Starting /dee2/code/volunteer_pipeline.sh SRR7168824 current disk space = 3103372779520 free memory = 1292903716 SRR7168824 SRAfilesize 1651831315e201ddd21a896464ff7453 SRR7168824.sra SRR7168824.sra file validated SRR7168824 is paired end SRR7168824 is conventional basespace SRR7168824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0855 34.0 33.0 34.0 32.0 34.0 2 33.116 34.0 33.0 34.0 32.0 34.0 3 33.16175 34.0 33.0 34.0 31.0 34.0 4 33.19975 34.0 33.0 34.0 33.0 34.0 5 33.3265 34.0 33.0 34.0 33.0 34.0 6 36.94625 38.0 37.0 38.0 36.0 38.0 7 37.23725 38.0 38.0 38.0 36.0 38.0 8 37.42575 38.0 38.0 38.0 37.0 38.0 9 37.4185 38.0 38.0 38.0 37.0 38.0 10-14 37.4303 38.0 38.0 38.0 37.0 38.0 15-19 37.45485 38.0 38.0 38.0 37.0 38.0 20-24 37.39265 38.0 38.0 38.0 37.0 38.0 25-29 37.26845 38.0 38.0 38.0 37.0 38.0 30-34 37.31545 38.0 38.0 38.0 37.0 38.0 35-39 37.3266 38.0 38.0 38.0 37.0 38.0 40-44 37.26545 38.0 38.0 38.0 37.0 38.0 45-49 37.21765 38.0 38.0 38.0 37.0 38.0 50-54 37.2001 38.0 38.0 38.0 36.6 38.0 55-59 37.2141 38.0 38.0 38.0 36.6 38.0 60-64 37.11625 38.0 38.0 38.0 36.0 38.0 65-69 37.04644999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.87205 38.0 38.0 38.0 35.6 38.0 75-79 36.819100000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.69185 38.0 38.0 38.0 35.0 38.0 85-89 36.657 38.0 38.0 38.0 34.8 38.0 90-94 36.4741 38.0 38.0 38.0 34.2 38.0 95-99 36.32935 38.0 38.0 38.0 34.0 38.0 100-104 36.2898 38.0 37.6 38.0 33.8 38.0 105-109 36.09435 38.0 37.4 38.0 33.4 38.0 110-114 35.88305 38.0 37.0 38.0 32.2 38.0 115-119 35.8076 38.0 37.0 38.0 31.8 38.0 120-124 35.49195 38.0 36.0 38.0 31.0 38.0 125-129 35.1667 38.0 36.0 38.0 28.8 38.0 130-134 34.8669 38.0 35.0 38.0 27.6 38.0 135-139 34.42915 38.0 34.8 38.0 25.8 38.0 140-144 33.745850000000004 38.0 33.6 38.0 22.2 38.0 145-149 32.73864999999999 38.0 33.4 38.0 15.2 38.0 150-151 28.45525 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 5.0 16 1.0 17 3.0 18 4.0 19 4.0 20 5.0 21 6.0 22 5.0 23 5.0 24 11.0 25 17.0 26 16.0 27 23.0 28 34.0 29 46.0 30 43.0 31 62.0 32 74.0 33 95.0 34 162.0 35 296.0 36 753.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.15480844409695 12.144904873599167 12.718269481365652 36.98201720093823 2 22.225 19.825 32.35 25.6 3 19.950000000000003 25.575 25.4 29.075 4 21.099999999999998 32.7 22.900000000000002 23.3 5 20.560280140070038 36.19309654827414 24.262131065532767 18.98449224612306 6 19.0 37.3 25.2 18.5 7 13.55 23.525 42.5 20.424999999999997 8 17.875 24.349999999999998 30.075000000000003 27.700000000000003 9 17.424999999999997 24.8 32.925 24.85 10-14 19.86 29.654999999999998 27.279999999999998 23.205000000000002 15-19 20.015 28.115000000000002 28.165000000000003 23.705000000000002 20-24 19.35 29.225 28.084999999999997 23.34 25-29 20.28 28.970000000000002 27.22 23.53 30-34 19.439999999999998 28.835 28.465 23.26 35-39 19.905 28.74 27.705000000000002 23.65 40-44 19.925 28.735 27.99 23.35 45-49 20.165 28.575 27.67 23.59 50-54 20.635 28.915000000000003 27.245 23.205000000000002 55-59 19.16 29.125 27.965 23.75 60-64 19.895 28.205000000000002 28.7 23.200000000000003 65-69 20.25 28.915000000000003 27.445000000000004 23.39 70-74 20.549999999999997 28.63 27.52 23.3 75-79 19.97 28.64 27.43 23.96 80-84 20.61 28.285 27.54 23.565 85-89 20.349999999999998 27.994999999999997 28.105000000000004 23.549999999999997 90-94 20.23 28.28 28.015 23.474999999999998 95-99 20.49 28.050000000000004 27.68 23.78 