Starting /dee2/code/volunteer_pipeline.sh SRR7168823 current disk space = 3103187656704 free memory = 1482342548 SRR7168823 SRAfilesize f532650ae6c0aafb4ccbcba64ad652f5 SRR7168823.sra SRR7168823.sra file validated SRR7168823 is paired end SRR7168823 is conventional basespace SRR7168823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08275 34.0 33.0 34.0 32.0 34.0 2 33.229 34.0 33.0 34.0 32.0 34.0 3 33.35575 34.0 33.0 34.0 32.0 34.0 4 33.405 34.0 33.0 34.0 33.0 34.0 5 33.47375 34.0 34.0 34.0 33.0 34.0 6 37.281 38.0 38.0 38.0 36.0 38.0 7 37.42175 38.0 38.0 38.0 37.0 38.0 8 37.47125 38.0 38.0 38.0 37.0 38.0 9 37.48975 38.0 38.0 38.0 37.0 38.0 10-14 37.539249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.52645 38.0 38.0 38.0 38.0 38.0 20-24 37.44845 38.0 38.0 38.0 37.4 38.0 25-29 37.40985 38.0 38.0 38.0 37.0 38.0 30-34 37.4532 38.0 38.0 38.0 37.2 38.0 35-39 37.471999999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.441500000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.396550000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.358850000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.3482 38.0 38.0 38.0 37.0 38.0 60-64 37.24655 38.0 38.0 38.0 37.0 38.0 65-69 37.2016 38.0 38.0 38.0 36.6 38.0 70-74 37.19185 38.0 38.0 38.0 36.6 38.0 75-79 37.03785 38.0 38.0 38.0 36.2 38.0 80-84 36.92115 38.0 38.0 38.0 36.0 38.0 85-89 36.8806 38.0 38.0 38.0 36.0 38.0 90-94 36.804 38.0 38.0 38.0 35.6 38.0 95-99 36.706999999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.6342 38.0 38.0 38.0 35.0 38.0 105-109 36.5745 38.0 38.0 38.0 34.6 38.0 110-114 36.394850000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.22735 38.0 38.0 38.0 33.8 38.0 120-124 36.014399999999995 38.0 37.2 38.0 33.0 38.0 125-129 35.76255 38.0 36.8 38.0 32.6 38.0 130-134 35.402499999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.21865 38.0 36.0 38.0 29.8 38.0 140-144 34.766549999999995 38.0 35.8 38.0 27.8 38.0 145-149 34.028999999999996 38.0 34.0 38.0 25.2 38.0 150-151 29.4565 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 6.0 19 7.0 20 5.0 21 4.0 22 5.0 23 4.0 24 5.0 25 7.0 26 15.0 27 25.0 28 16.0 29 36.0 30 34.0 31 47.0 32 63.0 33 85.0 34 133.0 35 198.0 36 556.0 37 2742.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.00890518596124 13.88161341016239 10.7386066003143 38.370874803562074 2 21.349999999999998 18.099999999999998 33.25 27.3 3 20.0 23.674999999999997 25.6 30.725 4 22.825 31.775 21.7 23.7 5 20.915686765073804 36.22717037778334 23.767825869402053 19.089316987740805 6 17.974999999999998 35.85 26.474999999999998 19.7 7 13.725000000000001 26.450000000000003 40.45 19.375 8 17.325 27.05 30.075000000000003 25.55 9 17.4 24.8 33.525 24.275 10-14 20.035 29.759999999999998 26.939999999999998 23.265 15-19 19.905 28.810000000000002 27.66 23.625 20-24 19.545 29.645 27.38 23.43 25-29 20.075000000000003 28.389999999999997 27.555000000000003 23.98 30-34 19.905 28.444999999999997 28.125 23.525 35-39 19.62 29.2 27.405 23.775 40-44 19.77 28.975 28.035 23.22 45-49 19.93 28.89 27.395000000000003 23.785 50-54 20.169999999999998 28.33 27.77 23.73 55-59 19.895 28.494999999999997 27.884999999999998 23.724999999999998 60-64 20.630000000000003 28.605000000000004 27.315 23.45 65-69 20.599999999999998 28.89 26.82 23.69 70-74 20.315 29.12 27.155 23.41 75-79 20.345 28.33 27.334999999999997 23.990000000000002 80-84 20.169999999999998 