Starting /dee2/code/volunteer_pipeline.sh SRR7166211 current disk space = 2809841754112 free memory = 1575183964 SRR7166211 SRAfilesize 57d1ddb7a27ead4a7dab220394884cf6 SRR7166211.sra SRR7166211.sra file validated SRR7166211 is paired end SRR7166211 is conventional basespace SRR7166211 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166211_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.729 33.0 30.0 33.0 18.0 34.0 2 31.97275 33.0 31.0 33.0 29.0 34.0 3 31.584 33.0 31.0 33.0 29.0 34.0 4 30.77625 32.0 31.0 33.0 28.0 33.0 5 32.64925 33.0 33.0 33.0 32.0 34.0 6 36.16725 38.0 36.0 38.0 33.0 38.0 7 37.156 38.0 38.0 38.0 36.0 38.0 8 37.33125 38.0 38.0 38.0 36.0 38.0 9 37.553 38.0 38.0 38.0 37.0 38.0 10-14 37.561400000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.5665 38.0 38.0 38.0 38.0 38.0 20-24 37.59705 38.0 38.0 38.0 38.0 38.0 25-29 37.59355000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.54655 38.0 38.0 38.0 38.0 38.0 35-39 37.491949999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.4523 38.0 38.0 38.0 37.0 38.0 45-49 37.39855 38.0 38.0 38.0 37.0 38.0 50-54 37.40605 38.0 38.0 38.0 37.0 38.0 55-59 37.053200000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.1825 38.0 38.0 38.0 36.6 38.0 65-69 37.19965 38.0 38.0 38.0 36.4 38.0 70-74 37.11795 38.0 38.0 38.0 36.0 38.0 75-79 37.0605 38.0 38.0 38.0 36.0 38.0 80-84 37.05485 38.0 38.0 38.0 36.0 38.0 85-89 36.92229999999999 38.0 38.0 38.0 35.8 38.0 90-94 36.7667 38.0 38.0 38.0 35.2 38.0 95-99 36.72475 38.0 38.0 38.0 35.0 38.0 100-104 36.56850000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.4882 38.0 38.0 38.0 34.0 38.0 110-114 36.50555 38.0 38.0 38.0 34.0 38.0 115-119 36.2456 38.0 37.6 38.0 33.6 38.0 120-124 36.0652 38.0 37.2 38.0 33.0 38.0 125-129 35.879599999999996 38.0 37.0 38.0 32.2 38.0 130-134 35.66985 38.0 36.0 38.0 31.2 38.0 135-139 35.5696 38.0 36.0 38.0 31.0 38.0 140-144 35.1358 38.0 35.8 38.0 28.8 38.0 145-149 34.835300000000004 38.0 35.8 38.0 28.8 38.0 150-151 31.534875 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 3.0 21 2.0 22 3.0 23 1.0 24 9.0 25 15.0 26 11.0 27 17.0 28 19.0 29 26.0 30 28.0 31 48.0 32 51.0 33 89.0 34 142.0 35 246.0 36 671.0 37 2610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.46496815286624 18.08917197452229 9.961783439490446 28.484076433121018 2 20.549999999999997 23.1 39.175 17.175 3 17.4 29.825000000000003 30.2 22.575 4 20.974999999999998 34.875 25.124999999999996 19.025 5 21.5607803901951 37.49374687343672 22.686343171585793 18.25912956478239 6 15.55 37.375 24.775 22.3 7 13.700000000000001 20.25 45.6 20.45 8 17.45 20.474999999999998 28.849999999999998 33.225 9 17.474999999999998 22.075 31.525 28.925 10-14 20.22 29.354999999999997 26.995 23.43 15-19 20.565 29.060000000000002 27.16 23.215 20-24 20.165 28.785 28.24 22.81 25-29 19.965 28.915000000000003 28.389999999999997 22.73 30-34 19.985 29.160000000000004 27.93 22.925 35-39 20.169999999999998 28.585 28.299999999999997 22.945 40-44 20.330000000000002 28.49 28.09 23.09 45-49 20.16 29.285 27.075 23.48 50-54 19.759999999999998 28.53 28.33 23.380000000000003 55-59 20.392848149080837 