 28.265 20.345 95-99 23.56 28.09 28.16 20.19 100-104 23.57353603040456 28.354253137970698 28.0892133820073 19.982997449617443 105-109 23.574429771908765 27.936174469787918 28.50640256102441 19.982993197278912 110-114 23.96479295859172 28.210642128425683 27.665533106621325 20.15903180636127 115-119 24.015 28.665000000000003 27.515 19.805 120-124 25.035 28.325 27.544999999999998 19.095000000000002 125-129 24.465 28.52 27.63 19.384999999999998 130-134 24.82 28.51 27.22 19.45 135-139 24.975 27.845 27.955000000000002 19.225 140-144 25.230000000000004 28.115000000000002 27.415 19.24 145-149 25.415 28.21 27.32 19.055 150-151 26.6125 27.224999999999998 27.187499999999996 18.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 1.5 23 1.0 24 1.5 25 7.0 26 8.5 27 5.5 28 8.5 29 13.5 30 19.0 31 26.5 32 32.0 33 42.0 34 61.5 35 74.0 36 91.0 37 128.0 38 152.0 39 178.0 40 201.5 41 229.0 42 268.0 43 275.5 44 280.5 45 284.0 46 274.0 47 257.0 48 214.0 49 187.5 50 163.5 51 124.0 52 92.0 53 70.0 54 62.0 55 48.5 56 32.5 57 18.5 58 15.5 59 13.5 60 7.0 61 4.5 62 4.0 63 3.5 64 3.5 65 2.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.04 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.675 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.512499999999999 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.574999999999999 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934038 spots for SRR7166209.sra Written 934038 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra Read 934032 spots for SRR7166209.sra Written 934032 spots for SRR7166209.sra SRR ids: ['SRR7166209.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmhmk10g SRR7166209.sra spots: 18680646 blocks: [[1, 934032], [934033, 1868064], [1868065, 2802096], [2802097, 3736128], [3736129, 4670160], [4670161, 5604192], [5604193, 6538224], [6538225, 7472256], [7472257, 8406288], [8406289, 9340320], [9340321, 10274352], [10274353, 11208384], [11208385, 12142416], [12142417, 13076448], [13076449, 14010480], [14010481, 14944512], [14944513, 15878544], [15878545, 16812576], [16812577, 17746608], [17746609, 18680646]] SRR7166209 file size 6308557 SRR7166209 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166209 SRR7166209_1.fastq SRR7166209_2.fastq Input file: SRR7166209_1.fastq Paired file: SRR7166209_2.fastq trimmed: SRR7166209-trimmed-pair1.fastq, SRR7166209-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:52:13 2025 >> started Sat Feb 15 02:52:32 2025 >> done (19.041s) 18680646 read pairs processed; of these: 26101 ( 0.14%) short read pairs filtered out after trimming by size control 24678 ( 0.13%) empty read pairs filtered out after trimming by size control 18629867 (99.73%) read pairs available; of these: 13214844 (70.93%) trimmed read pairs available after processing 5415023 (29.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 8 0.00% 20 5 0.00% 21 7 0.00% 22 5 0.00% 23 12 0.00% 24 10 0.00% 25 7 0.00% 26 9 0.00% 27 8 0.00% 28 15 0.00% 29 18 0.00% 30 15 0.00% 31 14 0.00% 32 21 0.00% 33 13 0.00% 34 21 0.00% 35 24 0.00% 36 27 0.00% 37 24 0.00% 38 33 0.00% 39 35 0.00% 40 33 0.00% 41 30 0.00% 42 42 0.00% 43 46 0.00% 44 56 0.00% 45 60 0.00% 46 60 0.00% 47 83 0.00% 48 78 0.00% 49 99 0.00% 50 122 0.00% 51 173 0.00% 52 157 0.00% 53 196 0.00% 54 206 0.00% 55 237 0.00% 56 243 0.00% 57 311 0.00% 58 293 0.00% 59 377 0.00% 60 454 0.00% 61 517 0.00% 62 620 0.00% 63 706 0.00% 64 766 0.00% 65 864 0.00% 66 930 0.00% 67 1054 0.01% 68 1189 0.01% 69 1357 0.01% 70 1580 0.01% 71 1861 0.01% 72 2150 0.01% 73 2420 0.01% 74 2650 0.01% 75 2931 0.02% 76 3235 0.02% 77 3601 0.02% 78 3977 0.02% 79 4463 0.02% 80 4903 0.03% 81 5635 0.03% 82 6690 0.04% 83 7448 