28.33 27.639999999999997 23.86 85-89 20.345 28.225 27.794999999999998 23.635 90-94 20.575 28.439999999999998 27.060000000000002 23.925 95-99 20.46 28.660000000000004 27.565 23.315 100-104 20.830000000000002 28.249999999999996 27.439999999999998 23.48 105-109 20.715 28.38 27.345000000000002 23.56 110-114 20.41 28.675 27.284999999999997 23.630000000000003 115-119 20.5 28.294999999999998 27.584999999999997 23.62 120-124 20.755000000000003 28.185 27.029999999999998 24.03 125-129 21.065 28.265 26.815 23.855 130-134 20.47 28.48 26.47 24.58 135-139 21.105 28.335 26.435 24.125 140-144 20.74 28.235 26.87 24.154999999999998 145-149 20.3 28.084999999999997 26.724999999999998 24.89 150-151 20.57350363135487 27.635862759829706 27.73603806661658 24.054595542198847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 3.5 25 4.5 26 4.5 27 6.0 28 9.0 29 12.5 30 17.5 31 28.5 32 41.0 33 47.5 34 59.0 35 78.5 36 90.5 37 106.0 38 135.5 39 166.5 40 179.5 41 201.5 42 231.5 43 264.0 44 282.5 45 276.5 46 266.0 47 243.5 48 226.5 49 201.0 50 170.5 51 143.5 52 115.5 53 89.0 54 75.0 55 63.0 56 42.0 57 28.0 58 24.0 59 19.0 60 10.0 61 8.5 62 7.0 63 4.5 64 3.5 65 2.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64779874213836 99.02499999999999 2 0.3270440251572327 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTCCAATCTCGTATGC 13 0.325 TruSeq Adapter, Index 9 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 5.987500000000001 0.0 0.0 0.0 0.0 130-131 6.449999999999999 0.0 0.0 0.0 0.0 132-133 6.987500000000001 0.0 0.0 0.0 0.0 134-135 7.4875 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAAT 10 0.006836113 144.9625 6 >>END_MODULE SRR7168823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81275 33.0 33.0 34.0 32.0 34.0 2 32.8865 34.0 33.0 34.0 32.0 34.0 3 32.92375 34.0 33.0 34.0 32.0 34.0 4 32.94675 34.0 33.0 34.0 32.0 34.0 5 32.967 34.0 33.0 34.0 32.0 34.0 6 37.17825 38.0 38.0 38.0 37.0 38.0 7 37.1595 38.0 38.0 38.0 37.0 38.0 8 37.192 38.0 38.0 38.0 37.0 38.0 9 37.121 38.0 38.0 38.0 37.0 38.0 10-14 37.163149999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.11275 38.0 38.0 38.0 37.0 38.0 20-24 37.0495 38.0 38.0 38.0 37.0 38.0 25-29 36.92105 38.0 38.0 38.0 36.6 38.0 30-34 36.993550000000006 38.0 38.0 38.0 36.4 38.0 35-39 36.987199999999994 38.0 38.0 38.0 36.6 38.0 40-44 36.9951 38.0 38.0 38.0 36.6 38.0 45-49 36.912349999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.76885 38.0 38.0 38.0 36.0 38.0 55-59 36.68095 38.0 38.0 38.0 35.6 38.0 60-64 36.64149999999999 38.0 38.0 38.0 35.2 38.0 65-69 36.5262 38.0 38.0 38.0 35.0 38.0 70-74 36.3651 38.0 38.0 38.0 34.4 38.0 75-79 36.33480000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.0371 38.0 38.0 38.0 33.4 38.0 85-89 35.805550000000004 38.0 38.0 38.0 32.6 38.0 90-94 35.66465 38.0 37.0 38.0 31.4 38.0 95-99 35.544000000000004 38.0 37.0 38.0 31.0 38.0 100-104 35.3106 38.0 37.0 38.0 29.4 38.0 105-109 35.27135 38.0 37.0 38.0 29.4 38.0 110-114 34.8918 38.0 36.4 38.0 27.6 38.0 115-119 34.604150000000004 38.0 36.0 38.0 26.4 38.0 120-124 34.1223 38.0 35.0 38.0 23.6 38.0 125-129 33.8797 38.0 35.0 38.0 22.2 38.0 130-134 33.1616 38.0 33.6 38.0 16.0 38.0 135-139 32.23505 38.0 32.0 38.0 13.0 38.0 140-144 31.465099999999996 38.0 30.8 38.0 12.6 38.0 145-149 30.042499999999997 36.8 28.8 38.0 2.0 38.0 150-151 24.513875 31.