100-104 20.36 27.839999999999996 27.515 24.285 105-109 20.32 28.705000000000002 27.245 23.73 110-114 20.52 29.03 26.715 23.735 115-119 20.575 28.720000000000002 27.250000000000004 23.455000000000002 120-124 20.7 28.915000000000003 26.625 23.76 125-129 20.47 28.485 27.42 23.625 130-134 20.39 29.189999999999998 26.35 24.07 135-139 20.93 29.12 26.555 23.395 140-144 21.07 28.7 26.015 24.215 145-149 20.5 28.549999999999997 26.834999999999997 24.115000000000002 150-151 20.987189148455162 29.037930168299418 26.07385079125848 23.901029891986937 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.0 22 1.0 23 3.5 24 4.0 25 2.5 26 4.5 27 9.5 28 10.5 29 13.5 30 14.5 31 24.0 32 46.5 33 49.5 34 58.0 35 83.0 36 98.5 37 109.0 38 131.5 39 163.0 40 203.0 41 235.0 42 253.0 43 268.0 44 255.0 45 245.5 46 268.5 47 259.5 48 229.5 49 194.0 50 151.5 51 126.0 52 110.5 53 93.5 54 68.0 55 56.0 56 43.0 57 32.5 58 22.5 59 14.5 60 11.5 61 6.0 62 5.0 63 3.5 64 3.5 65 2.5 66 1.5 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.7249999999999996 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.925000000000001 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.6125 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 8.0 0.0 0.0 0.0 0.0 134-135 8.6625 0.0 0.0 0.0 0.0 136-137 9.2875 0.0 0.0 0.0 0.0 138-139 9.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9345 33.0 33.0 34.0 32.0 34.0 2 33.0085 34.0 33.0 34.0 32.0 34.0 3 33.0875 34.0 33.0 34.0 32.0 34.0 4 32.98325 34.0 33.0 34.0 32.0 34.0 5 33.01975 34.0 33.0 34.0 32.0 34.0 6 37.3345 38.0 38.0 38.0 37.0 38.0 7 37.271 38.0 38.0 38.0 37.0 38.0 8 37.18975 38.0 38.0 38.0 37.0 38.0 9 37.25475 38.0 38.0 38.0 37.0 38.0 10-14 37.22605 38.0 38.0 38.0 37.0 38.0 15-19 37.170249999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.120050000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.1182 38.0 38.0 38.0 37.0 38.0 30-34 37.0809 38.0 38.0 38.0 37.0 38.0 35-39 37.085 38.0 38.0 38.0 37.0 38.0 40-44 37.056200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.028 38.0 38.0 38.0 37.0 38.0 50-54 36.908550000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.836650000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.8601 38.0 38.0 38.0 36.0 38.0 65-69 36.796899999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.79445 38.0 38.0 38.0 36.0 38.0 75-79 36.644349999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.5198 38.0 38.0 38.0 34.8 38.0 85-89 36.39745 38.0 38.0 38.0 34.2 38.0 90-94 36.32905 38.0 38.0 38.0 34.0 38.0 95-99 36.17815 38.0 38.0 38.0 33.8 38.0 100-104 36.083800000000004 38.0 38.0 38.0 33.8 38.0 105-109 35.89020000000001 38.0 37.8 38.0 32.6 38.0 110-114 35.75605 38.0 37.2 38.0 31.8 38.0 115-119 35.458600000000004 38.0 37.0 38.0 30.6 38.0 120-124 35.1402 38.0 36.4 38.0 29.0 38.0 125-129 34.75715 38.0 36.0 38.0 27.4 38.0 130-134 34.4566 38.0 35.4 38.0 25.2 38.0 135-139 33.80755 38.0 34.2 38.0 22.2 38.0 140-144 32.95115 38.0 33.0 38.0 15.4 38.0 145-149 31.863049999999998 38.0 32.6 38.0 8.4 38.0 150-151 27.396875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 2.0 5 4.