Starting /dee2/code/volunteer_pipeline.sh SRR7166210 current disk space = 3104067375104 free memory = 1462789892 SRR7166210 SRAfilesize 2558c498832553fbef0ea131ed879461 SRR7166210.sra SRR7166210.sra file validated SRR7166210 is paired end SRR7166210 is conventional basespace SRR7166210 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166210_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.98475 18.0 18.0 25.0 18.0 32.0 2 22.56925 18.0 18.0 27.0 18.0 32.0 3 28.24575 27.0 27.0 32.0 25.0 32.0 4 30.83875 32.0 32.0 33.0 27.0 33.0 5 32.09725 33.0 32.0 33.0 32.0 33.0 6 36.80475 38.0 37.0 38.0 35.0 38.0 7 37.20475 38.0 38.0 38.0 36.0 38.0 8 37.311 38.0 38.0 38.0 36.0 38.0 9 37.3535 38.0 38.0 38.0 37.0 38.0 10-14 37.4524 38.0 38.0 38.0 37.0 38.0 15-19 37.516400000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.4916 38.0 38.0 38.0 37.2 38.0 25-29 37.468199999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.4598 38.0 38.0 38.0 37.2 38.0 35-39 37.403650000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.40055 38.0 38.0 38.0 37.0 38.0 45-49 37.38484999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.2856 38.0 38.0 38.0 37.0 38.0 55-59 36.932399999999994 38.0 38.0 38.0 36.4 38.0 60-64 37.07280000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.1688 38.0 38.0 38.0 36.0 38.0 70-74 37.11705 38.0 38.0 38.0 36.0 38.0 75-79 37.071799999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.94250000000001 38.0 38.0 38.0 35.8 38.0 85-89 36.89665 38.0 38.0 38.0 35.4 38.0 90-94 36.76195 38.0 38.0 38.0 34.8 38.0 95-99 36.67059999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.59675 38.0 38.0 38.0 34.4 38.0 105-109 36.447500000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.469 38.0 38.0 38.0 34.0 38.0 115-119 36.26585 38.0 37.8 38.0 33.8 38.0 120-124 36.0517 38.0 37.0 38.0 33.0 38.0 125-129 35.950250000000004 38.0 37.0 38.0 32.8 38.0 130-134 35.71345000000001 38.0 36.4 38.0 31.0 38.0 135-139 35.5586 38.0 36.0 38.0 31.0 38.0 140-144 35.228950000000005 38.0 35.8 38.0 30.0 38.0 145-149 34.7999 38.0 35.4 38.0 28.0 38.0 150-151 31.768375 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 0.0 17 1.0 18 0.0 19 2.0 20 3.0 21 1.0 22 1.0 23 6.0 24 8.0 25 4.0 26 11.0 27 12.0 28 18.0 29 28.0 30 35.0 31 58.0 32 85.0 33 99.0 34 175.0 35 304.0 36 804.0 37 2339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 8.731171815164666 42.78784784273679 10.492724023487362 37.98825631861118 2 19.75 34.225 26.724999999999998 19.3 3 17.325 32.824999999999996 25.074999999999996 24.775 4 19.375 38.2 21.5 20.925 5 19.27409261576971 39.774718397997496 22.478097622027533 18.473091364205256 6 16.075 37.9 23.3 22.725 7 11.825 19.55 46.550000000000004 22.075 8 17.2 20.625 27.400000000000002 34.775 9 17.349999999999998 23.375 30.225 29.049999999999997 10-14 19.295 30.769999999999996 25.895000000000003 24.04 15-19 19.71 29.25 27.029999999999998 24.01 20-24 19.470000000000002 29.404999999999998 27.865000000000002 23.26 25-29 19.495 29.23 27.715 23.56 30-34 19.759999999999998 29.035 27.505000000000003 23.7 35-39 19.77 29.060000000000002 27.505000000000003 23.665 40-44 19.415 28.860000000000003 28.235 23.49 45-49 19.96 28.665000000000003 27.675 23.7 50-54 19.566197465310825 28.367479837699744 27.751339978961077 24.314982718028354 55-59 19.856616347755843 28.883727974958344 28.005250668955416 23.25440500833039 60-64 19.519038076152302 28.53206412825651 28.12625250501002 23.822645290581164 65-69 20.19 29.035 27.505000000000003 23.27 70-74 19.93 29.385 27.73 22.955000000000002 75-79 20.11 29.07 27.715 23.105 80-84 19.7 29.065 27.875 23.36 85-89 19.78 28.82 27.845 23.555 90-94 19.994999999999997 28.785 27.51 23.71 95-99 20.32 28.904999999999998 27.77 23.005 100-104 20.32 28.49 28.155 23.035 105-109 20.535535535535534 28.743743743743742 27.51751751751752 23.203203203203206 110-114 20.96 29.044999999999998 26.474999999999998 