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 1.0 5 1.0 6 3.0 7 1.0 8 2.0 9 2.0 10 4.0 11 5.0 12 4.0 13 2.0 14 7.0 15 5.0 16 9.0 17 18.0 18 4.0 19 7.0 20 13.0 21 14.0 22 17.0 23 14.0 24 25.0 25 24.0 26 23.0 27 37.0 28 32.0 29 47.0 30 66.0 31 71.0 32 90.0 33 118.0 34 214.0 35 363.0 36 735.0 37 2009.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.11411411411411 18.043043043043046 17.46746746746747 25.375375375375377 2 28.3496118206862 24.06711745554721 31.02930127723516 16.55396944653143 3 20.510894064613073 29.226145755071375 30.177811169546708 20.085149010768845 4 24.129290904535207 34.527687296416936 22.60085191681283 18.74216988223503 5 23.516153268219384 37.08990733784122 21.26220886551465 18.131730528424743 6 20.895895895895897 37.512512512512515 23.173173173173172 18.41841841841842 7 21.22122122122122 19.544544544544546 39.38938938938939 19.844844844844843 8 22.291718789091817 25.04378283712785 26.044533400050035 26.619964973730298 9 21.61621215911934 25.619214410808105 29.221916437327994 23.54265699274456 10-14 23.28595736162546 28.48563707336603 26.658993093784407 21.5694124712241 15-19 23.429601081135193 28.09950447970369 27.92432053656339 20.54657390259773 20-24 22.8743114672008 28.833249874812218 27.53630445668503 20.756134201301954 25-29 23.498772975409427 28.251615165022287 26.744127810887964 21.505484048680323 30-34 23.64164454905103 28.434072812859934 27.142070208823675 20.78221242926536 35-39 22.753231139164413 28.313796212804327 27.77276825969342 21.160204388337842 40-44 24.383164005805515 27.781392322706573 27.20084079875882 20.634602872729094 45-49 23.219380349366837 28.109514990740276 27.473847539916914 21.197257119975973 50-54 23.80857028434121 27.598117741289546 27.723267921505805 20.870044052863438 55-59 23.62571342745569 27.115249824772203 27.881245619305094 21.37779112846701 60-64 23.379872891958165 27.813641595356053 27.9737777110544 20.832707801631386 65-69 23.5588721390294 27.60554915610758 27.82090449241248 21.014674212450544 70-74 23.396264209524766 27.71295508037458 27.863187941309032 21.027592768791628 75-79 23.3335002754545 28.011218510542395 27.560474783392596 21.094806430610507 80-84 24.33501978660522 27.90161799328758 27.535941491759758 20.227420728347443 85-89 23.778746430181876 28.277969838168243 27.461295656094997 20.481988075554888 90-94 24.113936724068882 27.503003604325187 27.873448137765315 20.50961153384061 95-99 23.621535074552185 27.88451916341439 27.89952967076954 20.594416091263884 100-104 23.75900720576461 27.56705364291433 28.10748598879103 20.566453162530024 105-109 23.9015113602242 27.734961465318786 27.78500650585527 20.57852066860174 110-114 24.055068836045056 27.85481852315394 27.724655819774718 20.36545682102628 115-119 23.99979970957889 28.356116368734664 27.30459165790396 20.339492263782486 120-124 24.591806070319542 28.24802163678253 26.87568867074026 20.284483622157666 125-129 24.53548354785396 27.60054089247258 27.630590474282567 20.233385085390896 130-134 24.683005061895454 28.366661654888993 27.058587681050465 19.891745602165088 135-139 25.515928671608894 28.521338409136444 26.68302945301543 19.27970346623923 140-144 25.088869974465528 28.63365543483703 26.62594502578481 19.651529564912632 145-149 25.73444772533907 27.851458885941643 27.08573144487263 19.32836194384665 150-151 26.331582895723933 27.369342335583895 27.056764191047762 19.24231057764441 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.5 24 2.5 25 3.0 26 3.0 27 6.0 28 7.5 29 7.0 30 11.0 31 16.0 32 21.0 33 34.0 34 48.5 35 68.5 36 83.5 37 102.0 38 135.5 39 150.0 40 168.5 41 201.5 42 226.5 43 252.5 44 286.5 45 285.0 46 252.0 47 251.5 48 256.5 49 229.5 50 184.5 51 147.5 52 120.5 53 102.0 54 94.0 55 72.5 56 49.0 57 34.0 58 23.0 59 18.5 60 15.0 61 8.0 62 3.5 63 3.5 64 2.