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 7.0 17 7.0 18 4.0 19 4.0 20 13.0 21 12.0 22 11.0 23 20.0 24 16.0 25 23.0 26 22.0 27 28.0 28 33.0 29 42.0 30 31.0 31 57.0 32 66.0 33 98.0 34 166.0 35 252.0 36 613.0 37 2448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.10952738184546 19.629907476869217 15.378844711177795 26.881720430107524 2 25.74430823117338 26.99524643482612 32.02401801351013 15.236427320490368 3 20.965724293219914 30.372779584688516 30.147610708031024 18.513885414060546 4 23.885828743114672 35.82874311467201 22.458688032048073 17.826740110165247 5 25.95095095095095 35.33533533533533 21.346346346346344 17.36736736736737 6 20.090067550662997 37.378033525143856 24.468351263447584 18.06354766074556 7 20.190142606955217 19.189392044033024 40.30522892169127 20.31523642732049 8 21.766324743557668 24.49337002752064 28.021015761821367 25.719289467100324 9 22.016512384288216 24.86865148861646 29.271953965474108 23.842882161621215 10-14 23.671570099069346 28.970279195436806 26.148303812668868 21.209846892824977 15-19 23.41309571485783 28.218862635162196 28.133760512615137 20.23428113736484 20-24 22.895066366140746 27.84372652141247 28.159278737791134 21.10192837465565 25-29 22.673807497872765 28.09950447970369 28.46488813253917 20.761799889884376 30-34 22.1554186081467 28.192795230221957 28.618668269953407 21.03311789167794 35-39 23.251152535578274 27.90138304269393 28.31729805572259 20.53016636600521 40-44 23.788060897435898 27.44891826923077 27.954727564102566 20.808293269230766 45-49 22.743881075128886 27.8342259372341 28.419840832874517 21.002052154762502 50-54 23.013013013013012 27.56756756756757 28.313313313313316 21.106106106106107 55-59 23.239753790722116 27.938747935745383 27.63849271881099 21.18300555472151 60-64 22.837127845884414 28.3112334250688 27.655741806354765 21.19589692269202 65-69 23.47255608974359 27.884615384615387 28.014823717948715 20.628004807692307 70-74 23.509668369902815 27.882977657549347 27.943091874561667 20.664262097986175 75-79 23.263732411997395 27.68514345801412 27.94051374493015 21.110610385058333 80-84 23.350381066987566 28.22904131568392 27.8529883674288 20.56758924989972 85-89 24.065537629020945 27.68313458262351 27.773323980358754 20.478003807996796 90-94 23.556801682271068 28.158013317979275 27.972763230360986 20.312421769388674 95-99 22.989943463251112 28.443488267373795 27.627958172812328 20.938610096562766 100-104 23.686317685917327 28.025222700430387 27.704934440996897 20.58352517265539 105-109 23.821675172620836 28.109676773741622 27.499249474632244 20.569398579005306 110-114 23.615349977485366 28.073247610947117 27.92815329964477 20.383249111922748 115-119 23.7284741690028 28.298958750500603 27.578093712454947 20.39447336804165 120-124 23.527054108216433 28.246492985971944 27.86573146292585 20.360721442885772 125-129 24.60675283037772 27.86794910329626 27.001302474701934 20.523995591624086 130-134 24.838370169899264 27.72014233448604 27.50964767202927 19.931839823585427 135-139 25.397143573039337 28.198446504635427 27.000751691305435 19.403658231019794 140-144 24.678444522296182 28.422000900855814 26.95560782743606 19.943946749411943 145-149 25.957255117873768 27.629010460984034 26.878222133239905 19.5355122879023 150-151 25.05 28.712500000000002 27.3375 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 2.0 26 2.0 27 3.0 28 6.0 29 13.0 30 19.0 31 25.0 32 31.5 33 38.5 34 50.0 35 67.0 36 87.5 37 113.0 38 146.0 39 177.5 40 201.5 41 220.0 42 245.0 43 269.5 44 276.5 45 268.5 46 265.0 47 255.5 48 222.5 49 190.5 50 165.0 51 134.0 52 111.5 53 92.0 54 69.5 55 61.5 56 47.5 57 31.5 58 24.5 59 16.5 60 11.5 61 9.0 62 9.0 63 5.0 64 2.0 65 1.