23.52 115-119 20.505000000000003 28.785 27.42 23.29 120-124 20.66 27.71 27.73 23.9 125-129 20.96 28.345 27.36 23.335 130-134 20.655 28.325 27.205000000000002 23.815 135-139 20.77 28.9 26.834999999999997 23.494999999999997 140-144 21.335 28.655 26.290000000000003 23.72 145-149 20.9 28.449999999999996 26.590000000000003 24.060000000000002 150-151 21.04999373512091 28.304723718832225 26.888861044981834 23.756421501065027 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 2.0 23 2.0 24 2.5 25 6.0 26 10.0 27 12.5 28 14.5 29 21.0 30 28.0 31 33.5 32 40.5 33 55.5 34 73.5 35 88.5 36 101.0 37 123.5 38 165.0 39 186.0 40 207.5 41 242.5 42 248.5 43 262.0 44 271.0 45 254.0 46 250.5 47 250.5 48 218.0 49 169.5 50 138.0 51 120.0 52 91.0 53 72.0 54 65.0 55 47.0 56 36.0 57 23.5 58 14.5 59 14.5 60 12.0 61 8.5 62 5.0 63 2.0 64 1.5 65 0.5 66 0.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.185 55-59 0.9650000000000001 60-64 0.2 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.1 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.725 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 6.175000000000001 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 7.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGATAT 10 0.0065993075 146.65823 1 >>END_MODULE SRR7166210 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166210_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99575 33.0 33.0 34.0 32.0 34.0 2 33.17325 34.0 33.0 34.0 32.0 34.0 3 33.23375 34.0 33.0 34.0 33.0 34.0 4 33.14475 34.0 33.0 34.0 33.0 34.0 5 33.056 34.0 33.0 34.0 33.0 34.0 6 37.3785 38.0 38.0 38.0 37.0 38.0 7 37.41275 38.0 38.0 38.0 37.0 38.0 8 37.3785 38.0 38.0 38.0 37.0 38.0 9 37.43025 38.0 38.0 38.0 37.0 38.0 10-14 37.400549999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.3824 38.0 38.0 38.0 37.4 38.0 20-24 37.387299999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.33605000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.2511 38.0 38.0 38.0 37.0 38.0 35-39 37.1796 38.0 38.0 38.0 37.0 38.0 40-44 37.2106 38.0 38.0 38.0 37.0 38.0 45-49 37.138949999999994 38.0 38.0 38.0 36.8 38.0 50-54 37.0925 38.0 38.0 38.0 36.4 38.0 55-59 37.02785 38.0 38.0 38.0 36.0 38.0 60-64 37.02675000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.98565 38.0 38.0 38.0 36.0 38.0 70-74 36.8779 38.0 38.0 38.0 36.0 38.0 75-79 36.80665 38.0 38.0 38.0 35.4 38.0 80-84 36.71755 38.0 38.0 38.0 35.0 38.0 85-89 36.67785 38.0 38.0 38.0 35.0 38.0 90-94 36.506350000000005 38.0 38.0 38.0 34.4 38.0 95-99 36.3649 38.0 38.0 38.0 34.0 38.0 100-104 36.3187 38.0 38.0 38.0 33.8 38.0 105-109 36.1916 38.0 37.8 38.0 33.8 38.0 110-114 35.973299999999995 38.0 37.2 38.0 33.0 38.0 115-119 35.7984 38.0 37.0 38.0 32.4 38.0 120-124 35.6407 38.0 36.8 38.0 31.8 38.0 125-129 35.447950000000006 38.0 36.0 38.0 31.0 38.0 130-134 35.21215 38.0 36.0 38.0 29.6 38.0 135-139 34.9459 38.0 35.6 38.0 28.6 38.0 140-144 34.31245 38.0 35.0 38.0 25.2 38.0 145-149 33.372699999999995 38.0 34.2 38.0 18.4 38.0 150-151 29.490250000000003 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 2.0 5 1.0 6 3.0 7 1.0 8 3.0 9 1.0 10 0.0 11 0.0 12 3.0 13 4.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 2.0 21 6.0 22 7.0 23 4.0 24 10.0 25 17.0 26 9.0 27 17.0 28 25.0 29 34.0 30 37.0 31 51.0 32 78.0 33 103.0 34 152.0 35 281.0 36 615.0 37 2520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 16.1 14.499999999999998 29.375 2 23.775 23.325000000000003 36.275 16.625 3 19.575 25.95 33.025 21.45 4 23.875 35.525 20.95 19.650000000000002 5 22.425 37.6 22.325 17.65 6 18.224999999999998 37.275000000000006 24.525 19.975 7 17.349999999999998 15.65 46.2 20.8 8 19.2 21.65 28.349999999999998 30.8 9 22.05 23.549999999999997 27.975 26.424999999999997 10-14 22.655 28.939999999999998 26.755000000000003 21.65 15-19 22.99 28.125 27.63 21.255 20-24 22.975 28.689999999999998 27.255000000000003 21.08 