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.17500000000000002 4 0.22499999999999998 5 0.17500000000000002 6 0.1 7 0.1 8 0.075 9 0.075 10-14 0.09 15-19 0.105 20-24 0.15 25-29 0.165 30-34 0.155 35-39 0.19 40-44 0.095 45-49 0.105 50-54 0.12 55-59 0.13 60-64 0.08499999999999999 65-69 0.165 70-74 0.155 75-79 0.165 80-84 0.185 85-89 0.20500000000000002 90-94 0.12 95-99 0.06999999999999999 100-104 0.08 105-109 0.09 110-114 0.125 115-119 0.145 120-124 0.16999999999999998 125-129 0.165 130-134 0.23500000000000001 135-139 0.18 140-144 0.135 145-149 0.095 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41948510853105 98.475 2 0.47955577990913684 0.95 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.675 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.1625 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.7 0.0 0.0 0.0 0.0 138-139 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828070 spots for SRR7168823.sra Written 828070 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra Read 828059 spots for SRR7168823.sra Written 828059 spots for SRR7168823.sra SRR ids: ['SRR7168823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ie2mp30x SRR7168823.sra spots: 16561191 blocks: [[1, 828059], [828060, 1656118], [1656119, 2484177], [2484178, 3312236], [3312237, 4140295], [4140296, 4968354], [4968355, 5796413], [5796414, 6624472], [6624473, 7452531], [7452532, 8280590], [8280591, 9108649], [9108650, 9936708], [9936709, 10764767], [10764768, 11592826], [11592827, 12420885], [12420886, 13248944], [13248945, 14077003], [14077004, 14905062], [14905063, 15733121], [15733122, 16561191]] SRR7168823 file size 5590343 SRR7168823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168823 SRR7168823_1.fastq SRR7168823_2.fastq Input file: SRR7168823_1.fastq Paired file: SRR7168823_2.fastq trimmed: SRR7168823-trimmed-pair1.fastq, SRR7168823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 03:08:02 2025 >> started Sat Feb 15 03:08:20 2025 >> done (18.046s) 16561191 read pairs processed; of these: 22273 ( 0.13%) short read pairs filtered out after trimming by size control 88819 ( 0.54%) empty read pairs filtered out after trimming by size control 16450099 (99.33%) read pairs available; of these: 9167087 (55.73%) trimmed read pairs available after processing 7283012 (44.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 20 0.00% 20 6 0.00% 21 6 0.00% 22 4 0.00% 23 10 0.00% 24 32 0.00% 25 8 0.00% 26 9 0.00% 27 9 0.00% 28 11 0.00% 29 13 0.00% 30 18 0.00% 31 13 0.00% 32 11 0.00% 33 8 0.00% 34 16 0.00% 35 25 0.00% 36 22 0.00% 37 22 0.00% 38 27 0.00% 39 15 0.00% 40 29 0.00% 41 38 0.00% 42 43 0.00% 43 50 0.00% 44 49 0.00% 45 82 0.00% 46 81 0.00% 47 70 0.00% 48 83 0.00% 49 91 0.00% 50 122 0.00% 51 147 0.00% 52 124 0.00% 53 129 0.00% 54 192 0.00% 55 197 0.00% 56 202 0.00% 57 195 0.00% 58 282 0.00% 59 321 0.00% 60 327 0.00% 61 407 0.00% 62 452 0.00% 63 503 0.00% 64 577 0.00% 65 657 0.00% 66 642 0.00% 67 918 0.01% 68 1201 0.01% 69 3566 0.02% 70 2782 0.02% 71 1636 0.01% 72 1604 