28.66784185343742 27.736086628053386 23.203223369428354 60-64 19.62373661563094 28.164715300710498 28.800160112078455 23.411387971580105 65-69 20.495 29.080000000000002 27.6 22.825 70-74 20.39 28.875 28.035 22.7 75-79 20.44 28.075 28.095 23.39 80-84 19.715 28.725 28.095 23.465 85-89 20.515 28.675 27.93 22.88 90-94 20.14 28.655 28.46 22.745 95-99 20.785 28.23 28.060000000000002 22.925 100-104 20.691380259142527 28.560708389614287 27.415078293061185 23.332833058182 105-109 20.479455482708573 28.817376507682297 27.781392322706573 22.921775686902556 110-114 21.415 28.910000000000004 27.189999999999998 22.485 115-119 21.195 28.395 27.794999999999998 22.615 120-124 20.65 28.27 27.544999999999998 23.535 125-129 21.224999999999998 28.435 26.995 23.345 130-134 21.654999999999998 28.715000000000003 26.955000000000002 22.675 135-139 21.58 28.775000000000002 26.69 22.955000000000002 140-144 21.07 28.12 27.500000000000004 23.31 145-149 20.895 29.459999999999997 26.025 23.62 150-151 22.014785114647285 28.993860418493924 25.723593534644777 23.267760932214006 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.5 22 2.0 23 0.5 24 2.5 25 10.0 26 10.5 27 8.0 28 14.0 29 19.0 30 19.0 31 31.0 32 46.5 33 49.5 34 62.5 35 88.5 36 105.0 37 118.5 38 157.0 39 182.5 40 200.5 41 231.0 42 250.5 43 263.5 44 258.5 45 246.0 46 259.0 47 241.5 48 208.0 49 189.5 50 162.5 51 128.5 52 96.0 53 80.0 54 64.0 55 45.5 56 36.0 57 32.5 58 19.0 59 11.5 60 9.5 61 6.0 62 7.0 63 7.5 64 2.5 65 0.5 66 1.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.7250000000000001 60-64 0.06999999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.095 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 2.9625 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.3875 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.8875 0.0 0.0 0.0 0.0 128-129 6.3875 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.587499999999999 0.0 0.0 0.0 0.0 138-139 9.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTTC 10 0.0066610035 146.20253 4 GTTTCAC 10 0.0069196247 144.375 6 >>END_MODULE SRR7166211 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7166211_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.959 33.0 33.0 34.0 32.0 34.0 2 33.01675 33.0 33.0 34.0 32.0 34.0 3 33.0675 34.0 33.0 34.0 32.0 34.0 4 33.08675 34.0 33.0 34.0 32.0 34.0 5 33.089 34.0 33.0 34.0 32.0 34.0 6 37.29625 38.0 38.0 38.0 37.0 38.0 7 37.3815 38.0 38.0 38.0 37.0 38.0 8 37.3245 38.0 38.0 38.0 37.0 38.0 9 37.42 38.0 38.0 38.0 37.0 38.0 10-14 37.3202 38.0 38.0 38.0 37.0 38.0 15-19 37.2801 38.0 38.0 38.0 37.0 38.0 20-24 37.246 38.0 38.0 38.0 37.0 38.0 25-29 37.19605 38.0 38.0 38.0 37.0 38.0 30-34 37.14659999999999 38.0 38.0 38.0 36.4 38.0 35-39 37.0929 38.0 38.0 38.0 36.0 38.0 40-44 37.072050000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.98815 38.0 38.0 38.0 36.0 38.0 50-54 36.8232 38.0 38.0 38.0 35.6 38.0 55-59 36.7811 38.0 38.0 38.0 35.2 38.0 60-64 36.7243 38.0 38.0 38.0 35.0 38.0 65-69 36.71825 38.0 38.0 38.0 34.8 38.0 70-74 36.624550000000006 38.0 38.0 38.0 34.4 38.0 75-79 36.548700000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.35805 38.0 