25-29 22.96 28.32 28.110000000000003 20.61 30-34 23.535 27.800000000000004 27.744999999999997 20.919999999999998 35-39 23.05 27.145000000000003 28.68 21.125 40-44 23.36 28.035 27.750000000000004 20.855 45-49 22.965 28.199999999999996 28.055000000000003 20.78 50-54 23.21 27.665 28.785 20.34 55-59 23.02 27.955000000000002 27.88 21.145 60-64 23.055 27.77 28.325 20.849999999999998 65-69 23.57 28.265 27.63 20.535 70-74 23.315 28.050000000000004 28.025 20.61 75-79 23.06 27.92 28.555000000000003 20.465 80-84 23.175 28.315 28.199999999999996 20.31 85-89 23.7 27.839999999999996 28.349999999999998 20.11 90-94 23.53 28.105000000000004 28.235 20.13 95-99 23.68 28.37 27.6 20.349999999999998 100-104 23.599999999999998 28.54 27.450000000000003 20.41 105-109 24.16 28.16 27.55 20.13 110-114 23.200000000000003 28.16 28.255000000000003 20.385 115-119 24.224999999999998 27.555000000000003 27.889999999999997 20.330000000000002 120-124 24.099999999999998 28.050000000000004 27.595 20.255000000000003 125-129 24.57 27.525 27.97 19.935 130-134 24.185000000000002 27.3 28.060000000000002 20.455000000000002 135-139 25.06 27.334999999999997 28.025 19.580000000000002 140-144 25.655 27.26 27.500000000000004 19.585 145-149 25.91 27.85 26.935 19.305 150-151 25.7661038148843 27.4296435272045 27.4671669793621 19.337085678549094 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 4.0 26 5.5 27 5.5 28 5.5 29 9.0 30 12.5 31 15.5 32 31.5 33 40.5 34 45.5 35 61.5 36 80.0 37 118.0 38 144.5 39 155.0 40 194.5 41 243.5 42 260.5 43 269.0 44 278.5 45 286.0 46 279.5 47 244.0 48 218.5 49 205.5 50 180.5 51 139.0 52 110.5 53 92.0 54 68.5 55 52.0 56 36.5 57 22.5 58 17.0 59 14.5 60 13.0 61 14.5 62 9.5 63 2.5 64 2.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.300000000000001 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 7.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCATC 10 0.006830828 145.0 9 TTGAGGC 10 0.006830828 145.0 2 >>END_MODULE Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793368 spots for SRR7166210.sra Written 793368 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra Read 793350 spots for SRR7166210.sra Written 793350 spots for SRR7166210.sra SRR ids: ['SRR7166210.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7yrf2m4 SRR7166210.sra spots: 15867018 blocks: [[1, 793350], [793351, 1586700], [1586701, 2380050], [2380051, 3173400], [3173401, 3966750], [3966751, 4760100], [4760101, 5553450], [5553451, 6346800], [6346801, 7140150], [7140151, 7933500], [7933501, 8726850], [8726851, 9520200], [9520201, 10313550], [10313551, 11106900], [11106901, 11900250], [11900251, 12693600], [12693601, 13486950], [13486951, 14280300], [14280301, 15073650], [15073651, 15867018]] SRR7166210 file size 5355111 SRR7166210 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166210 SRR7166210_1.fastq SRR7166210_2.fastq Input file: SRR7166210_1.fastq Paired file: SRR7166210_2.fastq trimmed: SRR7166210-trimmed-pair1.fastq, SRR7166210-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:08:29 2025 >> started Sat Feb 15 02:08:49 2025 >> done (20.023s) 15867018 read pairs processed; of these: 10615 ( 0.07%) short read pairs filtered out after trimming by size control 13433 ( 0.08%) empty read pairs filtered out after trimming by size control 15842970 (99.85%) read pairs available; of these: 7090315 (44.75%) trimmed read pairs available after processing 8752655 (55.