0.01% 73 1769 0.01% 74 1866 0.01% 75 2078 0.01% 76 2296 0.01% 77 2610 0.02% 78 2661 0.02% 79 3074 0.02% 80 3398 0.02% 81 3876 0.02% 82 4265 0.03% 83 5087 0.03% 84 6277 0.04% 85 7086 0.04% 86 7576 0.05% 87 7977 0.05% 88 8824 0.05% 89 9202 0.06% 90 10244 0.06% 91 10630 0.06% 92 11761 0.07% 93 12805 0.08% 94 13934 0.08% 95 14823 0.09% 96 15330 0.09% 97 16143 0.10% 98 16982 0.10% 99 17921 0.11% 100 19203 0.12% 101 20042 0.12% 102 21263 0.13% 103 22839 0.14% 104 23907 0.15% 105 25411 0.15% 106 26763 0.16% 107 27368 0.17% 108 28492 0.17% 109 29762 0.18% 110 30708 0.19% 111 31974 0.19% 112 33566 0.20% 113 35466 0.22% 114 36899 0.22% 115 38446 0.23% 116 40350 0.25% 117 41731 0.25% 118 42707 0.26% 119 43581 0.26% 120 45261 0.28% 121 47130 0.29% 122 48961 0.30% 123 51209 0.31% 124 54122 0.33% 125 55818 0.34% 126 58797 0.36% 127 60971 0.37% 128 62531 0.38% 129 64965 0.39% 130 67754 0.41% 131 69625 0.42% 132 73182 0.44% 133 76777 0.47% 134 81153 0.49% 135 86378 0.53% 136 90418 0.55% 137 96049 0.58% 138 102033 0.62% 139 107948 0.66% 140 116061 0.71% 141 125440 0.76% 142 138990 0.84% 143 154547 0.94% 144 175614 1.07% 145 207212 1.26% 146 254483 1.55% 147 334866 2.04% 148 490622 2.98% 149 919327 5.59% 150 3989762 24.25% 151 7283012 44.27% 16450099 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=380.35 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=60.49 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168823 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 03:09:09 Started mapping on | Feb 15 03:09:09 Finished on | Feb 15 03:10:47 Mapping speed, Million of reads per hour | 604.29 Number of input reads | 16450099 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15493924 Uniquely mapped reads % | 94.19% Average mapped length | 291.26 Number of splices: Total | 14393175 Number of splices: Annotated (sjdb) | 14053476 Number of splices: GT/AG | 14113279 Number of splices: GC/AG | 231200 Number of splices: AT/AC | 8247 Number of splices: Non-canonical | 40449 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390236 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 24901 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 583750 583750 583750 N_multimapping 390236 390236 390236 N_noFeature 525182 15174469 699254 N_ambiguous 251298 1508 104918 UnstrandedReadsAssigned:14717444 PositiveStrandReadsAssigned:317947 NegativeStrandReadsAssigned:14689752 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168823-trimmed-pair1.fastq SRR7168823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,450,099 reads, 14,695,946 reads pseudoaligned [quant] estimated average fragment length: 229.184 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7168823.ke.tsv 34699 SRR7168823.se.tsv 87100 total ==> SRR7168823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.82 427 16.2561 Potri.005G024800.1.v4.1 1035 806.816 92 7.76979 Potri.004G059700.1.v4.1 961 732.852 12 1.11573 Potri.007G009000.2.v4.1 1416 1187.82 0 0 Potri.003G141000.2.v4.1 2943 2714.82 932.442 23.4033 Potri.016G087400.1.v4.1 270 86.4022 621 489.737 Potri.015G069301.1.v4.1 564 339.726 0 0 Potri.010G195200.1.v4.1 1773 1544.82 3 0.132324 Potri.012G127500.1.v4.1 977 748.832 160 14.559 ==> SRR7168823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 130 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7168823 completed mapping pipeline successfully