37.8 38.0 33.8 38.0 85-89 36.181799999999996 38.0 37.0 38.0 33.6 38.0 90-94 35.9721 38.0 37.0 38.0 32.4 38.0 95-99 35.813599999999994 38.0 37.0 38.0 32.2 38.0 100-104 35.64444999999999 38.0 37.0 38.0 30.6 38.0 105-109 35.44325 38.0 36.2 38.0 29.4 38.0 110-114 35.18814999999999 38.0 36.0 38.0 28.4 38.0 115-119 34.96505 38.0 35.4 38.0 28.0 38.0 120-124 34.58385 38.0 35.0 38.0 26.2 38.0 125-129 34.266850000000005 38.0 34.8 38.0 24.0 38.0 130-134 33.7502 38.0 34.2 38.0 22.2 38.0 135-139 33.29515 38.0 34.0 38.0 18.6 38.0 140-144 32.52135 37.8 33.2 38.0 14.2 38.0 145-149 31.0066 36.8 31.0 38.0 8.6 38.0 150-151 26.218625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 5.0 15 3.0 16 5.0 17 7.0 18 6.0 19 8.0 20 5.0 21 10.0 22 11.0 23 18.0 24 12.0 25 20.0 26 24.0 27 29.0 28 32.0 29 39.0 30 64.0 31 68.0 32 96.0 33 138.0 34 244.0 35 411.0 36 951.0 37 1788.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.625 17.325 12.35 27.700000000000003 2 23.9 22.900000000000002 35.75 17.45 3 20.775 26.224999999999998 31.724999999999998 21.275 4 23.45 35.875 22.425 18.25 5 22.275 38.925 22.6 16.2 6 18.375 37.35 23.275000000000002 21.0 7 17.125 14.725 45.775 22.375 8 18.825 22.95 28.825 29.4 9 21.95 23.849999999999998 27.575 26.625 10-14 22.24 29.07 27.255000000000003 21.435000000000002 15-19 23.11 27.605 28.51 20.775 20-24 22.37 28.87 27.775 20.985 25-29 22.925 28.194999999999997 28.365000000000002 20.515 30-34 22.345000000000002 28.585 28.134999999999998 20.935000000000002 35-39 22.314999999999998 28.725 27.894999999999996 21.065 40-44 23.56 28.62 27.345000000000002 20.474999999999998 45-49 22.189999999999998 28.425 28.294999999999998 21.09 50-54 22.52 28.075 28.794999999999998 20.61 55-59 22.86 27.88 28.405 20.855 60-64 22.985 28.38 28.165000000000003 20.47 65-69 23.005 28.08 27.575 21.34 70-74 23.195 28.744999999999997 27.715 20.345 75-79 22.994999999999997 28.18 28.24 20.585 80-84 22.515 28.565 28.845 20.075000000000003 85-89 23.505000000000003 28.415000000000003 27.905 20.175 90-94 22.81 28.105000000000004 28.375 20.71 95-99 22.86 27.950000000000003 28.475 20.715 100-104 23.535 27.994999999999997 28.389999999999997 20.080000000000002 105-109 23.285 28.405 28.53 19.78 110-114 24.08 28.535 27.224999999999998 20.16 115-119 23.94 28.775000000000002 27.345000000000002 19.939999999999998 120-124 23.765 28.74 27.894999999999996 19.6 125-129 24.145 29.37 26.91 19.575 130-134 24.175 28.505000000000003 27.744999999999997 19.575 135-139 24.535 28.549999999999997 27.389999999999997 19.525000000000002 140-144 24.834999999999997 28.52 26.52 20.125 145-149 25.16 28.58 26.51 19.75 150-151 25.203252032520325 27.76735459662289 26.804252657911192 20.225140712945592 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 2.0 24 1.0 25 1.5 26 5.5 27 8.5 28 8.0 29 14.5 30 21.5 31 23.0 32 32.5 33 45.0 34 57.5 35 70.0 36 83.0 37 113.5 38 140.5 39 163.0 40 206.0 41 244.5 42 268.0 43 290.0 44 294.0 45 276.0 46 270.5 47 243.5 48 218.0 49 202.0 50 151.5 51 110.0 52 95.5 53 79.5 54 65.5 55 53.5 56 33.5 57 22.5 58 21.0 59 16.5 60 9.5 61 8.5 62 5.0 63 2.5 64 2.5 65 2.5 66 2.0 67 2.5 68 2.