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 11 0.00% 21 7 0.00% 22 6 0.00% 23 5 0.00% 24 8 0.00% 25 11 0.00% 26 11 0.00% 27 5 0.00% 28 8 0.00% 29 6 0.00% 30 10 0.00% 31 10 0.00% 32 6 0.00% 33 9 0.00% 34 8 0.00% 35 12 0.00% 36 13 0.00% 37 13 0.00% 38 17 0.00% 39 14 0.00% 40 13 0.00% 41 16 0.00% 42 26 0.00% 43 26 0.00% 44 27 0.00% 45 18 0.00% 46 35 0.00% 47 47 0.00% 48 38 0.00% 49 35 0.00% 50 60 0.00% 51 65 0.00% 52 60 0.00% 53 71 0.00% 54 88 0.00% 55 77 0.00% 56 99 0.00% 57 120 0.00% 58 165 0.00% 59 160 0.00% 60 214 0.00% 61 269 0.00% 62 295 0.00% 63 308 0.00% 64 320 0.00% 65 378 0.00% 66 405 0.00% 67 476 0.00% 68 543 0.00% 69 628 0.00% 70 708 0.00% 71 852 0.01% 72 1001 0.01% 73 1161 0.01% 74 1339 0.01% 75 1439 0.01% 76 1673 0.01% 77 1751 0.01% 78 2000 0.01% 79 2378 0.02% 80 2520 0.02% 81 3152 0.02% 82 3544 0.02% 83 4097 0.03% 84 4791 0.03% 85 5534 0.03% 86 5832 0.04% 87 6286 0.04% 88 6698 0.04% 89 7223 0.05% 90 7941 0.05% 91 8541 0.05% 92 9872 0.06% 93 10738 0.07% 94 11727 0.07% 95 12067 0.08% 96 12726 0.08% 97 13289 0.08% 98 13944 0.09% 99 15374 0.10% 100 15334 0.10% 101 16944 0.11% 102 18346 0.12% 103 19572 0.12% 104 20978 0.13% 105 21990 0.14% 106 22739 0.14% 107 23087 0.15% 108 23948 0.15% 109 24726 0.16% 110 25499 0.16% 111 27229 0.17% 112 29407 0.19% 113 30934 0.20% 114 33118 0.21% 115 34677 0.22% 116 35240 0.22% 117 36041 0.23% 118 36794 0.23% 119 37239 0.24% 120 38729 0.24% 121 40393 0.25% 122 42465 0.27% 123 44738 0.28% 124 47476 0.30% 125 49070 0.31% 126 50696 0.32% 127 51572 0.33% 128 52277 0.33% 129 53149 0.34% 130 54821 0.35% 131 56956 0.36% 132 59817 0.38% 133 63006 0.40% 134 66170 0.42% 135 70114 0.44% 136 72889 0.46% 137 76858 0.49% 138 79591 0.50% 139 82105 0.52% 140 85851 0.54% 141 91709 0.58% 142 100811 0.64% 143 111123 0.70% 144 128290 0.81% 145 150356 0.95% 146 181453 1.15% 147 234261 1.48% 148 341385 2.15% 149 643670 4.06% 150 3149187 19.88% 151 8752655 55.25% 15842970 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=75.22 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.7 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=3.2 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=34.29 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.7 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7166210 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:09:56 Started mapping on | Feb 15 02:09:57 Finished on | Feb 15 02:12:02 Mapping speed, Million of reads per hour | 456.28 Number of input reads | 15842970 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14903516 Uniquely mapped reads % | 94.07% Average mapped length | 292.61 Number of splices: Total | 14216716 Number of splices: Annotated (sjdb) | 13964433 Number of splices: GT/AG | 13984092 Number of splices: GC/AG | 181982 Number of splices: AT/AC | 9930 Number of splices: Non-canonical | 40712 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.27 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 374826 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 40003 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574445 574445 574445 N_multimapping 374826 374826 374826 N_noFeature 438796 14707716 556940 N_ambiguous 158479 1243 79897 UnstrandedReadsAssigned:14306241 PositiveStrandReadsAssigned:194557 NegativeStrandReadsAssigned:14266679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166210 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166210-trimmed-pair1.fastq SRR7166210-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,842,970 reads, 14,175,118 reads pseudoaligned [quant] estimated average fragment length: 234.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7166210.ke.tsv 34699 SRR7166210.se.tsv 87100 total ==> SRR7166210.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.84 945 37.9161 Potri.005G024800.1.v4.1 1035 801.841 160 14.2897 Potri.004G059700.1.v4.1 961 727.883 17 1.67255 Potri.007G009000.2.v4.1 1416 1182.84 0 0 Potri.003G141000.2.v4.1 2943 2709.84 474 12.5264 Potri.016G087400.1.v4.1 270 88.5871 999 807.581 Potri.015G069301.1.v4.1 564 337.421 0 0 Potri.010G195200.1.v4.1 1773 1539.84 268 12.4638 Potri.012G127500.1.v4.1 977 743.865 10725 1032.51 ==> SRR7166210.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 490 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 215 SRR7166210 completed mapping pipeline successfully