0.04% 84 8809 0.05% 85 10081 0.05% 86 10395 0.06% 87 10848 0.06% 88 11624 0.06% 89 12608 0.07% 90 13445 0.07% 91 14465 0.08% 92 16010 0.09% 93 17093 0.09% 94 18316 0.10% 95 19618 0.11% 96 20619 0.11% 97 21081 0.11% 98 22042 0.12% 99 23438 0.13% 100 24848 0.13% 101 26391 0.14% 102 28439 0.15% 103 30532 0.16% 104 32145 0.17% 105 33987 0.18% 106 35441 0.19% 107 36440 0.20% 108 37459 0.20% 109 39201 0.21% 110 41212 0.22% 111 43535 0.23% 112 46280 0.25% 113 49802 0.27% 114 52692 0.28% 115 55512 0.30% 116 57723 0.31% 117 59363 0.32% 118 62151 0.33% 119 64375 0.35% 120 67229 0.36% 121 71270 0.38% 122 75376 0.40% 123 79599 0.43% 124 84911 0.46% 125 89847 0.48% 126 94820 0.51% 127 98220 0.53% 128 102531 0.55% 129 109172 0.59% 130 115731 0.62% 131 122645 0.66% 132 132305 0.71% 133 141431 0.76% 134 153892 0.83% 135 168597 0.90% 136 177118 0.95% 137 184463 0.99% 138 197181 1.06% 139 213883 1.15% 140 236252 1.27% 141 240819 1.29% 142 262984 1.41% 143 294791 1.58% 144 337002 1.81% 145 399470 2.14% 146 491173 2.64% 147 635356 3.41% 148 880422 4.73% 149 1503271 8.07% 150 4279816 22.97% 151 5415023 29.07% 18629867 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=16 prefix-density=0.58 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=21.13 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.1 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=92.21 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.4 sequence=CAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGACATCGTTGAGACTGAGAAGAGCCATGTCTACACTGGAGTCATGGAGGTTCCAGCAACCGAGAACGATGGCAAGTGCAAGTGCGG SRR7166209 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:53:29 Started mapping on | Feb 15 02:53:29 Finished on | Feb 15 02:56:23 Mapping speed, Million of reads per hour | 385.45 Number of input reads | 18629867 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17068372 Uniquely mapped reads % | 91.62% Average mapped length | 287.38 Number of splices: Total | 16149331 Number of splices: Annotated (sjdb) | 15819243 Number of splices: GT/AG | 15882764 Number of splices: GC/AG | 208422 Number of splices: AT/AC | 12445 Number of splices: Non-canonical | 45700 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431862 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 35731 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.77% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1153999 1153999 1153999 N_multimapping 431862 431862 431862 N_noFeature 671564 16854909 796744 N_ambiguous 174065 985 85108 UnstrandedReadsAssigned:16222743 PositiveStrandReadsAssigned:212478 NegativeStrandReadsAssigned:16186520 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR7166209 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166209-trimmed-pair1.fastq SRR7166209-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,629,867 reads, 16,184,324 reads pseudoaligned [quant] estimated average fragment length: 229.535 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7166209.ke.tsv 34699 SRR7166209.se.tsv 87100 total ==> SRR7166209.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.46 1686 56.8611 Potri.005G024800.1.v4.1 1035 806.465 607 45.4238 Potri.004G059700.1.v4.1 961 732.495 36 2.96605 Potri.007G009000.2.v4.1 1416 1187.46 0 0 Potri.003G141000.2.v4.1 2943 2714.46 878.025 19.5211 Potri.016G087400.1.v4.1 270 88.8703 1030 699.457 Potri.015G069301.1.v4.1 564 340.179 0 0 Potri.010G195200.1.v4.1 1773 1544.46 661 25.8288 Potri.012G127500.1.v4.1 977 748.475 7031 566.918 ==> SRR7166209.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 548 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 124 SRR7166209 completed mapping pipeline successfully