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.37754845205134663 0.75 3 0.07550969041026932 0.22499999999999998 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 7.862500000000001 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785254 spots for SRR7166211.sra Written 785254 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra Read 785249 spots for SRR7166211.sra Written 785249 spots for SRR7166211.sra SRR ids: ['SRR7166211.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_99i7cch8 SRR7166211.sra spots: 15704985 blocks: [[1, 785249], [785250, 1570498], [1570499, 2355747], [2355748, 3140996], [3140997, 3926245], [3926246, 4711494], [4711495, 5496743], [5496744, 6281992], [6281993, 7067241], [7067242, 7852490], [7852491, 8637739], [8637740, 9422988], [9422989, 10208237], [10208238, 10993486], [10993487, 11778735], [11778736, 12563984], [12563985, 13349233], [13349234, 14134482], [14134483, 14919731], [14919732, 15704985]] SRR7166211 file size 5300203 SRR7166211 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7166211 SRR7166211_1.fastq SRR7166211_2.fastq Input file: SRR7166211_1.fastq Paired file: SRR7166211_2.fastq trimmed: SRR7166211-trimmed-pair1.fastq, SRR7166211-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Apr 15 11:26:35 2025 >> started Tue Apr 15 11:26:51 2025 >> done (16.424s) 15704985 read pairs processed; of these: 7562 ( 0.05%) short read pairs filtered out after trimming by size control 6534 ( 0.04%) empty read pairs filtered out after trimming by size control 15690889 (99.91%) read pairs available; of these: 7964590 (50.76%) trimmed read pairs available after processing 7726299 (49.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 6 0.00% 21 4 0.00% 22 4 0.00% 23 10 0.00% 24 6 0.00% 25 10 0.00% 26 10 0.00% 27 6 0.00% 28 9 0.00% 29 2 0.00% 30 13 0.00% 31 10 0.00% 32 11 0.00% 33 9 0.00% 34 13 0.00% 35 13 0.00% 36 10 0.00% 37 14 0.00% 38 19 0.00% 39 12 0.00% 40 17 0.00% 41 17 0.00% 42 20 0.00% 43 19 0.00% 44 22 0.00% 45 36 0.00% 46 26 0.00% 47 40 0.00% 48 49 0.00% 49 36 0.00% 50 58 0.00% 51 60 0.00% 52 62 0.00% 53 71 0.00% 54 102 0.00% 55 109 0.00% 56 129 0.00% 57 132 0.00% 58 123 0.00% 59 189 0.00% 60 223 0.00% 61 233 0.00% 62 268 0.00% 63 308 0.00% 64 372 0.00% 65 388 0.00% 66 388 0.00% 67 506 0.00% 68 594 0.00% 69 648 0.00% 70 735 0.00% 71 925 0.01% 72 1094 0.01% 73 1179 0.01% 74 1398 0.01% 75 1475 0.01% 76 1645 0.01% 77 1831 0.01% 78 2063 0.01% 79 2381 0.02% 80 2675 0.02% 81 3099 0.02% 82 3659 0.02% 83 4113 0.03% 84 4848 0.03% 85 5525 0.04% 86 5958 0.04% 87 6614 0.04% 88 7016 0.04% 89 7539 0.05% 90 8090 0.05% 91 8805 0.06% 92 10222 0.07% 93 10928 0.07% 94 12153 0.08% 95 12776 0.08% 96 13562 0.09% 97 14036 0.09% 98 14828 0.09% 99 16088 0.10% 100 16603 0.11% 101 17994 0.11% 102 19659 0.13% 103 21178 0.13% 104 22318 0.14% 105 23710 0.15% 106 24125 0.15% 107 24950 0.16% 108 26412 0.17% 109 26583 0.17% 110 27979 0.18% 111 30084 0.19% 112 31676 0.20% 113 33743 0.22% 114 35978 0.23% 115 37310 0.24% 116 38485 0.25% 117 39394 0.25% 118 39827 0.25% 119 41122 0.26% 120 42520 0.27% 121 44246 0.28% 122 46456 0.30% 123 48773 0.31% 124 52131 0.33% 125 53952 0.34% 