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.075 4 0.15 5 0.1 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.06999999999999999 15-19 0.12 20-24 0.17500000000000002 25-29 0.105 30-34 0.20500000000000002 35-39 0.22 40-44 0.16 45-49 0.105 50-54 0.1 55-59 0.08499999999999999 60-64 0.075 65-69 0.16 70-74 0.19 75-79 0.145 80-84 0.27999999999999997 85-89 0.21 90-94 0.135 95-99 0.065 100-104 0.09 105-109 0.06999999999999999 110-114 0.065 115-119 0.12 120-124 0.2 125-129 0.19 130-134 0.23500000000000001 135-139 0.22499999999999998 140-144 0.095 145-149 0.105 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0750000000000002 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.8375000000000004 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 3.9749999999999996 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.800000000000001 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.887499999999999 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 7.1625 0.0 0.0 0.0 0.0 132-133 7.8625 0.0 0.0 0.0 0.0 134-135 8.5375 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138-139 9.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAGA 10 0.00682755 145.0 1 ATGCATT 10 0.00682755 145.0 8 >>END_MODULE Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra Read 825906 spots for SRR7168824.sra Written 825906 spots for SRR7168824.sra SRR ids: ['SRR7168824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3gsn7ric SRR7168824.sra spots: 16518120 blocks: [[1, 825906], [825907, 1651812], [1651813, 2477718], [2477719, 3303624], [3303625, 4129530], [4129531, 4955436], [4955437, 5781342], [5781343, 6607248], [6607249, 7433154], [7433155, 8259060], [8259061, 9084966], [9084967, 9910872], [9910873, 10736778], [10736779, 11562684], [11562685, 12388590], [12388591, 13214496], [13214497, 14040402], [14040403, 14866308], [14866309, 15692214], [15692215, 16518120]] SRR7168824 file size 5575748 SRR7168824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168824 SRR7168824_1.fastq SRR7168824_2.fastq Input file: SRR7168824_1.fastq Paired file: SRR7168824_2.fastq trimmed: SRR7168824-trimmed-pair1.fastq, SRR7168824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:52:42 2025 >> started Sat Feb 15 02:53:05 2025 >> done (22.639s) 16518120 read pairs processed; of these: 19431 ( 0.12%) short read pairs filtered out after trimming by size control 44310 ( 0.27%) empty read pairs filtered out after trimming by size control 16454379 (99.61%) read pairs available; of these: 8889209 (54.02%) trimmed read pairs available after processing 7565170 (45.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 6 0.00% 21 5 0.00% 22 9 0.00% 23 9 0.00% 24 6 0.00% 25 8 0.00% 26 14 0.00% 27 11 0.00% 28 14 0.00% 29 8 0.00% 30 14 0.00% 31 10 0.00% 32 19 0.00% 33 17 0.00% 34 14 0.00% 35 32 0.00% 36 29 0.00% 37 17 0.00% 38 23 0.00% 39 30 0.00% 40 32 0.00% 41 54 0.00% 42 50 0.00% 43 58 0.00% 44 78 0.00% 45 63 0.00% 46 70 0.00% 47 82 0.00% 48 101 0.00% 49 100 0.00% 50 124 0.00% 51 156 0.00% 52 148 0.00% 53 180 0.00% 54 200 0.00% 55 188 0.00% 56 248 0.00% 57 263 0.00% 58 320 0.00% 59 350 0.00% 60 387 0.00% 61 450 0.00% 62 511 0.00% 63 593 0.00% 64 648 0.00% 65 729 0.00% 66 827 0.01% 67 830 0.01% 68 965 0.01% 69 1786 0.01% 70 1751 0.01% 71 1540 0.01% 72 1635 0.01% 73 1883 0.01% 74 2094 0.01% 75 2347 0.01% 76 2551 0.02% 77 2774 0.02% 78 3029 0.02% 79 3271 0.02% 80 3814 0.02% 81 4424 0.03% 82 4986 0.03% 83 5651 0.03% 84 6896 0.04% 85 7555 0.05% 86 8204 0.05% 87 8746 0.05% 88 9261 