126 56258 0.36% 127 56771 0.36% 128 58396 0.37% 129 59898 0.38% 130 61528 0.39% 131 63721 0.41% 132 67577 0.43% 133 71111 0.45% 134 75557 0.48% 135 79664 0.51% 136 83078 0.53% 137 87313 0.56% 138 91030 0.58% 139 95635 0.61% 140 101183 0.64% 141 109599 0.70% 142 121071 0.77% 143 132952 0.85% 144 152331 0.97% 145 179441 1.14% 146 216719 1.38% 147 285186 1.82% 148 414396 2.64% 149 772935 4.93% 150 3411318 21.74% 151 7726299 49.24% 15690889 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=231.15 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.8 sequence=CAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCAC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=35 prefix-density=0.45 prefix-fanout=2.4 sequence=AGGAGGTTTCCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=88.84 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.0 sequence=AGAGAGAAAGAAACAACATGTCGTCGACGACAAAACCAAAGGCAGTGAAGCACACTCTATTCGTGAAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTT SRR7166211 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 15 11:27:45 Started mapping on | Apr 15 11:27:45 Finished on | Apr 15 11:30:01 Mapping speed, Million of reads per hour | 415.35 Number of input reads | 15690889 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14464965 Uniquely mapped reads % | 92.19% Average mapped length | 291.69 Number of splices: Total | 13280320 Number of splices: Annotated (sjdb) | 13013119 Number of splices: GT/AG | 13051168 Number of splices: GC/AG | 175268 Number of splices: AT/AC | 11509 Number of splices: Non-canonical | 42375 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.24 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372994 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 44540 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861835 861835 861835 N_multimapping 372994 372994 372994 N_noFeature 496673 14267368 614021 N_ambiguous 161018 1507 79630 UnstrandedReadsAssigned:13807274 PositiveStrandReadsAssigned:196090 NegativeStrandReadsAssigned:13771314 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7166211 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7166211-trimmed-pair1.fastq SRR7166211-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,690,889 reads, 13,706,615 reads pseudoaligned [quant] estimated average fragment length: 227.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7166211.ke.tsv 34699 SRR7166211.se.tsv 87100 total ==> SRR7166211.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.78 949 38.9531 Potri.005G024800.1.v4.1 1035 808.775 144 13.0947 Potri.004G059700.1.v4.1 961 734.795 27 2.70245 Potri.007G009000.2.v4.1 1416 1189.78 0 0 Potri.003G141000.2.v4.1 2943 2716.78 492.53 13.3333 Potri.016G087400.1.v4.1 270 89.3724 879 723.345 Potri.015G069301.1.v4.1 564 342.268 0 0 Potri.010G195200.1.v4.1 1773 1546.78 364 17.3075 Potri.012G127500.1.v4.1 977 750.785 16575 1623.67 ==> SRR7166211.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 65 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 535 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 362 SRR7166211 completed mapping pipeline successfully