0.06% 89 9836 0.06% 90 10573 0.06% 91 11795 0.07% 92 12649 0.08% 93 13912 0.08% 94 15365 0.09% 95 16006 0.10% 96 16989 0.10% 97 17599 0.11% 98 18297 0.11% 99 19028 0.12% 100 19986 0.12% 101 21246 0.13% 102 23185 0.14% 103 24671 0.15% 104 26003 0.16% 105 27717 0.17% 106 28671 0.17% 107 29511 0.18% 108 30135 0.18% 109 31503 0.19% 110 32478 0.20% 111 33413 0.20% 112 35325 0.21% 113 37491 0.23% 114 39035 0.24% 115 41266 0.25% 116 42479 0.26% 117 43474 0.26% 118 44167 0.27% 119 45214 0.27% 120 45788 0.28% 121 47208 0.29% 122 49757 0.30% 123 52277 0.32% 124 54353 0.33% 125 56805 0.35% 126 59118 0.36% 127 60411 0.37% 128 61750 0.38% 129 63300 0.38% 130 65034 0.40% 131 66836 0.41% 132 69353 0.42% 133 73592 0.45% 134 76305 0.46% 135 80780 0.49% 136 84846 0.52% 137 88964 0.54% 138 92921 0.56% 139 97999 0.60% 140 103708 0.63% 141 110595 0.67% 142 120757 0.73% 143 134203 0.82% 144 153900 0.94% 145 181029 1.10% 146 222623 1.35% 147 296826 1.80% 148 444215 2.70% 149 863101 5.25% 150 3998528 24.30% 151 7565170 45.98% 16454379 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=12.68 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.8 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=17 prefix-density=0.62 prefix-fanout=2.3 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=74.17 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7168824 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:54:18 Started mapping on | Feb 15 02:54:18 Finished on | Feb 15 02:56:22 Mapping speed, Million of reads per hour | 477.71 Number of input reads | 16454379 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15191587 Uniquely mapped reads % | 92.33% Average mapped length | 290.93 Number of splices: Total | 14377482 Number of splices: Annotated (sjdb) | 14029968 Number of splices: GT/AG | 14100745 Number of splices: GC/AG | 220716 Number of splices: AT/AC | 8550 Number of splices: Non-canonical | 47471 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486906 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 91393 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.03% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 789761 789761 789761 N_multimapping 486906 486906 486906 N_noFeature 602902 14882335 781165 N_ambiguous 251187 1646 119086 UnstrandedReadsAssigned:14337498 PositiveStrandReadsAssigned:307606 NegativeStrandReadsAssigned:14291336 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168824-trimmed-pair1.fastq SRR7168824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,454,379 reads, 14,356,219 reads pseudoaligned [quant] estimated average fragment length: 227.305 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7168824.ke.tsv 34699 SRR7168824.se.tsv 87100 total ==> SRR7168824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.69 1467 56.3996 Potri.005G024800.1.v4.1 1035 808.695 225 19.1649 Potri.004G059700.1.v4.1 961 734.721 9 0.843781 Potri.007G009000.2.v4.1 1416 1189.69 0 0 Potri.003G141000.2.v4.1 2943 2716.69 1040.24 26.3756 Potri.016G087400.1.v4.1 270 87.7427 885 694.772 Potri.015G069301.1.v4.1 564 341.679 0 0 Potri.010G195200.1.v4.1 1773 1546.69 548.948 24.4476 Potri.012G127500.1.v4.1 977 750.706 332 30.4634 ==> SRR7168824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 708 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 185 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7168824 completed mapping pipeline successfully